ID: 959847062

View in Genome Browser
Species Human (GRCh38)
Location 3:111045652-111045674
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959847062_959847071 23 Left 959847062 3:111045652-111045674 CCTGACAACCCTAATCGTGAGTC No data
Right 959847071 3:111045698-111045720 CAGGATTCCGGAGTAGATGAAGG No data
959847062_959847069 11 Left 959847062 3:111045652-111045674 CCTGACAACCCTAATCGTGAGTC No data
Right 959847069 3:111045686-111045708 GAGTCTGTGCCTCAGGATTCCGG No data
959847062_959847067 4 Left 959847062 3:111045652-111045674 CCTGACAACCCTAATCGTGAGTC No data
Right 959847067 3:111045679-111045701 GGCCTCTGAGTCTGTGCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959847062 Original CRISPR GACTCACGATTAGGGTTGTC AGG (reversed) Intergenic