ID: 959855169

View in Genome Browser
Species Human (GRCh38)
Location 3:111145374-111145396
Sequence AAATATCTTTGAAGTTTTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 923
Summary {0: 1, 1: 1, 2: 6, 3: 78, 4: 837}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959855168_959855169 -8 Left 959855168 3:111145359-111145381 CCGAAGGACATATAAAAATATCT 0: 1
1: 0
2: 6
3: 57
4: 709
Right 959855169 3:111145374-111145396 AAATATCTTTGAAGTTTTAATGG 0: 1
1: 1
2: 6
3: 78
4: 837
959855166_959855169 10 Left 959855166 3:111145341-111145363 CCTTTCATGAAGTGGTAACCGAA 0: 1
1: 0
2: 0
3: 2
4: 83
Right 959855169 3:111145374-111145396 AAATATCTTTGAAGTTTTAATGG 0: 1
1: 1
2: 6
3: 78
4: 837

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959855169 Original CRISPR AAATATCTTTGAAGTTTTAA TGG Intronic
902707601 1:18216457-18216479 AAATATCATTGAGATTTTAGGGG + Intronic
902829396 1:19000850-19000872 AAATATATTTGAAGAAATAATGG + Intergenic
903783617 1:25840432-25840454 AAATATGTTTGAAGAAATAAGGG + Intronic
905707099 1:40068789-40068811 ATATTTCTTTTATGTTTTAAGGG - Intronic
906642013 1:47446701-47446723 AAAGAACTTTGGTGTTTTAAGGG + Intergenic
906867140 1:49434165-49434187 AAAGGTCTTTGAAGCCTTAATGG + Intronic
906867152 1:49434289-49434311 AAAGGTCTTTGAAGCCTTAATGG + Intronic
907637141 1:56146697-56146719 AAACATCTTAAGAGTTTTAACGG - Intergenic
908181817 1:61613236-61613258 AAAAAACTTTGAAAATTTAAAGG + Intergenic
908279307 1:62514200-62514222 ATATATCTTTTAGTTTTTAATGG - Intronic
908290239 1:62658642-62658664 AAATATCCTTGAAGAATGAAGGG + Intronic
909198092 1:72651864-72651886 AAATATGTTGGAATTTTTTAGGG + Intergenic
909225530 1:73016456-73016478 AAATATTTTTGACATTTTAGAGG + Intergenic
909288316 1:73849516-73849538 AAATATTATTGGGGTTTTAATGG + Intergenic
909324295 1:74330465-74330487 AAATAACTTTGAACTTCTACTGG - Intronic
909690417 1:78400336-78400358 AAATCACTTTCAAGTTTTTATGG - Intronic
910061755 1:83102290-83102312 AAAAATCTTTCAAATATTAATGG - Intergenic
910253078 1:85218728-85218750 AAATATATTTGATGGTTGAAAGG - Intergenic
910832276 1:91473092-91473114 TAATGTCTATGAAGTATTAATGG + Intergenic
911275728 1:95854873-95854895 GAAAATCTTTGATGTTTTATTGG + Intergenic
911344633 1:96681609-96681631 AAATATCTGTGAAATATAAAGGG - Intergenic
911493821 1:98604585-98604607 AAATATATATGAAATTTTATTGG + Intergenic
911532556 1:99062545-99062567 TAATATCTCATAAGTTTTAATGG + Intergenic
911863668 1:102988507-102988529 AAATATATTTGGAGATTGAAAGG + Intronic
911990017 1:104684263-104684285 AAATATAATTAAAGTTTTAAGGG - Intergenic
912043849 1:105428077-105428099 AAATATTTTACAATTTTTAATGG - Intergenic
912049341 1:105505233-105505255 TAATATCATTGAAATTTTGATGG - Intergenic
912194576 1:107382292-107382314 TAATTTCTTTGAAATTTAAAGGG - Intronic
