ID: 959851236

View in Genome Browser
Species Human (GRCh38)
Location 3:111089709-111089731
Sequence CTTGAAAAAATTGCCTTTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 402
Summary {0: 1, 1: 1, 2: 2, 3: 32, 4: 366}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959851235_959851236 12 Left 959851235 3:111089674-111089696 CCAATATGCAGTCAGTTTTGGCA 0: 1
1: 0
2: 1
3: 11
4: 161
Right 959851236 3:111089709-111089731 CTTGAAAAAATTGCCTTTGTTGG 0: 1
1: 1
2: 2
3: 32
4: 366
959851234_959851236 13 Left 959851234 3:111089673-111089695 CCCAATATGCAGTCAGTTTTGGC 0: 1
1: 0
2: 1
3: 43
4: 925
Right 959851236 3:111089709-111089731 CTTGAAAAAATTGCCTTTGTTGG 0: 1
1: 1
2: 2
3: 32
4: 366

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959851236 Original CRISPR CTTGAAAAAATTGCCTTTGT TGG Intronic
900706288 1:4082318-4082340 CTTCCAAATATTCCCTTTGTGGG + Intergenic
901260856 1:7869514-7869536 CTTGAAAATGCTGCCTTTCTAGG + Intergenic
903828495 1:26161359-26161381 CTTGACATACTTGGCTTTGTCGG - Exonic
904169627 1:28582276-28582298 CTTGAATAAATCGCCTTTCGGGG - Intergenic
905517080 1:38569823-38569845 CCTGGAAAAGCTGCCTTTGTGGG - Intergenic
906677792 1:47705774-47705796 GGGGAAAAAATTGCCTGTGTTGG - Intergenic
906737454 1:48144548-48144570 CCTGATAAGATTCCCTTTGTAGG - Intergenic
906759559 1:48363648-48363670 ATTGAAAGTATTGCATTTGTGGG - Intronic
907876992 1:58500116-58500138 TTAGAAAAAATTGCTTTTGAGGG - Intronic
909198745 1:72661317-72661339 CATGTAAAAATTGCCACTGTTGG + Intergenic
909412233 1:75367850-75367872 TGGGAAAAAAATGCCTTTGTGGG - Intronic
909418681 1:75437557-75437579 CTGGAAGAACTTGTCTTTGTGGG + Intronic
909893188 1:81033838-81033860 ATTTAAAAAATTGCGTTAGTAGG + Intergenic
910070257 1:83205738-83205760 TTTTAAAAAATTGTCTTTCTGGG + Intergenic
910506625 1:87956719-87956741 CTTGAAGTAATTACTTTTGTTGG + Intergenic
911020935 1:93387030-93387052 CTTGAAAAAACTGCATGTTTTGG + Intergenic
911598878 1:99826490-99826512 CTTACAAAAATTTCATTTGTAGG - Intergenic
916779286 1:168007623-168007645 CTTGAAACACTTTCCTTTCTTGG + Intronic
918272976 1:182921139-182921161 CTTGATAGGATTCCCTTTGTAGG - Intronic
918369534 1:183845772-183845794 CTTGAAAAACTGGCCATGGTTGG - Intronic
919235972 1:194843042-194843064 CTTCAAAAATTTTCCTTTGCTGG + Intergenic
920118407 1:203637477-203637499 CTACATGAAATTGCCTTTGTAGG - Intronic
920154844 1:203940105-203940127 CTTGAAATAATTACCTGTGGTGG + Intergenic
921914997 1:220597642-220597664 CTTGAACAAATTGCTTTATTTGG + Intronic
921917691 1:220630778-220630800 TTTGAAAATATTCCCTTTGAAGG + Intronic
922389426 1:225124360-225124382 TTTGAAAGAATTTCCATTGTGGG - Intronic
1062954217 10:1529634-1529656 ATTTAAAAAATAGCCCTTGTTGG + Intronic
1063144153 10:3281231-3281253 CTTCACAAAATTGCCTTTCATGG + Intergenic
1064370788 10:14750300-14750322 CTTTAAAAAAATGCTTTTCTAGG - Intronic
1065092620 10:22250702-22250724 CCTTAAAAAATTTCCTTTCTTGG - Intergenic
1065624014 10:27612443-27612465 CTTGCAAACACAGCCTTTGTAGG - Intergenic
1065656028 10:27950992-27951014 CTTGAAAAAAGTTCCCATGTCGG + Intronic
1066719044 10:38317976-38317998 CTGGAAAAAATTGGCATAGTTGG + Intergenic
1068543480 10:58321847-58321869 CTTTATAAATTTGCCTTTGCTGG + Intergenic
1069437921 10:68402433-68402455 CTGGGAAAAATTGCCTATCTTGG - Intronic
1069924588 10:71839537-71839559 CTTTAAAAAAGTCCCATTGTGGG - Intronic
1070267138 10:74914570-74914592 CTTGAAAAAGTTGCCAATTTTGG - Intronic
1071843158 10:89493870-89493892 TTTGACAAAATTACCTTGGTAGG - Intronic
1071852772 10:89592021-89592043 CTTGGAAAAATTCCCTTTAAAGG + Intronic
1072298570 10:94037194-94037216 TTTCACAAAAATGCCTTTGTTGG + Intronic
1074950427 10:118329037-118329059 ATTGAAGACCTTGCCTTTGTAGG - Intronic
