ID: 959847071

View in Genome Browser
Species Human (GRCh38)
Location 3:111045698-111045720
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959847065_959847071 15 Left 959847065 3:111045660-111045682 CCCTAATCGTGAGTCAGAGGGCC No data
Right 959847071 3:111045698-111045720 CAGGATTCCGGAGTAGATGAAGG No data
959847062_959847071 23 Left 959847062 3:111045652-111045674 CCTGACAACCCTAATCGTGAGTC No data
Right 959847071 3:111045698-111045720 CAGGATTCCGGAGTAGATGAAGG No data
959847068_959847071 -6 Left 959847068 3:111045681-111045703 CCTCTGAGTCTGTGCCTCAGGAT No data
Right 959847071 3:111045698-111045720 CAGGATTCCGGAGTAGATGAAGG No data
959847061_959847071 24 Left 959847061 3:111045651-111045673 CCCTGACAACCCTAATCGTGAGT No data
Right 959847071 3:111045698-111045720 CAGGATTCCGGAGTAGATGAAGG No data
959847066_959847071 14 Left 959847066 3:111045661-111045683 CCTAATCGTGAGTCAGAGGGCCT No data
Right 959847071 3:111045698-111045720 CAGGATTCCGGAGTAGATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type