ID: 959850462

View in Genome Browser
Species Human (GRCh38)
Location 3:111080948-111080970
Sequence GAGTTTAGACAGATAAAACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 245}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959850462 Original CRISPR GAGTTTAGACAGATAAAACA GGG Intronic
900896902 1:5489244-5489266 GAATTAGGACAGATACAACAGGG + Intergenic
901261104 1:7871532-7871554 GAGTGAAGATAAATAAAACAAGG - Intergenic
906779885 1:48563928-48563950 GACTTTCGACAGACAAATCAAGG - Intronic
906897913 1:49799615-49799637 GATTTTAGAGTGAAAAAACAAGG + Intronic
909550883 1:76897394-76897416 GGTTTTAGACAGATAAAATGGGG + Intronic
910220512 1:84885270-84885292 GAGATGAGACATATAATACAGGG + Intronic
910633459 1:89381379-89381401 TAGTTTACACAGATAAAATGAGG - Intronic
910975298 1:92900213-92900235 GAGTTCAGAAAGAGAAAAGAAGG - Intronic
911239584 1:95450292-95450314 GAGGATAGACAGAAAAATCAGGG - Intergenic
911818138 1:102381050-102381072 GAGTTGAGTAAGATAAAGCAAGG - Intergenic
913149736 1:116029010-116029032 CAGTTTAGAAAGAGAGAACATGG - Intronic
916504001 1:165411242-165411264 GAATGTTGACAGATGAAACAAGG + Intronic
917330752 1:173878156-173878178 CAGTTAGGACAGATAAAACTAGG - Intronic
917619972 1:176785748-176785770 GAGAGTAGACAGATCAAACTTGG - Intronic
918479569 1:184964024-184964046 GAGATTAGACAAATAAACCAAGG + Intronic
918653335 1:186993409-186993431 GAGTGAAGAAAGATAAAAGAGGG - Intergenic
919886643 1:201939927-201939949 GAGGATAGACAGATAAGACCGGG + Intronic
919996059 1:202751696-202751718 ATGTTTATACAGATAATACAAGG - Intronic
920806118 1:209235516-209235538 ATGTTTAGACAGATTGAACATGG + Intergenic
922607273 1:226897454-226897476 GTGTTAAGACTGAGAAAACAAGG + Intergenic
922609447 1:226913707-226913729 GAGGTTACACAGCTAACACATGG - Intronic
924103264 1:240625701-240625723 GAGTATTTACAGATAGAACATGG + Intergenic
924862649 1:247941380-247941402 GAGTTTAGATATATAAAGAATGG + Intronic
1064845438 10:19647178-19647200 GACTTTTTCCAGATAAAACAGGG - Intronic
1065782482 10:29183004-29183026 GAGATTAGATAAAGAAAACATGG - Intergenic
1066071792 10:31823155-31823177 GGGTTTAGAAAGAAATAACATGG - Intronic
1066437068 10:35405139-35405161 GTTTTTGGACAGGTAAAACAGGG + Intronic
1066624796 10:37395615-37395637 GGGATTAGATAGATCAAACAAGG + Intergenic
1069142531 10:64844270-64844292 GGGATTAGAGAGATAAAACTAGG + Intergenic
1072203367 10:93180789-93180811 GGGTTTTGACAGATTAAAGATGG - Intergenic
1072290934 10:93963690-93963712 CAGTTGAGACAGATAATACCAGG - Intergenic
1073947699 10:108769942-108769964 AAGTTTAGGGAGATAAAATAAGG + Intergenic
1074284872 10:112088658-112088680 GATATTAGAGAGAAAAAACAGGG - Intergenic
1075746854 10:124733995-124734017 GAGTTTAGACAGATGAAGAACGG - Intronic
1076147732 10:128137897-128137919 GAGCTTGTACAGCTAAAACATGG - Intergenic