1075866905 10:125730763-125730785 CTTGTAAAAATTGCATATGGTGG + Intronic
1075900581 10:126040006-126040028 CTTAAAAACACAGCCTTTGTGGG + Intronic
1075952597 10:126494776-126494798 CTTGAAATAAATGCCCTTGTAGG - Intronic
1077418558 11:2437343-2437365 GGTGAGAAAATTGCCTTGGTGGG + Intergenic
1078037912 11:7826877-7826899 CTGAAAAAAATTGCATCTGTAGG + Intergenic
1078784112 11:14471070-14471092 CTTTAGAAAGTTACCTTTGTGGG - Intronic
1079482303 11:20894380-20894402 CTTGGATAAAAGGCCTTTGTGGG - Intronic
1079579623 11:22047358-22047380 CTTGAAATAATGGCTTTTGTAGG - Intergenic
1080242698 11:30144952-30144974 CTTTAAAAAAATGACTTTATAGG + Intergenic
1080368073 11:31600507-31600529 ATTGAAAAAATGGTATTTGTTGG - Intronic
1080438975 11:32272941-32272963 TTTAAAAAAATAGCCTTAGTGGG - Intergenic
1080883017 11:36340260-36340282 CTTGAAAAACTGGCCTATTTTGG + Intronic
1081126008 11:39322527-39322549 CTTTAGAAAATTGCTTTTTTTGG + Intergenic
1082021384 11:47536456-47536478 TTTTAAAAAACTGCATTTGTAGG + Intronic
1082312373 11:50667621-50667643 CTTGAAAAAGCTGTTTTTGTAGG - Intergenic
1082792160 11:57353664-57353686 GTTGAAAAATCTGCCTCTGTTGG - Intronic
1083065596 11:59920745-59920767 CTTGAAAAAATAGGATTTATAGG + Intergenic
1085100835 11:73798392-73798414 CTTTTAAAAATTGTTTTTGTTGG - Intronic
1087291035 11:96320868-96320890 CTTGAAAACATTGACTTTCTTGG - Intronic
1087903549 11:103669930-103669952 CTTGAATAAAATGCCATAGTGGG + Intergenic
1089914166 11:122136260-122136282 CTTAAAAAACTTGTCTTTGAGGG + Intergenic
1090992021 11:131826374-131826396 CTTGTTAAAATTGCTTTTCTGGG - Intronic
1091181842 11:133612248-133612270 TTTGAAAAAATAGTTTTTGTTGG + Intergenic
1094109842 12:26850248-26850270 TTTGCAAAAATTGCCGTTGAGGG + Intergenic
1094637935 12:32244925-32244947 TTTTAAAAAATAGCCTATGTCGG - Intronic
1095076540 12:37935100-37935122 CTTGTAAACATTGTTTTTGTTGG - Intergenic
1095174780 12:39079056-39079078 TAAGAAAAATTTGCCTTTGTGGG - Intergenic
1095881401 12:47141257-47141279 ATGGACAAAAGTGCCTTTGTGGG + Intronic
1098122964 12:67262126-67262148 TTTTTAAAAATTGGCTTTGTTGG - Intergenic
1098289727 12:68946358-68946380 TTTTAAAAAATTGGCTTTGCTGG + Intronic
1098426621 12:70371580-70371602 CTTGAAAAAGTGGCATTTCTTGG + Intronic
1098821248 12:75232545-75232567 ATGGACAAAATTGCCTTTGTGGG - Intergenic
1100017538 12:90029096-90029118 GCTGAAAAAATTGCTTTAGTGGG + Intergenic
1101087009 12:101246481-101246503 CTTATCAAAATTGCCTTGGTGGG - Intergenic
1101787577 12:107898593-107898615 TTTAAAAAAAATGCCTTTTTGGG + Intergenic
1102444962 12:112994952-112994974 CTTTAAAAAATTGTTTGTGTTGG - Intronic
1102708075 12:114899868-114899890 CTTGAAAGCATGGCCATTGTCGG - Intergenic
1102777465 12:115533018-115533040 CTTGAAGAATATTCCTTTGTGGG - Intergenic
1106471419 13:30059111-30059133 TTTAAAAAAATTGGCTTTGCTGG - Intergenic
1106530580 13:30587028-30587050 CTTTAAAAACTTTACTTTGTAGG + Intronic
1106611667 13:31288755-31288777 TTTTTAAAAATTGCTTTTGTAGG - Intronic
1106683314 13:32030932-32030954 CTTGAAAAGACTGCATTTCTGGG + Intergenic
1106688213 13:32085004-32085026 CTTGAAAAGAATGTCTTTATTGG + Intronic
1107107667 13:36663834-36663856 CTTGAAAAAATTGCTAATCTTGG + Intergenic
1107187165 13:37537253-37537275 TTTGAGAAATTTGCCTTTGAAGG - Intergenic
1108069413 13:46613088-46613110 CTTTAAAAAAATGCATTTCTAGG + Intronic
1108480418 13:50864607-50864629 TTTGACACAATTTCCTTTGTGGG + Intergenic
1109260681 13:60142365-60142387 TTTCCAAAAATTGCCTTTATTGG - Intronic
1109302499 13:60603692-60603714 CTTACAAAAAGTGCCTGTGTGGG + Intergenic
1109537849 13:63740603-63740625 CATGAAAGACTTGCTTTTGTTGG + Intergenic
1109564041 13:64087388-64087410 CTTGAAAGATTTACCTTTGCAGG - Intergenic
