ID: 959854676

View in Genome Browser
Species Human (GRCh38)
Location 3:111137593-111137615
Sequence AGTAAATACGAGGACAAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 373
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 344}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959854676 Original CRISPR AGTAAATACGAGGACAAAGA TGG (reversed) Intronic
900636506 1:3668804-3668826 AGTAGAAACGAGTACAAAGCTGG + Intronic
901852322 1:12023368-12023390 AATAAATAAGAAAACAAAGAAGG - Intronic
903993091 1:27288043-27288065 AGTACAAAGGAGGGCAAAGAGGG - Intronic
904297130 1:29527187-29527209 AGGAAATAGGAAGAGAAAGAGGG + Intergenic
908602146 1:65752208-65752230 AATAAACACGAGGACAGAGAAGG + Intergenic
909029839 1:70526361-70526383 ACTAAATAAGAGGACAAAAATGG + Intergenic
909102018 1:71359487-71359509 AGTAAATGTGAACACAAAGAAGG - Intergenic
909176916 1:72372408-72372430 ACTAAAGAAGAGGAAAAAGAAGG - Intergenic
909377697 1:74959061-74959083 AATAAATAAAATGACAAAGAGGG + Intergenic
909863817 1:80639917-80639939 AGTAAAGAAGAGGACATAAAAGG + Intergenic
910480543 1:87653934-87653956 AGTAAATAAAAAGAAAAAGAAGG + Intergenic
911429201 1:97761957-97761979 AGTATATATGAGCACAAGGAAGG + Intronic
911612900 1:99976758-99976780 AGTACATATGAACACAAAGAAGG + Intronic
912006243 1:104904311-104904333 AGTAAAAAGGAGGAAAATGATGG - Intergenic
912206932 1:107518980-107519002 AGTAAATAAAGGCACAAAGATGG - Intergenic
912426169 1:109593346-109593368 AGTAAAAACGATGGCAAACAGGG - Exonic
913568631 1:120098477-120098499 AGTAAGTAAGAAGACAAAGTAGG - Intergenic
914289445 1:146259498-146259520 AGTAAGTAAGAAGACAAAGTAGG - Intergenic
914401650 1:147326904-147326926 AGTAGATAAAACGACAAAGATGG - Intergenic
914410698 1:147424102-147424124 AGTAGATACAACCACAAAGATGG + Intergenic
914550481 1:148710251-148710273 AGTAAGTAAGAAGACAAAGTAGG - Intergenic
915181327 1:154063198-154063220 AGTATATAAGAGCACAAAGAAGG + Intronic
917635329 1:176930198-176930220 AGTAAAGAGGAGGATCAAGAAGG + Intronic
917718357 1:177760408-177760430 AGTAGATACAACCACAAAGACGG + Intergenic
917748337 1:178032313-178032335 AATAAATACAAAGAAAAAGAGGG + Intergenic
918506175 1:185256898-185256920 AGTAAATAAAACCACAAAGATGG - Intronic
918810724 1:189116361-189116383 AGTACATACGGACACAAAGAAGG + Intergenic
919026181 1:192173382-192173404 AGTAAAGACTAAGACTAAGAAGG - Intronic
919713685 1:200753451-200753473 AGTAAAGAGGAACACAAAGAAGG - Intronic
920073499 1:203320557-203320579 AGTAAATAGGCAGACACAGATGG + Intergenic
920498596 1:206472430-206472452 GGAAAAGATGAGGACAAAGATGG + Intronic
921455365 1:215365053-215365075 AGTAGATAAGACCACAAAGATGG - Intergenic
922206127 1:223447879-223447901 AGTAAATAAAACCACAAAGATGG + Intergenic
924704977 1:246493478-246493500 AGTAAAAACTAGGCCAAAAAGGG + Intronic
1063718420 10:8553556-8553578 GGTAAAAAGTAGGACAAAGAAGG + Intergenic
1064234181 10:13558108-13558130 AGTATACACTAGGACTAAGAGGG + Intergenic
1064337896 10:14460088-14460110 AATAAATATGAGAACAGAGAAGG + Intronic
1064811282 10:19201514-19201536 TGTAAATACGGGGAGAAAGCAGG - Intronic
1065856902 10:29838566-29838588 AGCAAATAGAGGGACAAAGATGG + Intergenic
1067367998 10:45654120-45654142 AGTATATATGGAGACAAAGATGG + Intronic
1068177464 10:53479571-53479593 AGAAATTCAGAGGACAAAGAAGG - Intergenic
1068500967 10:57839706-57839728 AGTAAATAGGAAGGTAAAGAGGG - Intergenic
