ID: 959849831

View in Genome Browser
Species Human (GRCh38)
Location 3:111072401-111072423
Sequence CGCGCGGGTCGCCGTGCGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 52
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 49}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959849819_959849831 -2 Left 959849819 3:111072380-111072402 CCCGCTGCCCTCCCCCGCGGCCG 0: 1
1: 0
2: 6
3: 64
4: 515
Right 959849831 3:111072401-111072423 CGCGCGGGTCGCCGTGCGGATGG 0: 1
1: 0
2: 0
3: 2
4: 49
959849824_959849831 -10 Left 959849824 3:111072388-111072410 CCTCCCCCGCGGCCGCGCGGGTC 0: 1
1: 0
2: 4
3: 35
4: 326
Right 959849831 3:111072401-111072423 CGCGCGGGTCGCCGTGCGGATGG 0: 1
1: 0
2: 0
3: 2
4: 49
959849813_959849831 25 Left 959849813 3:111072353-111072375 CCAGGCCAGCGAATGCTGAGCCG 0: 1
1: 0
2: 0
3: 4
4: 71
Right 959849831 3:111072401-111072423 CGCGCGGGTCGCCGTGCGGATGG 0: 1
1: 0
2: 0
3: 2
4: 49
959849823_959849831 -9 Left 959849823 3:111072387-111072409 CCCTCCCCCGCGGCCGCGCGGGT 0: 1
1: 0
2: 1
3: 18
4: 144
Right 959849831 3:111072401-111072423 CGCGCGGGTCGCCGTGCGGATGG 0: 1
1: 0
2: 0
3: 2
4: 49
959849817_959849831 5 Left 959849817 3:111072373-111072395 CCGGCGGCCCGCTGCCCTCCCCC 0: 1
1: 0
2: 8
3: 93
4: 874
Right 959849831 3:111072401-111072423 CGCGCGGGTCGCCGTGCGGATGG 0: 1
1: 0
2: 0
3: 2
4: 49
959849820_959849831 -3 Left 959849820 3:111072381-111072403 CCGCTGCCCTCCCCCGCGGCCGC 0: 1
1: 0
2: 8
3: 109
4: 831
Right 959849831 3:111072401-111072423 CGCGCGGGTCGCCGTGCGGATGG 0: 1
1: 0
2: 0
3: 2
4: 49
959849816_959849831 20 Left 959849816 3:111072358-111072380 CCAGCGAATGCTGAGCCGGCGGC 0: 1
1: 0
2: 0
3: 8
4: 53
Right 959849831 3:111072401-111072423 CGCGCGGGTCGCCGTGCGGATGG 0: 1
1: 0
2: 0
3: 2
4: 49

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959849831 Original CRISPR CGCGCGGGTCGCCGTGCGGA TGG Intronic
905058647 1:35120935-35120957 CCTGGGGGTCGCCGTGCGGCGGG - Intergenic
912716872 1:111989526-111989548 CGCGCGGGGCGCCGGGCGCGGGG - Intergenic
912878954 1:113390404-113390426 CGCGCCGGGCGCCGCGCGGCGGG + Intergenic
922287572 1:224183384-224183406 GGCGCCGGTCGGCGTGCGGCTGG - Exonic
1065483860 10:26217894-26217916 CCCGCGGGCCGCCGCCCGGAAGG + Exonic
1072169782 10:92848388-92848410 CGCGCGGAACGCCGGGCAGAAGG - Intronic
1077043743 11:535484-535506 CGCGCGGTTCGCCCCGCGCATGG + Exonic
1089262398 11:117232141-117232163 CGCGGGGGTCGCCGGGCCGCAGG - Exonic
1092462438 12:8698214-8698236 AGCGCGGGCCGCCGGGCGGCTGG - Exonic
1117253135 14:53954679-53954701 CGCGTGGGTCGCTCTGCGCAAGG + Intronic
1122982157 14:105196780-105196802 CGCGCCGGGCGCCGCGGGGAGGG - Intergenic
1126137157 15:45403080-45403102 CGCGCGGGTAGCGGAGCGGGAGG - Exonic