1110348414 13:74476443-74476465 TTGTAAAAAATCGCCTTTGTGGG + Intergenic
1111079700 13:83287154-83287176 CTTGACAAAATTCCCTTTGATGG - Intergenic
1111671971 13:91342855-91342877 CTTTAATAATTTGCCTTTCTGGG - Intergenic
1112465473 13:99640926-99640948 CTGGAAAACATTCCCTTTATGGG + Intronic
1112912824 13:104509441-104509463 CTTGGGCAAATTGCCTCTGTTGG + Intergenic
1115101611 14:29707994-29708016 GTTGACAAAATTACCTTTGATGG - Intronic
1115211390 14:30970489-30970511 CTTGAAATAATAGCCTGTATAGG - Intronic
1115816946 14:37173538-37173560 CATGTAAAAATTGCCATTTTTGG + Intergenic
1116537515 14:46052196-46052218 CTTTAAATACTTGTCTTTGTAGG + Intergenic
1116955138 14:50915668-50915690 TTTCAAAAAGCTGCCTTTGTTGG + Intronic
1117027644 14:51637837-51637859 CTTGAAAAAACTGATTTAGTTGG - Intronic
1118169832 14:63377789-63377811 CCTGAAAAAATTGCACTTATAGG + Intronic
1118987742 14:70771321-70771343 CTTTGAAAAGTTTCCTTTGTAGG - Intronic
1118995362 14:70830776-70830798 GTTGAAAAAATTATTTTTGTAGG - Intergenic
1119469165 14:74882921-74882943 TTACAAAAATTTGCCTTTGTTGG - Intronic
1121877792 14:97469797-97469819 CTTGAAAAAAGTGAGGTTGTTGG + Intergenic
1121935332 14:98013272-98013294 CTGGTAAAAATTGCCTTTCTAGG - Intergenic
1122171621 14:99880646-99880668 ATTTAAAAAATTGCCCTTGTTGG + Intronic
1202911681 14_GL000194v1_random:123288-123310 CTTCTTAAAATTGGCTTTGTTGG + Intergenic
1202880941 14_KI270722v1_random:59344-59366 CTTCTTAAAATTGGCTTTGTTGG - Intergenic
1125775841 15:42212980-42213002 CATGGAAAAATTCCCTTTGTGGG + Intronic
1126387158 15:48106056-48106078 CCTAGAAAAATTTCCTTTGTGGG + Intergenic
1126831948 15:52616610-52616632 TTTGAATCAATTGGCTTTGTTGG - Intronic
1127738072 15:61865201-61865223 CTTGAAAAAATTGAATTACTGGG - Intronic
1129378295 15:75148919-75148941 TTTTAAAAAATTGGCTTTGAAGG - Intergenic
1130977325 15:88787473-88787495 TTTGAAAAAAGTGTCTTTGCAGG - Intergenic
1134596045 16:15496836-15496858 CTTTAAAAAATTTCCCTTGTGGG - Intronic
1135352560 16:21741340-21741362 CTTTAAAAAGGTCCCTTTGTTGG + Intronic
1135451048 16:22557462-22557484 CTTTAAAAAGGTCCCTTTGTTGG + Intergenic
1135648725 16:24186907-24186929 CTTGAAAATATTTTCTTTGAGGG + Intronic
1137245116 16:46696500-46696522 CTTGGAAACATTTCTTTTGTCGG - Intronic
1137690981 16:50427361-50427383 CTTTAAAAAATTTTTTTTGTGGG + Intergenic
1139022037 16:62761459-62761481 CTTAAAAATATGGCCTGTGTGGG - Intergenic
1139627590 16:68203065-68203087 CTTGTAAATAATGCCTATGTAGG + Intronic
1139735437 16:68983730-68983752 TTTGAAAAAATAGCTTTTGTAGG + Intronic
1143051078 17:4126389-4126411 CTTGATAATATTGTCTTAGTGGG - Intronic
1143569760 17:7749010-7749032 CTTGAAAATCTTGCCTTGGCCGG + Intronic
1143886184 17:10066634-10066656 TTTAAAAAAATTGACCTTGTAGG - Intronic
1144133091 17:12266846-12266868 CTTTAAAAAATTGCCTTTACAGG + Intergenic
1144543921 17:16174408-16174430 CTTGAAAATTATGCTTTTGTAGG - Intronic
1145352739 17:22100818-22100840 CTGGAAAAAGTTGGCTCTGTGGG - Intergenic
1147040898 17:37718218-37718240 CTTGAAAAAATTGCACATGTGGG + Intronic
1150868866 17:68882177-68882199 CCTGAAAAAACTGCCTTTGTAGG - Intronic
1151273994 17:73020195-73020217 CTCGAAAAAAATTCATTTGTTGG + Intronic
1153542614 18:6172111-6172133 TTTGGTACAATTGCCTTTGTTGG - Intronic
1154309619 18:13256985-13257007 GATGAGAAAATTGCCTATGTGGG + Intronic
1154408089 18:14115052-14115074 GTTGATCACATTGCCTTTGTGGG + Intronic
1155227906 18:23746176-23746198 CTTGAAAAAAGTGCTTATTTGGG - Intronic
1155615271 18:27714841-27714863 CTTGAATAAGTAGCCTTTGCTGG + Intergenic
1156104569 18:33643550-33643572 CCTAAAATAATTGTCTTTGTAGG + Intronic
1156217981 18:35020881-35020903 GTTGGAAAAATTGCCATTGCTGG + Intronic
1156468597 18:37363277-37363299 CATGAAAATATTGCCTTGATGGG - Intronic