1069004923 10:63306799-63306821 AGTAAATACAATGATAAATAAGG + Intronic
1070376787 10:75840131-75840153 AGTAAAAACGAAGAGAAGGAAGG - Intronic
1070477847 10:76847233-76847255 AGTAGATACAACCACAAAGATGG + Intergenic
1071222369 10:83483938-83483960 GGTAAATATGAGGACAAAAATGG - Intergenic
1072399270 10:95080101-95080123 AGTAGATAAAACGACAAAGATGG + Intergenic
1073499687 10:103925153-103925175 TGTAAATAATAGCACAAAGAAGG - Intergenic
1073906480 10:108286723-108286745 AATAAATAAAAGGAAAAAGAGGG - Intergenic
1074158750 10:110820155-110820177 GGAAAACACAAGGACAAAGAAGG + Exonic
1075222809 10:120599505-120599527 TGTACAGATGAGGACAAAGAGGG + Exonic
1075449172 10:122536455-122536477 AGTAAACAAGCTGACAAAGAAGG - Intergenic
1075538940 10:123296173-123296195 GCCAAATACGTGGACAAAGATGG - Intergenic
1077679825 11:4228353-4228375 AGAAACCACGAGGAAAAAGAAGG + Intergenic
1077681661 11:4247555-4247577 AGAAACCACGAGGAAAAAGAAGG - Intergenic
1079777340 11:24548502-24548524 AGTACACAGGAGCACAAAGAAGG + Intronic
1080717185 11:34814851-34814873 ACTATATAAAAGGACAAAGAAGG + Intergenic
1082561454 11:54625138-54625160 AGTAAAAAAAAAGACAAAGAAGG - Intergenic
1082579735 11:54850828-54850850 AGTAGATAAAAGCACAAAGATGG + Intergenic
1085967997 11:81552424-81552446 AGCAAATACTAGGAGAATGATGG - Intergenic
1086642439 11:89176347-89176369 AGTATGGAAGAGGACAAAGAAGG + Intergenic
1087663560 11:101015678-101015700 AGTAAATAGAAAAACAAAGAAGG + Intergenic
1090217074 11:124978044-124978066 AGTACATATGAACACAAAGAAGG - Intronic
1091126145 11:133100121-133100143 AGTACACATGGGGACAAAGATGG + Intronic
1091282911 11:134392007-134392029 TGTAAAGACGAGGTCAAGGAGGG - Exonic
1092821725 12:12359174-12359196 AGAAATTTGGAGGACAAAGAGGG - Intronic
1093019700 12:14192080-14192102 AGTAAAAACGAAAACAAAAAAGG + Intergenic
1094079591 12:26518320-26518342 AGTACATATGAACACAAAGAAGG + Intronic
1094769882 12:33643459-33643481 AGTAACTGATAGGACAAAGAAGG - Intergenic
1095066825 12:37787921-37787943 AGTAGATAAAAGGACAAAGATGG + Intergenic
1097408987 12:59227438-59227460 AGTAAATAAAACCACAAAGATGG - Intergenic
1097764312 12:63506969-63506991 AGTAAATAAAGAGACAAAGAAGG + Intergenic
1097983299 12:65756281-65756303 AATGAATAAGAGGACATAGAGGG - Intergenic
1098280531 12:68857887-68857909 AGTAAATAGGAGGAAAATAAAGG + Intronic
1098403046 12:70094019-70094041 AGTACATAAGAACACAAAGAAGG + Intergenic
1098513312 12:71344710-71344732 AGAAAAGAAGAAGACAAAGAAGG + Intronic
1099675017 12:85748060-85748082 AGGAAATACTAGTACAAACACGG - Intergenic
1100529541 12:95451004-95451026 AGTAAGTAGGAAGATAAAGAGGG + Intergenic
1100579823 12:95928656-95928678 AGTAGATACAACCACAAAGATGG - Intronic
1101054708 12:100900275-100900297 AGTAAATAAAAAGAGAAAGAAGG - Intronic
1101071814 12:101083279-101083301 AAGAAACACCAGGACAAAGAAGG - Intronic
1101705267 12:107215429-107215451 AGTAAATAGGAAGGTAAAGAGGG - Intergenic
1101708369 12:107242125-107242147 AGTAAATATGAGGACAGGCAGGG + Intergenic
1103352035 12:120290787-120290809 AGTACCTACAAGGTCAAAGACGG - Intergenic
1103862425 12:124025627-124025649 AATAAATAAGAGGAAAAATAGGG - Intronic
1103993799 12:124816232-124816254 AGTAAAGAAGTGGACAAATAAGG - Intronic
1104870075 12:131988744-131988766 AGTAATGAGGAGGATAAAGAAGG - Intronic
1105231978 13:18504486-18504508 AGTAGATACAACCACAAAGATGG + Intergenic
1105557050 13:21457378-21457400 AGTAAATAAGAAGATAAAGGAGG + Intronic