912348491 1:108988710-108988732 AATTATTTTTACAGTTTTAAAGG - Intronic
914045840 1:144091491-144091513 AAATAGTTTTTAATTTTTAAAGG - Intergenic
914132270 1:144869196-144869218 AAATAGTTTTTAATTTTTAAAGG + Intergenic
914711592 1:150219362-150219384 AAATATTTTTCTACTTTTAATGG + Exonic
914809707 1:151018045-151018067 AAATATCATTTTAGTTTTTATGG - Intronic
915791961 1:158681883-158681905 AAAATGCTTTGCAGTTTTAAAGG + Intronic
916212986 1:162373574-162373596 AAGAATCTCTGCAGTTTTAAAGG - Exonic
916680399 1:167098936-167098958 AAATGTCCATGAAGTTTCAAGGG + Intronic
916770931 1:167907313-167907335 AAATAACTTTGAAATCTCAATGG + Intronic
917186771 1:172365466-172365488 AAATATTTTTGATGTGATAATGG + Intronic
918601295 1:186365615-186365637 AAATATCATGAAAGTTTTAAAGG + Intronic
918657679 1:187048397-187048419 AGATTTCTTGAAAGTTTTAATGG - Intergenic
918754009 1:188313015-188313037 AACTATTTTTAATGTTTTAAGGG - Intergenic
918803269 1:189000785-189000807 AAGAATCTTTGAATTTATAAAGG + Intergenic
918816263 1:189189373-189189395 AAATATGTTTTAAATTGTAAAGG - Intergenic
918937122 1:190935635-190935657 AAATATCTCTGAAGTTCATACGG + Intergenic
918963945 1:191316745-191316767 ACATATCTGTTAAATTTTAAAGG - Intergenic
919005147 1:191889457-191889479 AAATGTCTTTAAAGTGTTAAAGG - Intergenic
919013538 1:191997186-191997208 AAATATATTTGAAGAAATAATGG + Intergenic
919063086 1:192659205-192659227 AATTTTCTTTGTAGTTTTATAGG - Intronic
919068789 1:192727477-192727499 AAATAACTTTGAATTTCAAAAGG + Intergenic
919643538 1:200068479-200068501 TGATATCTTTGAAGTTGAAAAGG + Intronic
920667950 1:207979985-207980007 AAATACGTTTGAAGTATTAAAGG - Intergenic
920857836 1:209677430-209677452 AAACATATTTGGAGTTTTAAAGG + Intergenic
921240966 1:213181738-213181760 AAATACCTTTCAAGAGTTAAGGG + Intronic
921334149 1:214069343-214069365 ATATATCTCTGAAGTTATGAAGG - Intergenic
922031117 1:221799968-221799990 CAATATCTTCAAAGTTCTAAAGG - Intergenic
922042761 1:221913069-221913091 AAATAGATTTTAAGTTTAAATGG + Intergenic
922532131 1:226352784-226352806 AAAAAAAATTGAAGTTTTAATGG + Intergenic
923260735 1:232265630-232265652 AAATATTTTCAAAGTTGTAAAGG + Intergenic
923378295 1:233388878-233388900 AAAAATATTTGAAGATATAATGG - Intergenic
923381576 1:233425599-233425621 AATTATGTTTGAAGTTGTAAGGG - Intergenic
924360107 1:243230824-243230846 AAAAGTATTTGAAGTCTTAATGG + Intronic
924560106 1:245151328-245151350 AAATATGTTTAAGGATTTAAAGG + Intergenic
1063471536 10:6290924-6290946 AAAAATATTTGAAGTAATAATGG - Intergenic
1063513830 10:6674072-6674094 AAATATAATAAAAGTTTTAAAGG + Intergenic
1064113081 10:12555067-12555089 AAATATCCTTGAAATTTTTGGGG + Intronic
1064942403 10:20749501-20749523 AAACATATTTTAAGTGTTAAGGG - Intergenic