1077816665 11:5692532-5692554 GAGTTTAGACAAATAAGAAGTGG + Intronic
1079773328 11:24492284-24492306 CAGTTTAGATAGATTATACAAGG + Intergenic
1079852085 11:25547286-25547308 AAGCTTAGACATATATAACAAGG + Intergenic
1080190283 11:29537238-29537260 AAGGTTACACAGATAAAACATGG + Intergenic
1080285035 11:30600966-30600988 AAGTTTACACAGCTAACACATGG - Intergenic
1080755582 11:35194279-35194301 GAGTCTGGAAAGATAAAACCAGG + Intronic
1084529500 11:69718579-69718601 GAGTTTAGACACAGAAAGCAGGG - Intergenic
1084676958 11:70640961-70640983 AGGTTCAGACAGCTAAAACATGG + Intronic
1084782761 11:71421594-71421616 GAGTGTAGCCAGATCAAACCAGG + Intergenic
1085905639 11:80758623-80758645 GATTTTAGTCAGACAAAAGAAGG + Intergenic
1086982914 11:93218273-93218295 GAGATTAGAAAGATAGAAAAAGG + Intergenic
1089484909 11:118837798-118837820 GAGTGTAGATAGATACAATAGGG + Intergenic
1093193874 12:16107188-16107210 GAGTTTGAAAAGAAAAAACATGG + Intergenic
1095495319 12:42778007-42778029 GAGTCTAGAAAAATAGAACATGG - Intergenic
1096612559 12:52812452-52812474 GAGTATAGATATTTAAAACAAGG + Intronic
1098651975 12:72982868-72982890 TAATTTAGAGAGATAAATCATGG - Intergenic
1099350936 12:81567514-81567536 GAGTTTAGTCAAATATTACATGG - Intronic
1104608547 12:130207615-130207637 GAGTTCAGAGAAATAAAACAAGG + Intergenic
1105626769 13:22120388-22120410 TAATTTAGACAGATCAAAAACGG - Intergenic
1105723676 13:23140488-23140510 GAATTTTCACAGTTAAAACATGG - Intergenic
1106095345 13:26638350-26638372 CAGTTTAGAGAGATAAAACCTGG - Intronic
1106440159 13:29759474-29759496 GAGTTTGGATATATAAATCAAGG - Intergenic
1106542894 13:30705719-30705741 GAGTTTAGAAAAAAAAAAAAAGG + Intergenic
1106953637 13:34911985-34912007 GAGGTGATAAAGATAAAACAAGG - Intergenic
1106953868 13:34913950-34913972 TAGGTTAGACTGAGAAAACAAGG - Intergenic
1107516333 13:41132955-41132977 GAGTGTCGTCAGCTAAAACAAGG - Intergenic
1108784591 13:53880720-53880742 GAGATTAGATAGAAACAACAGGG + Intergenic
1109092794 13:58070050-58070072 GAGTTTAGGCAGAAGAACCACGG - Intergenic
1109657996 13:65419930-65419952 GAGTATGGAAACATAAAACAAGG - Intergenic
1110086111 13:71382016-71382038 GAGTTTAAAAAGAAAAAAGAAGG - Intergenic
1110094272 13:71496700-71496722 GAATATATACAGATAAAAAAAGG + Intronic
1111839283 13:93429095-93429117 GACATTATACAGATAAAAGAGGG + Intronic
1112121685 13:96419395-96419417 GAGCCTAGACAGAGAAAAGATGG + Intronic
1114999210 14:28401331-28401353 GAGTGCAGACAGATAAGAGAAGG + Intergenic
1115144834 14:30214588-30214610 GAATTTTGACAGATACAAAACGG - Intergenic
1115840629 14:37465983-37466005 GAGTTAAATTAGATAAAACAAGG + Intronic
1116505712 14:45677818-45677840 GAGCTTAGCCACATAGAACAGGG - Intergenic
1116561235 14:46381938-46381960 GAGTTTACACATATAACCCAGGG + Intergenic
1117013990 14:51499754-51499776 GAGTTTATACAGATCACCCAAGG - Intronic