1105954937 13:25272637-25272659 GGTACATACGAGCACAAAGATGG - Intronic
1108164260 13:47675778-47675800 AGTGAATACTAGTAAAAAGAAGG + Intergenic
1108224833 13:48277999-48278021 AGTAAAGATGAGGCCAAACATGG - Intergenic
1108448728 13:50537439-50537461 AGTAAATAATAGCACAAAGGAGG - Intronic
1108816593 13:54299406-54299428 AGTAATTAAAAAGACAAAGAAGG - Intergenic
1109095178 13:58105322-58105344 AGTAAAAAAAAGGACCAAGAAGG - Intergenic
1109139535 13:58696922-58696944 AGTACACACGAACACAAAGAGGG + Intergenic
1109823235 13:67685368-67685390 AGTAGATAAAAGCACAAAGATGG - Intergenic
1109869748 13:68319082-68319104 AGAAAAAACGAAGACAAAGAAGG - Intergenic
1109972082 13:69783200-69783222 AGTAGATAAAATGACAAAGATGG + Intronic
1111932720 13:94527654-94527676 AGTAGATAAAAGCACAAAGATGG + Intergenic
1112446209 13:99466475-99466497 AGTAGATACGGACACAAAGAAGG - Intergenic
1113214334 13:108020495-108020517 AGAAAAAAAAAGGACAAAGAAGG + Intergenic
1113270992 13:108674270-108674292 AGTAAATACAAGGAAACAGCTGG - Intronic
1113550811 13:111191756-111191778 AGTAAATAGGAAGGTAAAGAGGG + Intronic
1114898394 14:27024275-27024297 AGTAAATACAAGGAAAATTATGG + Intergenic
1116038447 14:39656894-39656916 AGTAGATAAAACGACAAAGATGG + Intergenic
1116096781 14:40380339-40380361 AGTAGATACAACCACAAAGATGG + Intergenic
1116192380 14:41677108-41677130 AGTAAAAACAAGGAGAAAGGGGG + Intronic
1116450369 14:45058194-45058216 AGTAAAAAAAAAGACAAAGAAGG - Intronic
1116923246 14:50604116-50604138 ATTAAAGACGAGAATAAAGAAGG - Intronic
1117154728 14:52927362-52927384 AGAAAATATGAGCACAGAGAAGG + Intronic
1118269803 14:64332370-64332392 AGTAAATAACAGAATAAAGATGG + Intronic
1118484118 14:66197724-66197746 AGTAGAAAAAAGGACAAAGAGGG + Intergenic
1119893821 14:78202883-78202905 ATTACATATGAGGACACAGAGGG + Intergenic
1123195455 14:106611551-106611573 AGTAAATTTGAGGCCAATGAGGG + Intergenic
1123399992 15:19974562-19974584 AGTAAATTTGAGGCCAATGAGGG + Intergenic
1124219711 15:27839050-27839072 AGTAAGTGCGTGGAGAAAGAAGG + Intronic
1124514964 15:30359977-30359999 AGAAGATAAGAGGCCAAAGAAGG - Intergenic
1124714848 15:32050763-32050785 AGTAAATAAAACCACAAAGATGG - Intronic
1124727958 15:32170785-32170807 AGAAGATAAGAGGCCAAAGAAGG + Intronic
1125254891 15:37752290-37752312 AGTAGAAACGAGGTCAAAAATGG + Intergenic
1129040037 15:72677906-72677928 AGAAAATAAGAGGAGAAAAAGGG - Intronic
1130413822 15:83671309-83671331 AGTAAAGAGGACGTCAAAGAAGG - Intronic
1130581423 15:85140481-85140503 AGTAAATTGGAAGACAATGAAGG + Intergenic
1130847245 15:87758857-87758879 AGTAAATACAAGGAGCAAGAGGG - Intergenic
1131820015 15:96263027-96263049 AGCCAGTACGGGGACAAAGATGG + Intergenic
1131968840 15:97872427-97872449 AGAAAATAAGAGGACACAAATGG + Intergenic
1144399493 17:14882675-14882697 AGTAAAAAAAATGACAAAGAAGG - Intergenic
1146007034 17:29166903-29166925 AAGAAAGACAAGGACAAAGATGG - Exonic
1147290115 17:39435242-39435264 AACAAATACTAGGACAGAGATGG + Intronic
1149162908 17:53716207-53716229 AGTACATATGGGCACAAAGAAGG - Intergenic
1149577741 17:57726202-57726224 AGTCAATGCCAGCACAAAGAGGG - Intergenic
1150506704 17:65706313-65706335 AGTAAATACAAGGAAAATGGGGG + Intronic
1150726931 17:67658766-67658788 AGTAAAGGATAGGACAAAGACGG - Intronic
1151254125 17:72862391-72862413 AATCAATATGAGGACAAAGGAGG + Intronic
1153084885 18:1273623-1273645 ATTAAATAAAAGGAGAAAGATGG - Intergenic
