ID: 959840346

View in Genome Browser
Species Human (GRCh38)
Location 3:110967805-110967827
Sequence TCAACTTGAACACTTTGGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959840344_959840346 1 Left 959840344 3:110967781-110967803 CCGATTGGAGGCACTTCGGTGTA No data
Right 959840346 3:110967805-110967827 TCAACTTGAACACTTTGGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959840346 Original CRISPR TCAACTTGAACACTTTGGAA TGG Intergenic
No off target data available for this crispr