ID: 959847061

View in Genome Browser
Species Human (GRCh38)
Location 3:111045651-111045673
Sequence ACTCACGATTAGGGTTGTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959847061_959847067 5 Left 959847061 3:111045651-111045673 CCCTGACAACCCTAATCGTGAGT No data
Right 959847067 3:111045679-111045701 GGCCTCTGAGTCTGTGCCTCAGG No data
959847061_959847069 12 Left 959847061 3:111045651-111045673 CCCTGACAACCCTAATCGTGAGT No data
Right 959847069 3:111045686-111045708 GAGTCTGTGCCTCAGGATTCCGG No data
959847061_959847071 24 Left 959847061 3:111045651-111045673 CCCTGACAACCCTAATCGTGAGT No data
Right 959847071 3:111045698-111045720 CAGGATTCCGGAGTAGATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959847061 Original CRISPR ACTCACGATTAGGGTTGTCA GGG (reversed) Intergenic
No off target data available for this crispr