1153289825 18:3489698-3489720 AGTACATATGAACACAAAGATGG - Intergenic
1153497492 18:5714585-5714607 AGTACATATAATGACAAAGATGG - Intergenic
1153533312 18:6071946-6071968 ATTAAATATAAGGACAATGATGG + Intronic
1154521346 18:15234219-15234241 AGTAGATACAACCACAAAGATGG - Intergenic
1155598051 18:27510897-27510919 AGTAAATAAAACCACAAAGATGG + Intergenic
1156141314 18:34115115-34115137 AGCAAGTTCGAGCACAAAGATGG + Intronic
1157963862 18:52186519-52186541 TGTAATTATGAGGACAAATAAGG - Intergenic
1158749165 18:60238949-60238971 AGTACATAGGATCACAAAGAAGG - Intergenic
1159707569 18:71710712-71710734 AATACATACGAGGAGAAAGATGG + Intergenic
1159905546 18:74087429-74087451 AGTACATATGAACACAAAGAAGG - Intronic
1163339482 19:16695825-16695847 AGACTATACGAGGACAGAGAAGG - Intergenic
1164493911 19:28740126-28740148 AGTAGATAAGAAGAAAAAGAAGG + Intergenic
1165675884 19:37722901-37722923 ACTAAATATGAGGAAAAAAATGG - Intergenic
1166586312 19:43952171-43952193 CCTAAATAAGAGGTCAAAGACGG - Intronic
1167623443 19:50571112-50571134 AGAAAATAAGAGGACAATTAGGG + Intergenic
1168394127 19:56033733-56033755 AGTAAAAACGAAGAAAAACAAGG - Intronic
924992651 2:326783-326805 AGTAATTAAAAAGACAAAGAAGG - Intergenic
925281689 2:2689747-2689769 AGTAATGACCAGGACACAGAGGG + Intergenic
925933658 2:8732605-8732627 AGTACAGATGAGGAAAAAGAAGG + Intronic
925965779 2:9064585-9064607 AGTCAAAACGAGGGCAAAGTTGG - Intergenic
926403681 2:12526867-12526889 AGTAGATAAGACCACAAAGATGG - Intergenic
927098590 2:19768069-19768091 AGTAAATACCATGACTAAGTGGG + Intergenic
927295667 2:21450230-21450252 AGTGAAAAAGAGGAAAAAGAAGG - Intergenic
928390412 2:30905085-30905107 AGTAAATAAAACCACAAAGATGG + Intergenic
928707439 2:33965344-33965366 AGTAAGTAGCAGGACAGAGATGG + Intergenic
929184905 2:39083552-39083574 AGTAGATGGGAGGAGAAAGATGG + Intronic
931048708 2:58386656-58386678 AGTAAATAAAACCACAAAGATGG - Intergenic
931591621 2:63889616-63889638 AGGAAATAAAAAGACAAAGATGG + Intronic
931905353 2:66836710-66836732 AGGAAATAAGAGGGAAAAGATGG + Intergenic
935013495 2:99157503-99157525 AGTAAATAGGAGGCCCAAGGTGG - Intronic
935056272 2:99570253-99570275 TGTCAATATGTGGACAAAGAAGG - Intronic
935519733 2:104089981-104090003 AGTACATATGGGCACAAAGAAGG + Intergenic
936000814 2:108828235-108828257 ATCAAATACGAGAACAAGGAAGG + Intronic
937592390 2:123629603-123629625 AGTAAATAAAAGCACAAAGATGG + Intergenic
938154353 2:128919342-128919364 AGGAAAGAAGAGGAGAAAGAGGG - Intergenic
938520704 2:132067986-132068008 AGTAGATACAACCACAAAGATGG - Intergenic
939197101 2:138986835-138986857 AGTACATAAGAAAACAAAGAAGG - Intergenic
939239275 2:139537936-139537958 AGTAGATAAAACGACAAAGATGG - Intergenic
940085263 2:149851332-149851354 AGTAGATACAACCACAAAGATGG + Intergenic
940430659 2:153586433-153586455 AGTAAAAAGAAAGACAAAGAAGG + Intergenic
941053505 2:160762038-160762060 AGTAGATAAAAGCACAAAGATGG - Intergenic
941056845 2:160798343-160798365 AGTAGATAAAAGCACAAAGATGG + Intergenic
941448136 2:165626990-165627012 AGTAAATAAAAGCACAAAGCTGG - Intronic
942213535 2:173695413-173695435 AGTAAATAAGAGAACACAGTGGG - Intergenic
943198403 2:184786207-184786229 AGTAAATACTAGGAGAAGAATGG + Intronic
944616727 2:201467889-201467911 AGTCAATACCATGACAGAGAAGG - Intronic
944755788 2:202760466-202760488 AGGAAAGGCGAAGACAAAGAGGG - Intronic
944759200 2:202795716-202795738 TCTCAATACTAGGACAAAGATGG + Intronic