1117318677 14:54599398-54599420 GAGTTTAAAAAGAAAAAATAAGG - Intronic
1119449638 14:74698054-74698076 GAATTTCTAAAGATAAAACATGG + Intronic
1119938205 14:78612804-78612826 GAGTTTCCACAGCTAAAACTGGG - Intronic
1120003342 14:79328563-79328585 AAGTTTAGAGAGAGAAACCATGG - Intronic
1121217046 14:92256326-92256348 CAGTTTTGACAGATATACCAAGG - Intergenic
1121824364 14:96998584-96998606 AAGTTCAGACAGACAAAAAAAGG - Intergenic
1129033180 15:72632857-72632879 TGGTCTAGACAAATAAAACATGG - Intergenic
1129216704 15:74104373-74104395 TGGTCTAGACAAATAAAACATGG + Intronic
1129407970 15:75331712-75331734 TGGTCTAGACAAATAAAACATGG - Intergenic
1129471134 15:75754491-75754513 TGGTCTAGACAAATAAAACATGG - Intergenic
1129733870 15:77948686-77948708 TGGTCTAGACAAATAAAACATGG + Intergenic
1129841714 15:78747317-78747339 TGGTCTAGACAAATAAAACATGG - Intergenic
1130645206 15:85719418-85719440 GAGCTTACACAGATAATAAATGG - Intronic
1133517364 16:6522478-6522500 GAAATTAGACAGTTAAAAGATGG + Intronic
1137016299 16:35378842-35378864 AAGATTAAACAGTTAAAACATGG - Intergenic
1137016676 16:35384089-35384111 AAGATTAAACAGTTAAAACATGG - Intergenic
1138736469 16:59256500-59256522 GAATTTAGAGAGATGAAAGAGGG + Intergenic
1140692964 16:77502022-77502044 GAGTTTCTGCAGACAAAACAAGG + Intergenic
1143044635 17:4067652-4067674 GAGTTTATATATTTAAAACATGG + Intronic
1143414212 17:6734268-6734290 GTTTTTGGACAGGTAAAACAGGG + Intergenic
1147499401 17:40948433-40948455 GGTTTTAGAGAGATAATACATGG + Intergenic
1149144049 17:53468443-53468465 GAATTTAGAAACAAAAAACAAGG + Intergenic
1149351081 17:55788100-55788122 GAGTTTAGATATATAAAATTCGG - Intronic
1150964446 17:69951867-69951889 GAGTTTTGACCAATAAAACATGG - Intergenic
1153033888 18:740635-740657 GAGTTTGGACAGATTATAAAGGG + Intronic
1153747421 18:8194119-8194141 GTGTTTAGACACATAAAATAAGG - Intronic
1155194456 18:23460053-23460075 GAGATTGGAAAGATAAATCAGGG + Intronic
1155456139 18:26016373-26016395 AAGTTTGAACAGATAAATCATGG - Exonic
1155861623 18:30908636-30908658 GAGTTTAGTAAGATGAAAGAAGG + Intergenic
1156787097 18:40928571-40928593 GAGGGTGGACAGATAAATCATGG - Intergenic
1156808143 18:41212403-41212425 GGGTTTTGAGAGTTAAAACAAGG - Intergenic
1157370869 18:47110098-47110120 GAGTTTAGGCAGAGAAAACTGGG - Intronic
1159138919 18:64369375-64369397 GAGTGCAGACAGATAAGAGAAGG + Intergenic
1167675198 19:50879681-50879703 GAGTTCAAACAGATACAGCATGG + Exonic
925643650 2:6012129-6012151 GAGAGTAGAGAGAGAAAACAGGG + Intergenic
926876697 2:17488307-17488329 GATTTTAGGAAGATAAAACATGG + Intergenic
927740699 2:25566961-25566983 GAGGTCAGACAGCTTAAACAAGG + Intronic
929870570 2:45755675-45755697 GAGGATAGACAGAGAAATCAAGG - Intronic
930067249 2:47337039-47337061 GACTCTAAACAGATAACACAGGG + Intergenic
933195836 2:79388509-79388531 AAGTTAAGAAATATAAAACAAGG + Intronic