1157101836 18:44737705-44737727 CTGGAATGAGTTGCCTTTGTAGG + Intronic
1157751827 18:50185837-50185859 AATGGCAAAATTGCCTTTGTAGG + Intronic
1157924943 18:51753492-51753514 CTTGAAATGATTAACTTTGTAGG - Intergenic
1158044597 18:53140799-53140821 TTTGATGAAATTCCCTTTGTCGG - Intronic
1158821719 18:61167130-61167152 CTTAAAAAAGTTACCTTTATGGG - Intergenic
1159431761 18:68361753-68361775 TTTTAAAAAATTGGCTTTGCTGG - Intergenic
1159624005 18:70670450-70670472 GTGGACAAAAGTGCCTTTGTGGG - Intergenic
1163911858 19:20202787-20202809 CCTGACAAAAATGCCTTTATTGG + Intergenic
1165451604 19:35887135-35887157 CTTGATAAAATACCCTTTATTGG - Intergenic
1166907329 19:46120419-46120441 TTTGTTAAAATTGCTTTTGTAGG - Intronic
1168373126 19:55852775-55852797 CCTGAAAATATTGTCCTTGTAGG + Intronic
1202656544 1_KI270708v1_random:28451-28473 CTTCTTAAAATTGGCTTTGTTGG - Intergenic
925009330 2:470161-470183 CTTTAAAAAATGGCCTTGGTAGG + Intergenic
926352656 2:12010993-12011015 GTTGGTAAAAGTGCCTTTGTAGG + Intergenic
926803166 2:16680281-16680303 TTTGAAAAAACTTCCTTTATTGG - Intergenic
927326208 2:21808377-21808399 CTTGAAAATATTGCATTACTGGG - Intergenic
928841044 2:35605074-35605096 CTTAAAAAAATTACCCTTCTAGG - Intergenic
930225335 2:48786582-48786604 CTTGAAAACATTTCCTTTTTTGG - Intergenic
930341525 2:50121950-50121972 CTGAAGAAAATTGCCTTTGCAGG - Intronic
930453359 2:51573052-51573074 ATTGAAAAATTTGTATTTGTGGG + Intergenic
930547039 2:52781407-52781429 TTTGAATTAATTGCTTTTGTGGG - Intergenic
930794280 2:55371141-55371163 CTTTAAAAAATACCCTGTGTTGG - Intronic
932915374 2:75852672-75852694 CTTGAGAAAAAAGCCTTTGAAGG + Intergenic
936600289 2:113889228-113889250 CTTAAAAAAATTTTCTTTGGAGG + Intergenic
936606813 2:113966656-113966678 CTTTGAAAAGTTCCCTTTGTAGG + Intergenic
936758210 2:115739969-115739991 CTTGAACAAGTTGTCTTTGGAGG + Intronic
939668190 2:144976725-144976747 GTTGAAAAAATTTCATTTATAGG + Intergenic
939709240 2:145495379-145495401 CATGAAAAGATTACCTCTGTTGG + Intergenic
939825203 2:147007059-147007081 TTCAAAAAAATTGCATTTGTTGG - Intergenic
940316195 2:152330108-152330130 CTAGAAAAAAATTACTTTGTTGG + Intergenic
940531012 2:154875835-154875857 ACTGAAAAAATGCCCTTTGTTGG - Intergenic
940849493 2:158674394-158674416 CTTAAAAAAATTCACTTTGGAGG - Intronic
942382568 2:175407192-175407214 CTTGGAAATTGTGCCTTTGTTGG - Intergenic
942709596 2:178818101-178818123 ATTGAAAATATTGCATATGTGGG - Intronic
942728187 2:179033717-179033739 CATGAAAAAATTTTGTTTGTAGG + Intronic
942772264 2:179536286-179536308 CTTGGAAAAAGTGTCTATGTTGG - Intronic
943428757 2:187771344-187771366 CTTGAATATATTGTCTTTATAGG + Intergenic
943852373 2:192740684-192740706 CTTGGAAAATTTGCAGTTGTTGG - Intergenic
944336994 2:198545757-198545779 TTTGAAAAAATTTCTTTTGCAGG + Intronic
945323647 2:208456924-208456946 CATGAAAAACTTGTCTTTGATGG - Intronic
948029074 2:234801521-234801543 CATGAAAAAATTGCTTGTGTAGG + Intergenic
948227784 2:236325248-236325270 GTTGAGAAAAATGCCATTGTGGG - Intronic
1170659953 20:18328280-18328302 TTTGAAAAATTTGGCTTTGCTGG - Intergenic
1172083787 20:32362334-32362356 CTTTTAAAAATTGTTTTTGTAGG + Intronic
1172756111 20:37285670-37285692 CTTCAAACCATTGCCTTTGTCGG - Intergenic
1173063725 20:39688258-39688280 TTTCAAAAAATTTCCTTTTTAGG - Intergenic
1173438159 20:43050943-43050965 CTTCAAAAAACTGCCTTGGGAGG - Intronic
1175287662 20:57848227-57848249 TTTGAATATATTGTCTTTGTTGG + Intergenic
1176631042 21:9137955-9137977 CTTCTTAAAATTGGCTTTGTTGG + Intergenic
1176642254 21:9316863-9316885 CTTCTTAAAATTGGCTTTGTTGG - Intergenic
1176772131 21:13085725-13085747 GATGAAATAATTGCCTTTGCAGG + Intergenic