945750175 2:213772095-213772117 AGGAAATAAGAGGACACAAATGG - Intronic
946860492 2:223996493-223996515 AGTGAAGAGGTGGACAAAGAAGG - Intronic
947352794 2:229263888-229263910 AGTAAATACTAAGAAAAAGGTGG + Intronic
947959229 2:234221157-234221179 AGAGAATAAGAAGACAAAGATGG - Intergenic
949054057 2:241915041-241915063 AGTAAATTTGAGTAAAAAGATGG - Intergenic
1169276180 20:4235179-4235201 AGCAAACACGAGGGCACAGAAGG - Intronic
1169671129 20:8104005-8104027 AGTAAAAAACAGGATAAAGAAGG - Intergenic
1170873289 20:20228220-20228242 AAAAAATACGAAGACAAAGAAGG - Intronic
1171901773 20:30865184-30865206 AGGAAAGAAGGGGACAAAGAAGG + Intergenic
1172772005 20:37387348-37387370 AGTCAATACAAGGACACAGGTGG - Intronic
1172873140 20:38148099-38148121 AGGAAACAAGAGGAGAAAGAGGG + Intronic
1173294567 20:41745258-41745280 AGCAAAAAAAAGGACAAAGAAGG - Intergenic
1173772375 20:45672642-45672664 AGTACACACGGGCACAAAGAAGG + Intergenic
1173774486 20:45692945-45692967 AGTAGATAAGACCACAAAGATGG - Intronic
1174683373 20:52430144-52430166 AGTACATACGGGCACAAAGAAGG + Intergenic
1174853814 20:54023605-54023627 AGAAAATACCAGGAGACAGATGG + Intronic
1176775950 21:13132787-13132809 AGTAGATACAACCACAAAGATGG + Intergenic
1176968079 21:15234386-15234408 AGTACATATGGGCACAAAGAAGG + Intergenic
1178011951 21:28297748-28297770 AGAAAAAATGAGAACAAAGAGGG - Intergenic
1178489528 21:33040271-33040293 AGTAAATATGAACACAAAGAAGG - Intergenic
1180335146 22:11571132-11571154 AGGAAAGAAGGGGACAAAGAAGG + Intergenic
1180523933 22:16236060-16236082 AGTAGATACAACCACAAAGATGG + Intergenic
949716640 3:6939704-6939726 AATAAATACCAGGATAATGATGG - Intronic
952227505 3:31393818-31393840 AGTCAATACGATGAAAATGAAGG + Intergenic
953249172 3:41227912-41227934 AGTACACACGGGCACAAAGAAGG - Intronic
955255368 3:57325595-57325617 AGTAGATACAACCACAAAGATGG + Intronic
957968074 3:87346540-87346562 AGTCAATATGGGGACAAAGTTGG + Intergenic
958498160 3:94872017-94872039 AGTAAATTAGTGGACACAGATGG + Intergenic
958583611 3:96057924-96057946 AGTAAAAAAGAGGAAGAAGAAGG - Intergenic
959000098 3:100954324-100954346 ATTATAAACAAGGACAAAGAAGG + Intronic
959239947 3:103777709-103777731 AGAAAATAAGAGGAGGAAGAAGG + Intergenic
959345415 3:105188448-105188470 AGTAAATAATATGAAAAAGAAGG - Intergenic
959820207 3:110725564-110725586 ATTACATACAAGGAAAAAGAAGG + Intergenic
959854676 3:111137593-111137615 AGTAAATACGAGGACAAAGATGG - Intronic
960859940 3:122142210-122142232 AGTAGATACAATCACAAAGACGG - Intergenic
961412942 3:126736144-126736166 TTTAAATAAGAGGAGAAAGATGG + Intronic
962532155 3:136292750-136292772 AGAAGATAAGAGGGCAAAGAGGG + Intronic
962935432 3:140076335-140076357 AGTAAAAATGAGCACAAAGCAGG - Intronic
964286514 3:155124536-155124558 AGTAGATAAAAGCACAAAGATGG - Intronic
964563211 3:158020564-158020586 AGTAGATAAAAGCACAAAGATGG + Intergenic
966666564 3:182478230-182478252 AGAAAATACGAGCATAAAGAAGG + Intergenic
966900169 3:184477388-184477410 ACTAAATAGAAGGACACAGATGG - Intronic
969199917 4:5594597-5594619 AGTAAATAAAACCACAAAGATGG + Intronic
971429275 4:26547129-26547151 AGTACATAGGAACACAAAGAAGG - Intergenic
971683242 4:29729533-29729555 AGTAAATACGGAGATAGAGAGGG + Intergenic
971705413 4:30035802-30035824 AGTAAATAAGAGGAAAATAATGG - Intergenic
972232497 4:37091674-37091696 AGTAAAAAAAAAGACAAAGAAGG - Intergenic