1064944101 10:20769098-20769120 AATTAGCTTTGCATTTTTAAAGG + Intergenic
1065194908 10:23254916-23254938 AAATATATTCGACGATTTAAAGG - Intergenic
1065247014 10:23768639-23768661 AAATGGGTTTGATGTTTTAATGG + Intronic
1065651620 10:27898662-27898684 AAATATATTTGAACTTTAATAGG + Intronic
1065666000 10:28061612-28061634 AAATATGTTTGAAGAAATAAAGG + Intronic
1067361428 10:45583384-45583406 ATATATCTTTGAACATTTATGGG - Intronic
1068352761 10:55870098-55870120 AAAAATTTTGGTAGTTTTAAGGG + Intergenic
1069230269 10:66000192-66000214 GAATATCTTTGAAAATTTATTGG + Intronic
1069622952 10:69849116-69849138 AAATGTCTTAGAATTTTCAAAGG + Intronic
1069773035 10:70911399-70911421 AAATATCTCTGAAGGATAAAGGG - Intergenic
1070210927 10:74320544-74320566 AAAAATTTTTGAAGATATAATGG - Intronic
1070246941 10:74741617-74741639 AAATCTCTTTGAGATTTTAATGG - Intergenic
1070298073 10:75182140-75182162 AAATGTCTTTGCATTATTAATGG + Intergenic
1071855569 10:89620925-89620947 AAATATCTTTGAAGTGTATCGGG - Intronic
1072501572 10:96023409-96023431 AAATCCCCTTGAAGTTTTGAAGG + Intronic
1072846253 10:98833976-98833998 AAATACCCTTAAAATTTTAAAGG + Intronic
1073159635 10:101380298-101380320 AAATATTTTGGAAATTATAAAGG + Intronic
1073858090 10:107700915-107700937 AAATATTTTTGGCTTTTTAAAGG + Intergenic
1074142456 10:110685943-110685965 AAATACCTGTGAGGATTTAAAGG - Intronic
1074398611 10:113121828-113121850 AAACATAATGGAAGTTTTAAAGG - Intronic
1076227958 10:128795951-128795973 AAGTATGTTTCAAGGTTTAATGG - Intergenic
1077203204 11:1324396-1324418 AAACATTTATGGAGTTTTAATGG - Intergenic
1077388417 11:2286938-2286960 AAATATGTTTTAAGTGTTAAAGG - Intergenic
1077725754 11:4673243-4673265 AAATATGATTGAAGTTTAAAAGG - Intergenic
1077752204 11:4985076-4985098 ACATATCTTTGATGTTTCTATGG - Intronic
1077829442 11:5848778-5848800 AAATGTGTTTAAATTTTTAAAGG + Intronic
1078607882 11:12793408-12793430 AAATATCTTTGCTATTTTAGAGG + Intronic
1079049058 11:17137363-17137385 AAAAATCTTTCCAGTTTTGAAGG + Intronic
1079547970 11:21657751-21657773 AAATATCTTGGAATTTTTATTGG + Intergenic
1079577729 11:22024412-22024434 AAAAATATTTGAAGAATTAATGG - Intergenic
1079665602 11:23101418-23101440 TAATAACTTTCAAATTTTAATGG + Intergenic
1079801766 11:24878281-24878303 AAATATCTTTCAAATATGAAGGG - Intronic
1080084146 11:28258525-28258547 AAAAATCTTTGAAGTTTGTCTGG + Intronic
1080189953 11:29532810-29532832 ACATATCTTTGAAGGTCTTAAGG - Intergenic
1080354231 11:31423147-31423169 TAAAATTTTTAAAGTTTTAAAGG - Intronic
1080727646 11:34914425-34914447 AAATTTCATTGTAGTTTTAGGGG - Intronic
1082213980 11:49544730-49544752 AATTTTCTTTGAATTTTTATGGG + Intergenic
1083115831 11:60458430-60458452 AAATATTTTTTTATTTTTAAAGG - Intronic
1083239749 11:61378972-61378994 AAAAATCTGTTATGTTTTAAAGG - Intergenic