1177765921 21:25457164-25457186 CTTTAAAAAATTGTTTTTCTTGG - Intergenic
1180351264 22:11806215-11806237 CTTCTTAAAATTGGCTTTGTTGG - Intergenic
1180375552 22:12089648-12089670 CTTCTTAAAATTGGCTTTGTTGG - Intergenic
1180386937 22:12185860-12185882 CTTCTTAAAATTGGCTTTGTTGG + Intergenic
1181429467 22:22869847-22869869 ATAGAAAAAAATGCCTTTGATGG - Intronic
1181900298 22:26148904-26148926 CTTTAAAAACTTGAATTTGTAGG + Intergenic
1182163948 22:28152918-28152940 TTTTAAAAAATTACTTTTGTAGG - Intronic
1182395871 22:30035546-30035568 CTTGAAAGAATTTGCTTTGCAGG - Intergenic
1182839348 22:33374010-33374032 GTGGAAGACATTGCCTTTGTAGG - Intronic
1183274184 22:36881405-36881427 ACTAAAAAAATTGCCTTTGAGGG + Intergenic
1185184518 22:49390464-49390486 CGTGATAAAATTCCCTTTTTCGG + Intergenic
1185282087 22:49976623-49976645 CTTGATAGATTTGCCTTTTTTGG + Intergenic
950967213 3:17154721-17154743 CTTTACAACATGGCCTTTGTTGG + Intergenic
950979976 3:17292147-17292169 CTTTACCAAATTGCCTTTGAAGG + Intronic
951348929 3:21581308-21581330 CTGGAAACAATTGCATTTGGAGG - Intronic
953799350 3:46010251-46010273 CTTTAAAAAATTGTTTTTATTGG + Intergenic
955583507 3:60450776-60450798 CTTGAAAACATGGTTTTTGTTGG - Intronic
956540386 3:70331457-70331479 ATTGAATAAATTGGATTTGTGGG - Intergenic
957097862 3:75793784-75793806 CTTCTTAAAATTGGCTTTGTTGG + Intergenic
957337958 3:78857129-78857151 CTTTTAAAAATTGCTTTTTTAGG + Intronic
957377472 3:79377068-79377090 CTTGAAAAACTTGCCTTCTTCGG - Intronic
958005126 3:87800783-87800805 CCTCAAAAAATTGTCTTTCTTGG + Intergenic
958028512 3:88077582-88077604 CATGAAAAACTTGCATTTGTGGG + Intronic
958947623 3:100381190-100381212 CTTGAAAAAATTCACTCTTTGGG + Intronic
959851236 3:111089709-111089731 CTTGAAAAAATTGCCTTTGTTGG + Intronic
960107861 3:113817523-113817545 TTTTAAAAAATAGCATTTGTTGG + Intergenic
961022445 3:123520028-123520050 CCTGATAAGTTTGCCTTTGTTGG - Intronic
961955663 3:130800641-130800663 CATGAAAGAATAACCTTTGTGGG - Intergenic
962832018 3:139151338-139151360 CCTGATGAAATTCCCTTTGTAGG - Intronic
963150265 3:142038502-142038524 CTTAAAATTATTACCTTTGTTGG - Intronic
963180606 3:142351538-142351560 CTTGAAAAAATTGTCTATACTGG - Intronic
963954126 3:151234349-151234371 CTTGAATAAATTGTCTGTCTAGG + Intronic
964231817 3:154479031-154479053 TATGAAAAAAATGACTTTGTCGG + Intergenic
964428107 3:156574419-156574441 CTTGAAAAAATTTCCATGCTTGG - Intergenic
964782521 3:160356150-160356172 TTTTTAAAAATTGCTTTTGTAGG - Exonic
964887071 3:161496312-161496334 CTTGAAATAATTGAGTTTGCTGG + Intergenic
965023897 3:163273208-163273230 CTTAAAAAAAAATCCTTTGTAGG - Intergenic
965457121 3:168915946-168915968 TTTAAAAACATTGCCCTTGTTGG - Intergenic
966006266 3:175016893-175016915 CTTGAAACATTTTCTTTTGTTGG + Intronic
966404005 3:179576549-179576571 CTTGAACGAATTTCCTCTGTGGG - Intronic
966567259 3:181396902-181396924 ATGGAAAAAAGTGCCATTGTGGG - Intergenic
967767631 3:193298826-193298848 TTTTAAAAAATTCCCTTTCTAGG + Intronic
1202744635 3_GL000221v1_random:88155-88177 CTTCTTAAAATTGGCTTTGTTGG + Intergenic
968395027 4:227850-227872 ATTGATCACATTGCCTTTGTGGG - Intergenic
968821648 4:2857206-2857228 TTTGAAAAAATTGCCCTGGCCGG - Intronic
969019755 4:4131983-4132005 CATGAAAAACTTGCTATTGTTGG + Intergenic
970384909 4:15546198-15546220 CTTGAAAATCTTGGCTTTGGAGG + Intronic
970853365 4:20627861-20627883 CTTTTAAAAATTGGCTTTGATGG + Intergenic
971326232 4:25646065-25646087 CTTTAAAAAATGGCATTTATGGG - Intergenic
971901227 4:32660730-32660752 CTTGAAAAAATTGTTTTTGTTGG + Intergenic
971916459 4:32875904-32875926 CATAAAGAAATTGCCTTTCTAGG + Intergenic
973769963 4:54197329-54197351 TTTCAAAAAATTGCATCTGTGGG + Intronic
974100236 4:57408225-57408247 CTGGAAAATAGTGACTTTGTGGG + Intergenic