933442408 2:82329699-82329721 GAGTATAGACAGGTAAAGAAAGG - Intergenic
934803477 2:97193010-97193032 GAGTATAGCCAGAGAAAACAAGG + Exonic
934803764 2:97196745-97196767 GGGTATAGCCAGAGAAAACAAGG + Exonic
934804181 2:97202350-97202372 GGGTATAGCCAGAGAAAACAAGG + Exonic
934804457 2:97206092-97206114 GAGTATAGCCAGAGAAAACAAGG + Exonic
936767389 2:115869899-115869921 GAGTTGAGATTAATAAAACAAGG + Intergenic
938655733 2:133431285-133431307 CAGTTTAAATATATAAAACATGG - Intronic
938920943 2:135994123-135994145 GAGTTTATGCAAATAATACATGG + Intergenic
939803316 2:146740463-146740485 GTGTTGAGAAATATAAAACATGG + Intergenic
940493513 2:154394770-154394792 GTGTTTGGGCAGAAAAAACAAGG - Intronic
943802220 2:192075414-192075436 GAGTTTAAACAAAGACAACATGG + Intronic
943957681 2:194213729-194213751 CAGTATAGTCAGATAAAATAGGG + Intergenic
947353036 2:229266268-229266290 AAGTTTAGACAAAAAAAAAATGG - Intronic
947475194 2:230439880-230439902 ATTTTTAGAGAGATAAAACAAGG - Intronic
948473557 2:238202699-238202721 GCGTTTTGACAGATGAAACCCGG + Intronic
948723124 2:239913714-239913736 CAGTGTTGACAGATCAAACATGG - Intronic
1169672263 20:8115667-8115689 AAGTTTAGAGTGAAAAAACAAGG + Intergenic
1170554933 20:17507325-17507347 GGATATAGAGAGATAAAACAAGG + Intronic
1173275120 20:41573792-41573814 AAGTGAAGACAGAGAAAACATGG + Intronic
1173645740 20:44632112-44632134 GAGTTTAGACAGAGCAGCCAGGG + Intronic
1178787247 21:35665001-35665023 AAGTTTATACTGATAAACCATGG - Intronic
1184486133 22:44780756-44780778 AAGTCTACAAAGATAAAACATGG - Intronic
950444621 3:13029360-13029382 GGGTTAATACAGATAGAACATGG + Intronic
950761505 3:15233498-15233520 GAGTTTAGAGAGAGAAAGAATGG + Intronic
951647747 3:24912261-24912283 GAGATCAGATAGATAAAACATGG - Intergenic
952304442 3:32133331-32133353 TAGTAATGACAGATAAAACAAGG - Intronic
953211361 3:40877923-40877945 AAGTTCTGCCAGATAAAACAAGG - Intergenic
953282006 3:41567941-41567963 TAGTTTTGATAGATACAACACGG - Intronic
955003877 3:54951758-54951780 GAGTTAAGTAAGATAACACAGGG + Intronic
956058808 3:65329122-65329144 GAATTGAGACAGAGAAAAGAAGG - Intergenic
957315930 3:78576592-78576614 GAGTTTAGGCAAAGAAGACATGG - Intergenic
959850462 3:111080948-111080970 GAGTTTAGACAGATAAAACAGGG + Intronic
959876341 3:111386748-111386770 TATTTTAAACTGATAAAACAAGG - Intronic
962543552 3:136408804-136408826 AAGTCTAGACAGATAAAAAATGG + Intronic
963432523 3:145227996-145228018 GAAAGTAGACAGATATAACAAGG + Intergenic
963530987 3:146473086-146473108 GTGTCTAGACAGATATAATAAGG - Intronic
964396944 3:156255657-156255679 ATTGTTAGACAGATAAAACAAGG - Intronic
964524839 3:157607335-157607357 TGGTTTAGGCAGATAAAATAGGG - Intronic
965117258 3:164506756-164506778 AATTTTAGAAAAATAAAACAAGG + Intergenic
965252276 3:166357121-166357143 GATTAGAGACAGATAAAAAATGG - Intergenic
