ID: 959840347

View in Genome Browser
Species Human (GRCh38)
Location 3:110967833-110967855
Sequence GCTCCAGATCTCATCCTCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959840344_959840347 29 Left 959840344 3:110967781-110967803 CCGATTGGAGGCACTTCGGTGTA No data
Right 959840347 3:110967833-110967855 GCTCCAGATCTCATCCTCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959840347 Original CRISPR GCTCCAGATCTCATCCTCCA AGG Intergenic
No off target data available for this crispr