974641498 4:64637773-64637795 ATTTAAAATATTGCATTTGTAGG + Intergenic
974721406 4:65743631-65743653 TTTGAAAAAATTGCCTTTGTTGG - Intergenic
974922901 4:68264277-68264299 CTTTTAAAAATTGGCTTTGATGG - Intergenic
975369764 4:73571200-73571222 TATGAAATCATTGCCTTTGTAGG + Intergenic
975723426 4:77269783-77269805 TTTGAAAAAATGGCCTTCTTGGG - Intronic
975922191 4:79405679-79405701 CTTTTAAATACTGCCTTTGTAGG + Intergenic
976795688 4:88930324-88930346 TTTTTAAAAATTGCTTTTGTAGG + Intronic
978049204 4:104174993-104175015 CTTGAAAGATATGGCTTTGTGGG + Intergenic
978361631 4:107936806-107936828 CTTCTAAAACTTGCCTATGTTGG + Intronic
978369542 4:108016559-108016581 CTTGACAAAACTCCCTTTTTTGG - Intronic
978390445 4:108219786-108219808 CTTGAAAAAAATGTGTCTGTTGG + Intergenic
979349850 4:119630698-119630720 CTTGAATTATTTGCTTTTGTTGG + Intergenic
979801461 4:124914177-124914199 ATAGACAAAATTGCCTTTGTGGG - Intergenic
980080673 4:128340776-128340798 CTTGAAATACTAACCTTTGTGGG - Intergenic
980135126 4:128851352-128851374 TTTTAAAAATTTGCCTTTCTTGG - Intronic
981190807 4:141860584-141860606 CTAGAAAAAATGGCCTTTTATGG - Intergenic
981232887 4:142379102-142379124 TTTTAAAAAATTGCCATTTTGGG - Intronic
981657746 4:147131232-147131254 CTTAAAACCAATGCCTTTGTTGG + Intergenic
982977806 4:162089332-162089354 CTTAAAAAAATTGAGTTTGTAGG + Intronic
984019079 4:174462767-174462789 GTTAAAAAAATTGACTTTTTGGG + Intergenic
984201020 4:176721369-176721391 CTTGATAACATTGCCTTATTGGG - Intronic
984693715 4:182757550-182757572 CTTGATTAAAATGCATTTGTAGG - Intronic
984859274 4:184221731-184221753 TCTGAAGAAATTGCCTTTCTGGG + Intergenic
985330668 4:188829103-188829125 CTTGAAAACATTGCCCTTTCTGG - Intergenic
1202757151 4_GL000008v2_random:75090-75112 CTTCTTAAAATTGGCTTTGTTGG - Intergenic
1202768653 4_GL000008v2_random:175836-175858 CTTGAAATAATTTCTTTTTTGGG + Intergenic
987757700 5:22118150-22118172 TGTGAAAAAATTGTGTTTGTTGG - Intronic
987807355 5:22786378-22786400 CTTTCAAAAGTTCCCTTTGTGGG + Intronic
988623404 5:32846423-32846445 CTTCAAGGGATTGCCTTTGTTGG + Intergenic
989836077 5:45993493-45993515 TTTGAAAAAACTGTATTTGTAGG + Intergenic
989838475 5:46027879-46027901 TTTGGAAACACTGCCTTTGTAGG + Intergenic
990040007 5:51368463-51368485 GTGCAAAAAATGGCCTTTGTTGG - Intergenic
991029881 5:62071722-62071744 CTTGAAAAATTTGACTATGGGGG + Intergenic
991921407 5:71661045-71661067 CTTAAAAAAATTGTTTTTCTTGG - Intergenic
992048735 5:72924813-72924835 CTTGATAATATTGCCTTTAGGGG + Intergenic
993194393 5:84722445-84722467 ATGGACAAAAGTGCCTTTGTGGG + Intergenic
993771106 5:91928480-91928502 CTTCAGAAAATTGCCCTTATTGG + Intergenic
994075814 5:95648158-95648180 CTTGAATTTATTTCCTTTGTTGG + Intronic
995408994 5:111833283-111833305 CATGGAATAATTGCCATTGTAGG - Intronic
997945334 5:138195293-138195315 CTTTAAAAAATCTCCTTTATGGG + Intronic
999115335 5:149157930-149157952 TTTTTAAAAAGTGCCTTTGTTGG - Intronic
999347838 5:150840198-150840220 CTTGGAAATACTGGCTTTGTTGG - Intergenic
999566129 5:152863947-152863969 CCTGAAATAATTTCCCTTGTTGG + Intergenic
1000300290 5:159950574-159950596 CTTGACAAAATGGTCTTTGAGGG + Intronic
1000502957 5:162075684-162075706 GTTGAAAATATTTCCTTTTTAGG - Intronic
1000913546 5:167051354-167051376 CTTAAAAAAATTGTTTGTGTTGG - Intergenic
1001147089 5:169194460-169194482 CTTGGCAATTTTGCCTTTGTGGG + Intronic
1004557399 6:16712751-16712773 CTTCAAAACAGTGCCTTTCTAGG + Intronic
1006446554 6:34082977-34082999 TTTGAAAAAATTCCCTTTGCTGG - Intronic
1006751031 6:36377138-36377160 CTTGACACATTTGCCTTTGTGGG + Intronic
1007254014 6:40516045-40516067 CTTGAAAACCTGCCCTTTGTGGG + Intronic
