ID: 959847069

View in Genome Browser
Species Human (GRCh38)
Location 3:111045686-111045708
Sequence GAGTCTGTGCCTCAGGATTC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959847061_959847069 12 Left 959847061 3:111045651-111045673 CCCTGACAACCCTAATCGTGAGT No data
Right 959847069 3:111045686-111045708 GAGTCTGTGCCTCAGGATTCCGG No data
959847066_959847069 2 Left 959847066 3:111045661-111045683 CCTAATCGTGAGTCAGAGGGCCT No data
Right 959847069 3:111045686-111045708 GAGTCTGTGCCTCAGGATTCCGG No data
959847062_959847069 11 Left 959847062 3:111045652-111045674 CCTGACAACCCTAATCGTGAGTC No data
Right 959847069 3:111045686-111045708 GAGTCTGTGCCTCAGGATTCCGG No data
959847065_959847069 3 Left 959847065 3:111045660-111045682 CCCTAATCGTGAGTCAGAGGGCC No data
Right 959847069 3:111045686-111045708 GAGTCTGTGCCTCAGGATTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959847069 Original CRISPR GAGTCTGTGCCTCAGGATTC CGG Intergenic
No off target data available for this crispr