ID: 959847067

View in Genome Browser
Species Human (GRCh38)
Location 3:111045679-111045701
Sequence GGCCTCTGAGTCTGTGCCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959847062_959847067 4 Left 959847062 3:111045652-111045674 CCTGACAACCCTAATCGTGAGTC No data
Right 959847067 3:111045679-111045701 GGCCTCTGAGTCTGTGCCTCAGG No data
959847061_959847067 5 Left 959847061 3:111045651-111045673 CCCTGACAACCCTAATCGTGAGT No data
Right 959847067 3:111045679-111045701 GGCCTCTGAGTCTGTGCCTCAGG No data
959847066_959847067 -5 Left 959847066 3:111045661-111045683 CCTAATCGTGAGTCAGAGGGCCT No data
Right 959847067 3:111045679-111045701 GGCCTCTGAGTCTGTGCCTCAGG No data
959847065_959847067 -4 Left 959847065 3:111045660-111045682 CCCTAATCGTGAGTCAGAGGGCC No data
Right 959847067 3:111045679-111045701 GGCCTCTGAGTCTGTGCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959847067 Original CRISPR GGCCTCTGAGTCTGTGCCTC AGG Intergenic
No off target data available for this crispr