973233567 4:47870840-47870862 AGAAAATACTAAAACAAAGATGG + Intronic
973569411 4:52223340-52223362 AGTAAATAAAATCACAAAGATGG - Intergenic
974238093 4:59207469-59207491 AGTAGATAAAAGCACAAAGATGG + Intergenic
974487763 4:62526294-62526316 AGAAAGTAGGAGGACAAAAAGGG + Intergenic
974537580 4:63190588-63190610 AGTAAATAGGAAGGTAAAGAAGG - Intergenic
975531333 4:75402083-75402105 AGTAGATAAAAGCACAAAGATGG + Intergenic
975535640 4:75447654-75447676 AGTAGATAAAAGCACAAAGATGG - Intergenic
975817067 4:78229292-78229314 AAAAAAAACAAGGACAAAGAGGG - Intronic
977296761 4:95218688-95218710 AGTAAAAAGGAGGTCAATGATGG + Intronic
977710715 4:100121141-100121163 TGTAAATGCGGGGACAAAGAAGG - Intergenic
977881421 4:102210049-102210071 AGTAAATAAAACCACAAAGATGG - Intergenic
978140770 4:105315244-105315266 ACGAAATAAGAGGACAAAAATGG + Intergenic
979160700 4:117457138-117457160 AGTAAAGACAAAGACAGAGATGG - Intergenic
979927517 4:126585789-126585811 AGTAAAAAGAAAGACAAAGAAGG + Intergenic
980289207 4:130824061-130824083 AGAAAATAGTAGGACAAAGGGGG - Intergenic
980531698 4:134064789-134064811 AGTACATACGGACACAAAGAAGG - Intergenic
981978915 4:150768133-150768155 AGTAAATCTGAGAATAAAGAGGG + Intronic
982961451 4:161843412-161843434 AGGAAATAAGAGGACACAAATGG - Intronic
982964672 4:161889810-161889832 TGTAAATAGGTGGATAAAGATGG - Intronic
983446474 4:167858773-167858795 AGTAGATACAACCACAAAGATGG + Intergenic
985755353 5:1710703-1710725 AGTAGATAAAACGACAAAGATGG + Intergenic
986127217 5:4894275-4894297 AGTAAATATTAGGAAAGAGATGG - Intergenic
986467386 5:8039278-8039300 AGTAAATATGGACACAAAGAAGG - Intergenic
987730877 5:21771012-21771034 AGTACATATGAACACAAAGAAGG + Intronic
987977301 5:25030912-25030934 ACTAAATATGAACACAAAGAGGG - Intergenic
988469822 5:31527451-31527473 TGTAAAGGGGAGGACAAAGAAGG - Intronic
989739601 5:44754984-44755006 ATTTAATACAAGGACAAAGTTGG + Intergenic
991213459 5:64134215-64134237 AGTAGATAAAAGCACAAAGATGG - Intergenic
993273917 5:85831803-85831825 AGTACATATGAACACAAAGAAGG + Intergenic
993444227 5:87991474-87991496 GGTAGATAAGACGACAAAGATGG + Intergenic
995508999 5:112889442-112889464 AGTAAATAGGATGATAAAGAAGG + Intronic
995771512 5:115675533-115675555 AGTAAATAAAACCACAAAGATGG + Intergenic
995781264 5:115777878-115777900 AGAAAATACGGGGAAAAAGGAGG - Intergenic
997072943 5:130639968-130639990 AGTAAATAGGAAGGTAAAGAGGG - Intergenic
998596105 5:143532099-143532121 AGTAAAAAAGAGGATGAAGAAGG - Intergenic
998713225 5:144849866-144849888 AGTAAATAGGAAGGTAAAGAGGG + Intergenic
999270342 5:150293224-150293246 AGTAAAAAAGATGAGAAAGACGG - Intergenic
999567368 5:152879781-152879803 AGTAAATATGAACACAAAGAAGG + Intergenic
999815280 5:155169354-155169376 AGTAGATAAGACCACAAAGATGG + Intergenic
999918209 5:156287042-156287064 GGGAAATACGACAACAAAGAGGG + Intronic
1001052063 5:168421596-168421618 AGTAAATATGAGCTGAAAGATGG + Intronic
1001090374 5:168735917-168735939 AGCAAATAGGATGACAAAGAGGG - Intronic
1002413363 5:179101953-179101975 AGTAAATAAAACCACAAAGATGG + Intergenic
1003993045 6:11506817-11506839 AGTACATATGAACACAAAGAAGG + Intergenic
1005436918 6:25822143-25822165 AGAAAAGAAGATGACAAAGAAGG - Intronic
1005789975 6:29289767-29289789 AGAAAATATGAGAATAAAGAAGG + Intergenic
1008776182 6:55040741-55040763 AGAATATAGGAGGACAAAGGTGG + Intergenic
1009466774 6:63980704-63980726 AGAAAATAGGAGGAAAGAGAGGG + Intronic