965551396 3:169968078-169968100 GAGTTCAGACAGATAAGACTAGG + Intronic
965919849 3:173899463-173899485 GAGTCTAGCTAGATTAAACAAGG + Intronic
965931571 3:174049934-174049956 GAGTTAAGACTGATAAAAGAGGG + Intronic
966657086 3:182371495-182371517 GAATTTATACAGGTGAAACATGG + Intergenic
968687799 4:1973201-1973223 CAGTTAAGATAAATAAAACAGGG + Intronic
969325704 4:6442644-6442666 GAGTTAATTCATATAAAACACGG - Intronic
969954511 4:10874763-10874785 GAATGTAGACAGATACAAAACGG - Intergenic
970855252 4:20643955-20643977 GAGCTTAGAAAGATAATAGATGG + Intergenic
971279088 4:25226504-25226526 GAGTTAATACAGACGAAACAAGG - Intronic
971672955 4:29587555-29587577 GATTTTAGACATAGAAAATACGG + Intergenic
971991701 4:33906493-33906515 GGGTTTGGACAGATAAATAATGG - Intergenic
972142146 4:35974166-35974188 GAGTTGAGACAGAGAAGAAAAGG + Intronic
972164957 4:36272277-36272299 GATTTTTGACAGATGACACAAGG + Intergenic
972207301 4:36790985-36791007 GAGTTTAGACAAGAAAGACAAGG - Intergenic
972873253 4:43326757-43326779 CAGTTTAGATAGTTAAAACTTGG - Intergenic
973590483 4:52436027-52436049 AAGTTCAGACAGAAAAGACAAGG - Intergenic
974962193 4:68717092-68717114 GAGTGTAGTAAGCTAAAACATGG + Intergenic
975332779 4:73137307-73137329 GTGTTGAGACAGGTTAAACAGGG + Intronic
976027250 4:80704097-80704119 GAGTTTTGATAGAAAAAACCTGG + Intronic
976288278 4:83391051-83391073 TAGTTTAGACAGACAGACCATGG + Intergenic
977201645 4:94123132-94123154 TAGATTAGATAGATAAAAGAGGG + Intergenic
977588025 4:98796621-98796643 GAGCTTTTAAAGATAAAACATGG + Intergenic
977594889 4:98867576-98867598 GAGTTCAGACAGATAATACCAGG + Intergenic
978436897 4:108695291-108695313 GAGGTTAGAAAGATAACACAGGG + Intergenic
978552425 4:109941688-109941710 GATTTTATACAGATAAAACAGGG - Intronic
979028260 4:115605096-115605118 GAGTTGAGAAAGAAAATACAAGG + Intergenic
980002263 4:127503708-127503730 GTGTTAAAACAGATAAAAGAAGG - Intergenic
980294920 4:130900585-130900607 GAGTTGTGACAAATAAAATATGG + Intergenic
980373863 4:131916470-131916492 GAGTTGAGACAGTAGAAACAAGG - Intergenic
982894528 4:160901688-160901710 AAGTTTAGGCAGAAAGAACATGG + Intergenic
983897706 4:173099393-173099415 GAGTTCAGACATCTAAAACTTGG + Intergenic
984003355 4:174278780-174278802 GCTTTTATACAAATAAAACAAGG + Intronic
984542195 4:181053103-181053125 GAATTTACACAGATAACAAATGG - Intergenic
984967314 4:185150909-185150931 AAGTATAAACACATAAAACAAGG + Intergenic
986188643 5:5471597-5471619 GAGTTTATCCTGATAAAACAAGG + Intronic
986299116 5:6464579-6464601 GAGGTTGGAAAGAAAAAACAAGG + Intronic
991933030 5:71774133-71774155 CAGATTGGACAAATAAAACATGG + Intergenic
992213115 5:74500398-74500420 GAGTCTAGACAAACAAATCACGG - Intergenic
992570522 5:78051507-78051529 GAGATTCGAAAAATAAAACATGG + Intronic
992732651 5:79688954-79688976 AAGAGTAGACAGGTAAAACATGG + Intergenic