1010429588 6:75763583-75763605 CTTGAATAAATGTCATTTGTTGG + Intronic
1010825596 6:80469532-80469554 TTTTAAAAAATTAACTTTGTTGG - Intergenic
1012353228 6:98279230-98279252 CTTAAAAATATTTCCTTTGGTGG - Intergenic
1013176041 6:107677852-107677874 CTGGCAAACATTGCCTTAGTCGG - Intergenic
1013388693 6:109660590-109660612 TTTTAAAAAATTACCTGTGTAGG - Intronic
1014078194 6:117261908-117261930 CATGAAAAAAATGAGTTTGTGGG + Intergenic
1015925688 6:138308289-138308311 CTTGCAAAATTGGCCTTTGGCGG - Intronic
1016046054 6:139481719-139481741 CTTAAAAAAATACCCTTTGCAGG - Intergenic
1016060838 6:139628071-139628093 CTTGAGGAAAATGCCTTAGTTGG - Intergenic
1016610864 6:145987846-145987868 CTTTAAAAAATTTTCTTTGCAGG - Intergenic
1017472871 6:154757610-154757632 CATGAAAAAAATACCTTTATTGG + Intronic
1018502804 6:164430145-164430167 CTTGAAAAAATAGCCATACTTGG - Intergenic
1020634483 7:10679952-10679974 CTTGAAACAATTGTCTTTCTGGG + Intergenic
1021504389 7:21365391-21365413 CTTTAAAAAATTTCATTTGTGGG - Intergenic
1022527922 7:31050306-31050328 CTAGAAAAAACTGCCCTTTTTGG + Intergenic
1022863430 7:34391735-34391757 CTGTAAGAAATTTCCTTTGTAGG - Intergenic
1023232401 7:38049357-38049379 TTTTAAAAATTTGCTTTTGTAGG + Intergenic
1023707415 7:42955760-42955782 TTTAAAAAAATTGACTTTGCTGG + Intergenic
1024778348 7:52815993-52816015 ATAGACAAAACTGCCTTTGTGGG + Intergenic
1025968819 7:66302635-66302657 CTTGAATCAATTGCCTGTCTGGG - Intronic
1028129195 7:87150406-87150428 CTAGTTAAAATTGACTTTGTTGG - Intergenic
1028945835 7:96579298-96579320 CATGAATAAATTGCTTTTGCAGG - Intronic
1029018590 7:97340281-97340303 TGTGAAAAAATTCCCTTTGCTGG - Intergenic
1030157825 7:106474299-106474321 TTTGAAAATATTCCATTTGTAGG - Intergenic
1030661476 7:112223671-112223693 CTGGACAAAAGCGCCTTTGTGGG - Intronic
1030671211 7:112339119-112339141 TTTGTAAAAATTACCTATGTGGG + Intronic
1030758687 7:113322768-113322790 TTAGTAAAAATTGCCTTTGACGG + Intergenic
1030933307 7:115552263-115552285 TTTTAAAAAATTGCCTTTGGAGG - Intergenic
1031039590 7:116825494-116825516 CCTGATGAAATTTCCTTTGTAGG + Intronic
1031466905 7:122124204-122124226 CTTTTAAAAAGTGCCTTTGAAGG - Intronic
1032870856 7:135983365-135983387 CTTTATAAAATTGGCTTTGCTGG + Intergenic
1032965117 7:137087689-137087711 CTTTAAAAAAATACTTTTGTGGG + Intergenic
1033738463 7:144248800-144248822 CTTTATACAATTGCCTTAGTTGG - Intergenic
1033744588 7:144302154-144302176 CTTTATACAATTGCCTTAGTTGG + Intergenic
1033809520 7:144994775-144994797 TCTGAAAACATTGACTTTGTAGG + Intergenic
1034002552 7:147431725-147431747 CTTGAAACAATTTCTTATGTTGG + Intronic
1034303387 7:150034426-150034448 CATGAAAAACTTGCTGTTGTTGG + Intergenic
1034303951 7:150036505-150036527 CATGAAAAACTTGCTGTTGTTGG + Intergenic
1034304470 7:150038418-150038440 CATGAAAAACTTGCTGTTGTTGG + Intergenic
1034305159 7:150041155-150041177 CATGAAAAACTTGCTGTTGTTGG + Intergenic
1034584405 7:152076438-152076460 CTTGAAAACATGCCCTTTATTGG - Intronic
1034801732 7:154059653-154059675 CATGAAAAACTTGCTGTTGTTGG - Intronic
1034802151 7:154061259-154061281 CATGAAAAACTTGCTGTTGTTGG - Intronic
1037474114 8:19239406-19239428 CTTGCATGAATTGCTTTTGTAGG + Intergenic
1039799164 8:40939268-40939290 GTTGTAAAAATCGCCTTTGTCGG - Intergenic
1039960139 8:42239937-42239959 TTTTAAAAAATTGCCTTTTACGG - Intergenic
1040760344 8:50833905-50833927 TTTGATAAATTTCCCTTTGTAGG + Intergenic
1040840005 8:51775160-51775182 TTTGTAATAATGGCCTTTGTGGG - Intronic
1041262040 8:56029523-56029545 CTTTAAAAAATTGACTCGGTAGG - Intergenic
1042345020 8:67718498-67718520 AATGAAAAAAATGCCTGTGTGGG - Intronic
1042911229 8:73828626-73828648 ATTAAAAAAATTGTTTTTGTGGG + Intronic
1044460457 8:92438430-92438452 GTTCAAAAAATTGCCTCTGCAGG - Intergenic