1009528069 6:64773171-64773193 AGTACATATGAAAACAAAGAAGG - Intronic
1009609510 6:65922723-65922745 AGTACATATGAACACAAAGAAGG + Intergenic
1009713233 6:67352209-67352231 AGTAAGTAGGAGGACAAATGGGG + Intergenic
1010530299 6:76959861-76959883 AGTAAATAAAACCACAAAGATGG + Intergenic
1010614492 6:77996197-77996219 AGTAGATAAAACGACAAAGATGG - Intergenic
1011223236 6:85080034-85080056 AGTAAATTTGATGACCAAGATGG - Intergenic
1011374420 6:86674361-86674383 AGTAAATAGGAAGGTAAAGAGGG + Intergenic
1012144281 6:95662080-95662102 AGAAAATGTGAGGACAAAGAGGG + Intergenic
1012984640 6:105862530-105862552 TGTAAATATGAGCAAAAAGATGG + Intergenic
1013286714 6:108688302-108688324 AGCAGATAAGAGGACAAAGATGG - Intergenic
1013507872 6:110817145-110817167 ATTCATTAGGAGGACAAAGAAGG + Intronic
1014314961 6:119852251-119852273 AGCAAAGAGGAGGAAAAAGAAGG - Intergenic
1014487463 6:122016909-122016931 AGTACATACGGACACAAAGAAGG - Intergenic
1015492679 6:133844422-133844444 AGAAAATAGGAGGAAAACGATGG + Intergenic
1017101594 6:150854046-150854068 AGTAAATAGGAAGGTAAAGAGGG - Intergenic
1018185707 6:161264179-161264201 AGTAAATATAGGGAGAAAGAAGG - Intronic
1020855502 7:13416406-13416428 AGTAAATAGGAGGCAAAAGAGGG + Intergenic
1021141024 7:17025570-17025592 GGTAAATTCCAGGACAGAGATGG - Intergenic
1021667802 7:23003789-23003811 AGAAAATAGTAGGGCAAAGAGGG + Intronic
1024370481 7:48577866-48577888 ATTATATACTATGACAAAGAAGG + Intronic
1024570361 7:50718076-50718098 ACTAAGTGCCAGGACAAAGAGGG + Intronic
1025195286 7:56927743-56927765 AGTAAATAAGAAGAAGAAGAAGG - Intergenic
1025676666 7:63649200-63649222 AGTAAATAAGAAGAAGAAGAAGG + Intergenic
1027791671 7:82643478-82643500 AGTAAATAGGAAGGTAAAGAGGG - Intergenic
1028362915 7:89990675-89990697 AGTACATATGAACACAAAGAGGG + Intergenic
1028472688 7:91222049-91222071 AGTAAATGCAAGCACACAGAGGG + Intergenic
1028494605 7:91449339-91449361 AGCAAATAGGAAGATAAAGAGGG + Intergenic
1028646720 7:93106481-93106503 AGAAAATAAGAGAAAAAAGAAGG + Intronic
1029916092 7:104210746-104210768 AGTAAATAAAACCACAAAGATGG + Intergenic
1030869901 7:114742720-114742742 AGATAATATGTGGACAAAGAAGG - Intergenic
1031592096 7:123605796-123605818 AGTACATACGGACACAAAGAAGG + Intronic
1033718564 7:144030976-144030998 AGTAAATATGAGGACTTAGCTGG - Intergenic
1033931686 7:146531171-146531193 AGTACATATGAGCACAAAAAAGG + Intronic
1037191438 8:16130672-16130694 AGTAGATACGGACACAAAGAAGG - Intronic
1038040112 8:23717118-23717140 AGCAACTACATGGACAAAGATGG + Intergenic
1038083194 8:24163654-24163676 AGTAAATAAGTCCACAAAGATGG - Intergenic
1038938839 8:32281551-32281573 AGTACACATGGGGACAAAGAAGG - Intronic
1039065462 8:33603702-33603724 AGTGTATATGAGCACAAAGAAGG - Intergenic
1040793025 8:51255968-51255990 AATAAATACCAGGACTTAGAGGG + Intergenic
1040796214 8:51292261-51292283 AGTAAGTAGGAGGGTAAAGAGGG + Intergenic
1041002546 8:53466587-53466609 AGTAAATAGGAAGGTAAAGAGGG - Intergenic
1044657136 8:94560623-94560645 AGTTAAAAAGAAGACAAAGAGGG - Intergenic
1045504926 8:102771575-102771597 AGGAAATAAGAAGACTAAGAGGG + Intergenic
1047111662 8:121796353-121796375 TGTAATTACAAGGACAATGATGG + Intergenic
1047280951 8:123445139-123445161 AGAAAATTGGAGGACAAAGCAGG - Intronic
1048171955 8:132115774-132115796 TGTAAATCAAAGGACAAAGATGG - Intergenic
1048389091 8:133944080-133944102 AGTAAATACAAGGGCAACAAGGG + Intergenic