1132478479 16:154098-154120 TGCGCGGGGCGCGGTGCGGGCGG + Intronic
1132480564 16:164688-164710 TGCGCGGGGCGCGGTGCGGGCGG + Intronic
1155392467 18:25351041-25351063 CGCGAGGGAGGCCGAGCGGAGGG - Intronic
1160690982 19:460664-460686 CGCGGGGGTCGCGGGGCGGGCGG - Exonic
1160868497 19:1266582-1266604 CGGGCGGGGCCCCGTGGGGAGGG + Intronic
1161610430 19:5238974-5238996 CGAGCGGGCCGCCAGGCGGAAGG + Exonic
1163427195 19:17246044-17246066 CGCGCGCGGCGCCGGGCGAACGG + Intronic
1168307196 19:55442225-55442247 CGCACGGGACGCCTTGCTGAAGG + Exonic
1168404705 19:56104479-56104501 GGCACGGGTCGGCGTGCGTAGGG - Intronic
1168722658 19:58562773-58562795 CGCGCGGCGCGCCGTGCTGCTGG - Exonic
928420938 2:31137666-31137688 CGCGAGGGTCCCGGGGCGGAGGG - Intronic
941110433 2:161414841-161414863 CGCGCGGCTCGGCGTCCGGGAGG + Intergenic
942748629 2:179264358-179264380 TGCGCGGGCCGCGGGGCGGAGGG - Intronic
1169214797 20:3786667-3786689 CGGGCGCGTCGCCGGGCGGCGGG + Exonic
1174017758 20:47502272-47502294 CGAGGGGGTCCCCGCGCGGAGGG + Intronic
1176148054 20:63574156-63574178 CGCGGGGGTCCCAGGGCGGAGGG - Intronic
1176157098 20:63627297-63627319 CGCGCGGGCGGCCGGGCCGAGGG + Intergenic
1183931384 22:41237916-41237938 CGCGCGGAGGGCCGCGCGGAGGG + Exonic
950683869 3:14602871-14602893 CGCGCGGCGCGGGGTGCGGAGGG - Intergenic
959849831 3:111072401-111072423 CGCGCGGGTCGCCGTGCGGATGG + Intronic
961389105 3:126541939-126541961 CGCGCGGGTCGCCGCGGGCTTGG - Exonic
968010635 3:195271632-195271654 CGCGCCGGAGGCCGAGCGGAGGG + Intergenic
984811136 4:183797494-183797516 CCCGCGGGTCGCTGCGGGGAAGG - Intergenic
985073694 4:186191969-186191991 GGCGCGGGCCACCGTGGGGATGG - Exonic
992939826 5:81751111-81751133 TGCGTGGGTCGCCATGGGGACGG - Exonic
998156023 5:139787738-139787760 CGCACGGGTCCCCGTGCAGCGGG - Intergenic
1004664084 6:17735275-17735297 CGGGCGGCTCGCCGGGCGGGGGG + Intergenic
1011193942 6:84763656-84763678 GGCGCGGGTCGCCGAGTGGGCGG + Intronic
1018754738 6:166839171-166839193 CGCGCGGGTCCCCCAGCGGGTGG - Intronic
1019404588 7:876929-876951 GCCGCGGGTCGCCCGGCGGAGGG + Intronic
1019693941 7:2434098-2434120 CGGGCGGGTGGGCGGGCGGAGGG - Exonic
1022207707 7:28180102-28180124 CGCGCGGGGCGCGGGGCGGAGGG - Intronic
1035404348 7:158588046-158588068 CGCGCGGGGCGGGGGGCGGACGG - Intergenic
1037855416 8:22367663-22367685 AGCGTGGGTCGCCGCGCCGAAGG + Intronic
1051840846 9:21396233-21396255 AGCGCGGGTCTCCTTGAGGAAGG + Intergenic
1053206593 9:36191242-36191264 CCGGCGGCTCGCCGTGCGGCTGG - Exonic
1059102428 9:111483600-111483622 CTCGCGGCTCGCGGTGCGGCAGG + Intronic
1061123187 9:128656712-128656734 CGCGCGGGTTGCCATGGAGACGG + Exonic
1061128213 9:128689744-128689766 CGCGGGGGGCGCCGGGCGGGGGG + Intronic
1198321452 X:135521743-135521765 CGCGAGGGTCGCCGCGCGGGGGG + Intronic