1044681341 8:94781351-94781373 CTTGAAAATATAGCATTGGTCGG + Intronic
1045916978 8:107483840-107483862 CTTAGACAAATTGCCTTAGTTGG - Intronic
1045987639 8:108267282-108267304 CTTGGAAACATTGTCTTTGAGGG + Intronic
1046496275 8:115018686-115018708 TTTTTAAAAATTGCTTTTGTAGG + Intergenic
1046776518 8:118169443-118169465 TTTGAAACAATTGCATCTGTAGG - Intergenic
1047038706 8:120969182-120969204 ATTTTAAAAATTGCCTTTGTAGG - Intergenic
1048526804 8:135210442-135210464 CTAACAAAGATTGCCTTTGTGGG - Intergenic
1049119712 8:140724049-140724071 CTTCTGAAAATTGCCTTTGTTGG - Intronic
1050662646 9:7899825-7899847 CCCGAAAAAGTTACCTTTGTCGG + Intergenic
1051149211 9:14062247-14062269 CTTGAAAAATTGCCCTTTATGGG + Intergenic
1051963704 9:22800695-22800717 TGGGAAAAAAGTGCCTTTGTAGG + Intergenic
1052083628 9:24237431-24237453 CTTCAAACAATTGAATTTGTAGG - Intergenic
1052925876 9:34015963-34015985 CTTTAAAAAGCTGCCTTTGCTGG - Intronic
1053049239 9:34945096-34945118 ATTGAAAGGATTGCCTTTGCTGG - Intergenic
1053110716 9:35457440-35457462 CTTGAAATAATAGCCTGTATAGG + Intergenic
1053210709 9:36225130-36225152 CTTGAAAAAAATGCCCTGGATGG - Intronic
1056467515 9:86872303-86872325 CTGACAAAAATTTCCTTTGTGGG - Intergenic
1056688771 9:88788198-88788220 CTTTAAAAGATTGTCTTTGGAGG - Intergenic
1057499615 9:95586167-95586189 CTTGATCAAATTGAGTTTGTGGG + Intergenic
1058285968 9:103178606-103178628 CTTGATAAAATTTCCTTATTTGG + Intergenic
1058294835 9:103293460-103293482 CTTTTAAAAATTGGCTTTGCTGG - Intergenic
1059321750 9:113475704-113475726 CTTTAAAAACTTGTCTTTGTGGG - Intronic
1059322206 9:113478510-113478532 CTTTAAAAACTCGTCTTTGTGGG + Intronic
1061875110 9:133539706-133539728 CTGGACAAAAATGCCTTTGTCGG + Intronic
1203688750 Un_GL000214v1:22152-22174 CTTCTTAAAATTGGCTTTGTTGG - Intergenic
1203753866 Un_GL000218v1:105571-105593 CTTCTTAAAATTGGCTTTGTTGG + Intergenic
1203713263 Un_KI270742v1:118105-118127 CTTCTTAAAATTGGCTTTGTTGG + Intergenic
1203537941 Un_KI270743v1:59950-59972 CTTCTTAAAATTGGCTTTGTTGG - Intergenic
1203647525 Un_KI270751v1:81901-81923 CTTCTTAAAATTGGCTTTGTTGG + Intergenic
1186391428 X:9163832-9163854 TTTGAAAAACTAGCCTTTGTTGG + Intronic
1187014666 X:15314154-15314176 CTTGCCAATATTGACTTTGTTGG + Intronic
1187091908 X:16105881-16105903 CTTGATAATATAGCCTTTATTGG + Intergenic
1187753989 X:22499769-22499791 GTTGAAAAAATTGGGTTTATTGG - Intergenic
1188256662 X:27969442-27969464 CGTGAAAAAATTACTTTTGGGGG + Intergenic
1188566275 X:31530116-31530138 GTTTAAAAAAATGGCTTTGTGGG + Intronic
1188584701 X:31758873-31758895 CTTTAAGAAATTCCCTTTGATGG - Intronic
1188970118 X:36605176-36605198 CTTCAAGAAAATGGCTTTGTGGG + Intergenic
1190405259 X:50080604-50080626 CATGAAATAATTGACTATGTAGG - Exonic
1193347540 X:80422172-80422194 CTTTAAAAAAATGCCTTTCATGG + Intronic
1194056243 X:89136366-89136388 CTTGAAGAAATTGCCTCTAAGGG + Intergenic
1194534847 X:95094022-95094044 ATTGACAAAAGTGTCTTTGTGGG + Intergenic
1194912143 X:99658903-99658925 CGTGAGAATATGGCCTTTGTTGG - Intergenic
1195150631 X:102065992-102066014 CTTTTTAAAATTGCCTTTGATGG - Intergenic
1195161721 X:102178261-102178283 CTTAAAAACATTGGCTCTGTTGG + Intergenic
1195390403 X:104356265-104356287 CATTAAAAAATTTCCTTTTTCGG + Intergenic
1195581454 X:106508173-106508195 TTTTAAAAAATTGGCTTTGATGG - Intergenic
1195846828 X:109237970-109237992 CTTGAAATAATAGCCTGTATAGG + Intergenic
1196238824 X:113316462-113316484 CATGAGAAAATTCCCTTTGTGGG + Intergenic
1197273109 X:124447667-124447689 CTTGAAAAACTTGCGTCTCTTGG + Intronic
1199347634 X:146760772-146760794 ATGGACAAAAGTGCCTTTGTAGG + Intergenic
1199400332 X:147391214-147391236 CTTGATAAGGTTCCCTTTGTAGG - Intergenic