993693660 5:91034619-91034641 GAGTGGAGAGAGATAATACAGGG - Intronic
995379969 5:111520892-111520914 AAATTTAAACAGATAAAACCAGG + Intergenic
996036963 5:118769182-118769204 GAGTTCAGAAAAATGAAACAGGG + Intergenic
996676558 5:126181877-126181899 CAGTTTAGATATATAAAATAAGG - Intergenic
997573435 5:134953166-134953188 GAGTTTAGTCTTATAAAACATGG + Intronic
997838038 5:137212299-137212321 GAGAGTAGAGAGAAAAAACAGGG + Intronic
998535629 5:142928279-142928301 ATTTTAAGACAGATAAAACATGG + Intronic
999824764 5:155263507-155263529 AAGTTTAGGCAGATAAAGAATGG - Intergenic
999837339 5:155388584-155388606 GAGCTTACACAAATATAACATGG - Intergenic
1000472773 5:161666625-161666647 GATTTGTGACAGATAAAATATGG - Intronic
1000847240 5:166297025-166297047 GAGTGTAGACAGAGAAAAGATGG - Intergenic
1000989743 5:167899570-167899592 AAGGTTACACAGATAAAACGTGG + Intronic
1002146982 5:177191863-177191885 CACTTTAGACAGACAAAACATGG - Exonic
1005050323 6:21678204-21678226 GTGACTAGACAGACAAAACATGG - Intergenic
1006150599 6:31985080-31985102 GAGTGTTTACAGATAAGACAGGG + Intronic
1006156900 6:32017818-32017840 GAGTGTTTACAGATAAGACAGGG + Intronic
1008157515 6:48034737-48034759 GAGTTTATTCTGATAAAATATGG - Intronic
1008745519 6:54665381-54665403 TTGTTGAGACAGAGAAAACAGGG - Intergenic
1009321002 6:62287895-62287917 GAGTTAAGAAAGAGAATACAAGG + Intergenic
1009845472 6:69129089-69129111 GAGTGTAGAGGGTTAAAACATGG - Intronic
1010600102 6:77814314-77814336 GAGTCCAGAGAGATAAAACAGGG + Intronic
1011027941 6:82889964-82889986 GATTTTAGAGACATAAAAAAGGG + Intergenic
1011184065 6:84654821-84654843 TAGTTCTGACAGAGAAAACATGG - Intergenic
1011230717 6:85158670-85158692 CATTTTAGGCAGATAAAACTTGG - Intergenic
1014294275 6:119599483-119599505 GAGTTGTGACAGATATTACATGG + Intergenic
1015630246 6:135225031-135225053 GTGTTTAGACAGAAAACACAGGG - Intergenic
1015956902 6:138608430-138608452 CAGTTGAAACAGATAAAAAATGG + Intronic
1016186900 6:141208344-141208366 TAGTTTAGACTGATAAAAACTGG - Intergenic
1016261536 6:142176473-142176495 GAGTTGTGAAAGATGAAACAAGG - Intronic
1016445116 6:144123754-144123776 GAGTTCAGACAGGAAAAATAAGG - Intergenic
1018274025 6:162110954-162110976 GAGTTGAGACAGACAAAAAGTGG + Intronic
1020817268 7:12921284-12921306 AATTTTAGACATACAAAACATGG + Intergenic
1020908725 7:14101056-14101078 GTGTTTAGGCAGAGACAACAGGG - Intergenic
1021672655 7:23047431-23047453 AAATTTAGACAGAAAAAATATGG + Intergenic
1022069156 7:26894028-26894050 GAGCAAAGACAGAAAAAACATGG + Intronic
1023289809 7:38657168-38657190 GAGTTTAGACATGAAAAAAAAGG - Intergenic
1023578085 7:41651323-41651345 GATTTTGGAGAGATAAACCAAGG + Intergenic
1024739105 7:52336269-52336291 GTTTTTAGACAGGTAAAATAGGG + Intergenic
1027911336 7:84255313-84255335 CAGTTTAGAGAGATATAAAATGG - Intronic
1028085591 7:86632936-86632958 GTGTTTGGAAATATAAAACAAGG + Intergenic
