ID: 959855166

View in Genome Browser
Species Human (GRCh38)
Location 3:111145341-111145363
Sequence TTCGGTTACCACTTCATGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 83}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959855166_959855169 10 Left 959855166 3:111145341-111145363 CCTTTCATGAAGTGGTAACCGAA 0: 1
1: 0
2: 0
3: 2
4: 83
Right 959855169 3:111145374-111145396 AAATATCTTTGAAGTTTTAATGG 0: 1
1: 1
2: 6
3: 78
4: 837

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959855166 Original CRISPR TTCGGTTACCACTTCATGAA AGG (reversed) Intronic
904362962 1:29990417-29990439 TTGGGTTATCACTTCTTGCAGGG + Intergenic
909027275 1:70496798-70496820 TTCAGCTACCACTATATGAAAGG + Intergenic
916674659 1:167055198-167055220 TTCTGGTAACACTCCATGAAAGG + Intronic
917718064 1:177758089-177758111 TTCGGATACAAATTCATCAAAGG + Intergenic
923375313 1:233356104-233356126 TTCTGTGCCCATTTCATGAATGG + Intronic
1066082411 10:31944600-31944622 TTCTGTAGCCACTTCCTGAAAGG - Intergenic
1067183698 10:44009385-44009407 TTAGGTTACCATTTCAAGACAGG - Intergenic
1067343986 10:45424995-45425017 TTTGGCTACCAGTTCCTGAATGG + Exonic
1068583416 10:58768438-58768460 TTCGTTTACCATTTCTTGTAAGG - Intronic
1072570135 10:96651327-96651349 TTCGGTTAGCAGTTTATCAAGGG + Exonic
1073173432 10:101533402-101533424 TACAGTTACCACTACCTGAAAGG - Intronic
1080002819 11:27370295-27370317 TTCTCTTAGCACTTCCTGAAGGG - Intronic
1081535089 11:43990482-43990504 TGAGGGTTCCACTTCATGAATGG - Intergenic
1087220090 11:95537454-95537476 TTCCTTCACTACTTCATGAAGGG - Intergenic
1090595701 11:128319013-128319035 ATCGCATACCACTTCCTGAAGGG - Intergenic
1094190655 12:27694985-27695007 TACAGTTACCACATAATGAATGG - Exonic
1094459709 12:30682159-30682181 TTTGGTTACCATATCCTGAATGG + Intronic
1095650528 12:44603718-44603740 TTCATTTACCACTTCACAAAAGG - Intronic
1100876805 12:98970760-98970782 ATCTGTTACTACTTCCTGAAAGG + Intronic
1102616071 12:114155376-114155398 ATCAGTTACAACTTCAGGAAAGG + Intergenic
1105032671 12:132895060-132895082 TGCAGTTACCCCATCATGAAAGG + Intronic
1105032721 12:132895464-132895486 TGCAGTTACCCCATCATGAAAGG + Intronic
1105032760 12:132895787-132895809 TGCAGTTACCCCATCATGAAAGG + Intronic
1105032807 12:132896191-132896213 TGCAGTTACCCCATCATGAAAGG + Intronic
1105032830 12:132896433-132896455 TGCAGTTACCCCATCATGAAAGG + Intronic
1105032876 12:132896836-132896858 TGCAGTTACCCCATCATGAAAGG + Intronic
1105032885 12:132896916-132896938 TGCAGTTACCCCATCATGAAAGG + Intronic
1120443656 14:84566926-84566948 TTAGGTTTCCACTTCATGGAAGG - Intergenic
1120743904 14:88136865-88136887 CTCGGTTATAACTTCATCAATGG - Intergenic
1123158865 14:106257957-106257979 TTCAGTTACTACTACATGAGCGG - Intergenic
1124812178 15:32952100-32952122 TTCAGTTGCCACTGCAGGAAAGG - Intronic
1127544124 15:59974294-59974316 TTTGGGTACCACTTCATGGAAGG - Intergenic
1130804471 15:87304385-87304407 TTGGGTAACAATTTCATGAAAGG - Intergenic
1132433796 15:101780966-101780988 TTCGGAGACCACTGAATGAAGGG + Intergenic
1153379350 18:4419406-4419428 TTCCTTTACCACTTTTTGAAGGG - Intronic
1155047346 18:22114367-22114389 TTCTGTTTCCAGTTCATCAACGG - Intergenic
1156565090 18:38178993-38179015 TTAAGATACCACTTGATGAATGG + Intergenic
1157646005 18:49272169-49272191 GTAACTTACCACTTCATGAATGG + Exonic
1162088316 19:8261737-8261759 TTCGGCTACTACTTCTTCAACGG + Exonic
