ID: 959840348

View in Genome Browser
Species Human (GRCh38)
Location 3:110967834-110967856
Sequence CTCCAGATCTCATCCTCCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959840344_959840348 30 Left 959840344 3:110967781-110967803 CCGATTGGAGGCACTTCGGTGTA No data
Right 959840348 3:110967834-110967856 CTCCAGATCTCATCCTCCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959840348 Original CRISPR CTCCAGATCTCATCCTCCAA GGG Intergenic
No off target data available for this crispr