1048690544 8:136957701-136957723 AATAAATAGGGGTACAAAGATGG - Intergenic
1049036469 8:140080137-140080159 AGTACATACAAGGTCATAGAAGG + Intronic
1050185103 9:2965049-2965071 AGTAACTATGGGGAGAAAGAAGG + Intergenic
1051945507 9:22565004-22565026 AGTAAACATGAACACAAAGAAGG - Intergenic
1052057163 9:23918853-23918875 AGTAAATAGGAAGGTAAAGAGGG + Intergenic
1052735351 9:32336316-32336338 AATGAATAGGAGGTCAAAGAAGG + Intergenic
1053487165 9:38468492-38468514 AGAAAATATGAGGAGATAGATGG - Intergenic
1053697945 9:40655386-40655408 AGTAAAAAGGAGGAGGAAGAGGG + Intergenic
1053802697 9:41774337-41774359 TGTAAATACAGGGACAAAGATGG - Intergenic
1054142544 9:61540733-61540755 TGTAAATACAGGGACAAAGATGG + Intergenic
1054191003 9:61985683-61985705 TGTAAATACAGGGACAAAGATGG - Intergenic
1054309236 9:63454794-63454816 AGTAAAAAGGAGGAGGAAGAGGG + Intergenic
1054441177 9:65262742-65262764 AGTAAAAAGGAGGAGGAAGAGGG + Intergenic
1054462289 9:65471883-65471905 TGTAAATACAGGGACAAAGATGG + Intergenic
1054489099 9:65758747-65758769 AGTAAAAAGGAGGAGGAAGAGGG - Intergenic
1054647366 9:67602034-67602056 TGTAAATACAGGGACAAAGATGG + Intergenic
1055369876 9:75586178-75586200 AGTACATATGGGCACAAAGAAGG + Intergenic
1055380937 9:75706216-75706238 AGTCAATAAAACGACAAAGATGG - Intergenic
1055407048 9:75986155-75986177 GGTAAAAAAGCGGACAAAGAGGG + Exonic
1056335586 9:85565512-85565534 AAAAATTACAAGGACAAAGAAGG + Intronic
1060040192 9:120293730-120293752 AGTAAATGCTAGGACAGAGATGG + Intergenic
1060434392 9:123581199-123581221 AGTAAATGAGAGGTCAATGATGG + Intronic
1060858253 9:126933190-126933212 AGGAAATGGGAGGAGAAAGAGGG + Intronic
1061478735 9:130885894-130885916 ATAAAATTCGAGGACAGAGACGG - Intronic
1202780308 9_KI270717v1_random:28576-28598 AGTAAAAAGGAGGAGGAAGAGGG + Intergenic
1186492343 X:9983799-9983821 AGTAAACCCGAGGAGAAAGTCGG + Intergenic
1187312603 X:18160095-18160117 AGGAAAGACAAGGTCAAAGAAGG + Intergenic
1187354755 X:18557458-18557480 AGTATCTACGAGGATATAGAGGG - Intronic
1188571436 X:31589594-31589616 ACTAAATAAGAGGTCAAACATGG - Intronic
1188573516 X:31618024-31618046 AGTACATATGAACACAAAGAAGG + Intronic
1188957982 X:36456483-36456505 AGTAAAAAAAATGACAAAGAGGG + Intergenic
1189562633 X:42207274-42207296 AGTAAATAAAACCACAAAGATGG - Intergenic
1191087628 X:56586638-56586660 AGTAGATAAAACGACAAAGATGG - Intergenic
1192029067 X:67489367-67489389 AGTAGATAAAAGCACAAAGATGG + Intergenic
1192098628 X:68239778-68239800 ATTAAATAAGTGCACAAAGATGG - Intronic
1193616902 X:83699932-83699954 AGTACATATGAACACAAAGAAGG - Intergenic
1193751984 X:85357082-85357104 TGTAAATAGGAGGAGAAAGAGGG - Intronic
1194982964 X:100459379-100459401 AGTACATACGGACACAAAGAAGG + Intergenic
1195500746 X:105595781-105595803 AGAAAATCCCAGGACTAAGATGG - Intronic
1197598892 X:128503707-128503729 AGTAAATATGGAAACAAAGAAGG - Intergenic
1197955091 X:131937930-131937952 AGCAAATTCAAGGACAAACAGGG - Intergenic
1198626904 X:138586108-138586130 AGTACATACGGACACAAAGAAGG - Intergenic
1198735384 X:139778977-139778999 AGTAAATAAAAAGACAAAGCGGG + Intronic
1198823570 X:140674958-140674980 AGTAAAAACAAGTACAAAAAGGG + Intergenic
1200959835 Y:8986543-8986565 AGTAAATAGGAAGGTAAAGAGGG - Intergenic
1201258703 Y:12135871-12135893 AGTAGATAAAACGACAAAGATGG + Intergenic
1201631822 Y:16078243-16078265 AGTAAATAGGAAGGTAAAGAAGG - Intergenic