1165016293 19:32882653-32882675 TTAGGTTACCAGTTGATGCAGGG - Intronic
925758568 2:7160355-7160377 TTCTTTTACCACTTCTTGCAAGG + Intergenic
930311154 2:49740991-49741013 TTGTGTAAACACTTCATGAACGG - Intergenic
937598036 2:123693712-123693734 TTTGTTTAACACTTCATGCAAGG - Intergenic
938214544 2:129499896-129499918 TTCATGTACCATTTCATGAAGGG - Intergenic
941595167 2:167467303-167467325 TTGGGTTATTACTTCATGTAGGG + Intergenic
1168773935 20:433114-433136 TTCGGTCACCACTTCATCCCTGG + Intergenic
1180726059 22:17947316-17947338 CCCAGTTACCTCTTCATGAAGGG - Intronic
1182884738 22:33763745-33763767 TTTGGTAAGCACTTCATTAAAGG - Intronic
950687281 3:14627616-14627638 GGAGGTTAGCACTTCATGAAAGG - Intergenic
953193044 3:40707230-40707252 TTCGTTTAACATTTCTTGAAAGG + Intergenic
954952838 3:54490375-54490397 GCCGGTTCCCGCTTCATGAATGG + Intronic
959855166 3:111145341-111145363 TTCGGTTACCACTTCATGAAAGG - Intronic
965341192 3:167493302-167493324 ATCTGATACCACTCCATGAACGG + Intronic
965828526 3:172754973-172754995 TTCCTTTACCACTTTATAAATGG + Intronic
966409679 3:179635244-179635266 GTCTGTTACCTCTTCATAAAAGG - Intergenic
967588188 3:191239717-191239739 ATTGGTTACCACTTAATAAATGG - Intronic
977637261 4:99313878-99313900 TTCCTTTAGCACTTCCTGAATGG + Exonic
977639674 4:99342852-99342874 TTCCTTTAGCACTTCCTGAATGG + Exonic
980017291 4:127665496-127665518 TTCTTTTACCTCTTCCTGAAAGG + Intronic
980994943 4:139771098-139771120 TTGGGTAAAGACTTCATGAATGG - Intronic
981162470 4:141514925-141514947 TTTTCTTACCATTTCATGAAGGG - Intergenic
981941791 4:150288813-150288835 TTAAGTTACCATTTCATGGATGG + Intronic
983581572 4:169314663-169314685 TTGTTTTACCACATCATGAAGGG - Intergenic
985827049 5:2200262-2200284 CTCAGTTACCCCCTCATGAATGG + Intergenic
988895640 5:35670806-35670828 TTAGGTGACCAGTTCATTAAGGG + Intronic
991291431 5:65036920-65036942 TCCTTTTCCCACTTCATGAAAGG + Intergenic
993881801 5:93371633-93371655 TTATTTTACCATTTCATGAAAGG - Intergenic
997983446 5:138485329-138485351 TTCTGTAACCATTGCATGAAAGG - Intergenic
998480767 5:142460780-142460802 TTCAGCTACCACTTTGTGAATGG + Intergenic
1010926215 6:81749932-81749954 CTCATTTACCACTCCATGAAGGG + Exonic
1018262535 6:161984780-161984802 TGCTGTTAGCATTTCATGAAGGG + Intronic
1021294055 7:18881888-18881910 ACCAGGTACCACTTCATGAAGGG + Intronic
1023705740 7:42940137-42940159 TTCTGTTTTCAATTCATGAATGG + Intronic
1036629215 8:10498744-10498766 CATGGTTACCATTTCATGAACGG - Intergenic
1039465351 8:37781519-37781541 CTCGCTTACCAATTCCTGAAGGG + Intergenic
1047012435 8:120686494-120686516 TGAGGTTAATACTTCATGAATGG - Intronic
1050371623 9:4927691-4927713 CTCTTTTACCACTTCATGAGAGG - Intergenic
1051116767 9:13704112-13704134 TTCAGTTACCACTTTAGCAAGGG - Intergenic
1051195102 9:14555644-14555666 TTCAGTTATCACTTCCTGGAGGG - Intergenic
1056876256 9:90334375-90334397 TTCTGTCAACACTTCTTGAAGGG - Intergenic
1058389167 9:104475246-104475268 TTCCTATACCACTTCAGGAATGG + Intergenic
1189448345 X:41102700-41102722 TTGGGTTAGCATTTCATGATTGG + Intronic
1194447984 X:94010123-94010145 TTAGGTTATCACTTAATGACTGG - Intergenic
1199191631 X:144978303-144978325 TTCGGTTCACACTTCTGGAATGG + Intergenic
1199382667 X:147189218-147189240 TTCAGTCACCAATTTATGAAGGG - Intergenic
1199518220 X:148703368-148703390 ACCTGTTACCAGTTCATGAATGG - Intronic