1029366680 7:100120857-100120879 TAGTTGGGACAGATAAACCAAGG - Intronic
1029797830 7:102913914-102913936 GAGTTGAAACAGATTAAATATGG + Intronic
1030162034 7:106518688-106518710 GAGTTTGGAGAGAGAAAAGAGGG - Intergenic
1031159627 7:118150817-118150839 GAGTATAGATAGAAAAAACAAGG + Intergenic
1032625278 7:133585232-133585254 GAAGTTACACAGATAACACAAGG - Intronic
1034716789 7:153250713-153250735 GAGATAAGACAGATTAACCAAGG - Intergenic
1036018363 8:4812984-4813006 GAGTTTTAACAGATAAATAAGGG - Intronic
1036020019 8:4834142-4834164 TAATTCATACAGATAAAACAAGG + Intronic
1039578914 8:38648038-38648060 GAGTTTGAAGAGAGAAAACAAGG + Intergenic
1039738336 8:40356312-40356334 GAGTTTTGGCAGATATAAGAGGG + Intergenic
1040777483 8:51063507-51063529 GAATTTATACAGAAAAAAAATGG - Intergenic
1043297893 8:78689059-78689081 AAGTTTAGACAAGTAAAACTGGG + Intronic
1044215473 8:89604445-89604467 GAGTGTAGGCTAATAAAACACGG - Intergenic
1045180202 8:99772688-99772710 CAGTATACACATATAAAACAGGG - Intronic
1050818838 9:9852070-9852092 GAGACCAGACATATAAAACAAGG + Intronic
1051040032 9:12797405-12797427 GTTTTTAGACAGCTAAAACTTGG - Intronic
1052125368 9:24767921-24767943 GAGTCTAGAAAAATAAAAGATGG - Intergenic
1053638846 9:40046702-40046724 GAGTTGAGACAGTAGAAACAAGG - Intergenic
1053767236 9:41418500-41418522 GAGTTGAGACAGTAGAAACAAGG + Intergenic
1054319642 9:63643272-63643294 GAGTTGAGACAGTAGAAACAAGG - Intergenic
1054545905 9:66330001-66330023 GAGTTGAGACAGTAGAAACAAGG + Intergenic
1056511075 9:87306390-87306412 AAGTTTAGATAGCTTAAACAAGG - Intergenic
1059184530 9:112255665-112255687 GAGGTTTGAGAGATAAACCAGGG - Intronic
1059661872 9:116409460-116409482 GATTTTAGAAAAATAAAAGAAGG + Intergenic
1202786718 9_KI270719v1_random:30303-30325 GAGTTGAGACAGTAGAAACAAGG - Intergenic
1203730773 Un_GL000216v2:87532-87554 GTGCTTAGACAAATAAAAGAGGG + Intergenic
1185835599 X:3344004-3344026 GAATTGAGAAAGATGAAACATGG + Intronic
1188244994 X:27828905-27828927 GCGATTAGACAGTTAAAACAGGG + Intergenic
1190968962 X:55330514-55330536 GAGTTTGGTCTGATAAAATATGG - Intergenic
1191227397 X:58058220-58058242 GACTTTAGACACACAGAACAGGG - Intergenic
1192547696 X:72027475-72027497 GAGTTTAGGAAGAAAAAAGAAGG + Intergenic
1194413577 X:93582877-93582899 GAGTCTTGAAAGATAAAAGAGGG - Intergenic
1195362715 X:104100394-104100416 GAGTTGAGACCAATAAAATAAGG - Exonic
1196102940 X:111866405-111866427 AGATTTAGACAGATTAAACAGGG - Intronic
1196347014 X:114674819-114674841 GAGTTTAGAGGCAGAAAACATGG - Intronic
1197340815 X:125264802-125264824 GATATTAGAGGGATAAAACATGG + Intergenic
1199269612 X:145867395-145867417 CAGATTAGACAAAGAAAACATGG - Intergenic
1201241092 Y:11957015-11957037 GAATTGAGAAAGATGAAACATGG - Intergenic
1202594833 Y:26526748-26526770 AAAATTAGACAGATTAAACAAGG + Intergenic