ID: 959840440

View in Genome Browser
Species Human (GRCh38)
Location 3:110968815-110968837
Sequence TTGTAAATCAAAAAGCAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959840440_959840445 -4 Left 959840440 3:110968815-110968837 CCTTCCTGCTTTTTGATTTACAA No data
Right 959840445 3:110968834-110968856 ACAATAGCTCTAACTTGGTGGGG No data
959840440_959840443 -6 Left 959840440 3:110968815-110968837 CCTTCCTGCTTTTTGATTTACAA No data
Right 959840443 3:110968832-110968854 TTACAATAGCTCTAACTTGGTGG No data
959840440_959840444 -5 Left 959840440 3:110968815-110968837 CCTTCCTGCTTTTTGATTTACAA No data
Right 959840444 3:110968833-110968855 TACAATAGCTCTAACTTGGTGGG No data
959840440_959840442 -9 Left 959840440 3:110968815-110968837 CCTTCCTGCTTTTTGATTTACAA No data
Right 959840442 3:110968829-110968851 GATTTACAATAGCTCTAACTTGG No data
959840440_959840446 26 Left 959840440 3:110968815-110968837 CCTTCCTGCTTTTTGATTTACAA No data
Right 959840446 3:110968864-110968886 ACAATTAATTTCCCCCCAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959840440 Original CRISPR TTGTAAATCAAAAAGCAGGA AGG (reversed) Intergenic
No off target data available for this crispr