1085745268 11:79109639-79109661 AAATAGCTATGAAGTGTCAAAGG + Intronic
1085943582 11:81237865-81237887 AAATATATTTGACGTGTTAGTGG - Intergenic
1086114720 11:83236578-83236600 AAAAATCTCTGAAGTTTTAATGG + Intronic
1086635622 11:89079759-89079781 AATTTTCTTTGAATTTTTATGGG - Intergenic
1086726772 11:90195881-90195903 AAAAGTTTTTGAAGTTTTAATGG - Intergenic
1086975530 11:93128394-93128416 AAATTTCTTTAAAGTTTATAAGG - Intergenic
1087323683 11:96695477-96695499 AAATATCTTAGAGATTATAATGG - Intergenic
1087400087 11:97653784-97653806 TTATATTTTTGCAGTTTTAAAGG - Intergenic
1087465650 11:98501439-98501461 AAATATGCTTAAAGATTTAAAGG - Intergenic
1087654442 11:100905442-100905464 AAATATGTTTGAAGTAGTAGTGG - Intronic
1087933888 11:104008692-104008714 TAATTTCTTTAAAGTTTCAAAGG + Intronic
1088042576 11:105405599-105405621 AAAAATCTTTGTCGTTATAATGG + Intergenic
1088216464 11:107515786-107515808 AAATATTTTTGATAGTTTAATGG - Intronic
1088229706 11:107661233-107661255 AAACATCTTGAAAGGTTTAAAGG - Intronic
1088299647 11:108343184-108343206 AAATACCTTTTAATTTTAAAAGG - Intronic
1088684480 11:112273568-112273590 TAGTATCTTTGAGGTTTTAAAGG - Intergenic
1088705288 11:112456739-112456761 AAATATCCTTGTACTTTTAGTGG - Intergenic
1088766538 11:112986000-112986022 GAATATCTTTCAACTTTTTAAGG + Intronic
1088921862 11:114265197-114265219 AAATCACTTTGAAGATTTCAAGG + Intronic
1088966404 11:114726161-114726183 CAATATCTTTGAAGTGCTTAAGG - Intergenic
1089115497 11:116091781-116091803 CCATATCATTGAAGTTTTTAAGG - Intergenic
1090021829 11:123135291-123135313 AAATATCTTTGCAGTGTTTGTGG + Intronic
1091006448 11:131958118-131958140 AAATTTTTATGAAGTATTAATGG + Intronic
1091578662 12:1765092-1765114 AAATATTTTTGATGTTTAAAGGG - Intronic
1091892018 12:4064447-4064469 AAATATGATTAAAGTATTAAGGG - Intergenic
1092554452 12:9541800-9541822 AAATATGTCTGAAGTGTCAATGG - Intergenic
1092700718 12:11227935-11227957 GAATATATTTGAAGTTTTATGGG + Intergenic
1092721147 12:11442056-11442078 AAATATACTAAAAGTTTTAAGGG + Intronic
1092753760 12:11743726-11743748 AAACATCTTTCTAGTTTTGAAGG + Intronic
1093003207 12:14023101-14023123 AAATTTTTTTGAAGAATTAATGG - Intergenic
1093242584 12:16696507-16696529 AGATATCTGTGGAGTATTAAGGG + Intergenic
1093262678 12:16958800-16958822 AAATATTTTTGAACTTTTCATGG - Intergenic
1093269958 12:17048293-17048315 AATTATCTTTGTAATTTTAATGG + Intergenic
1093339768 12:17959128-17959150 AAATATCCTTGAAGTTTAGTAGG - Intergenic
1094172173 12:27505083-27505105 GAATATCTTTGAAGTGGGAATGG + Intergenic
1094433695 12:30398150-30398172 AAATTTATTTCAATTTTTAAGGG + Intergenic
1094517650 12:31148836-31148858 AAATATGTCTGAAGTGTCAATGG + Intergenic
1094629969 12:32164312-32164334 AGGAATCTTTGCAGTTTTAATGG + Intronic
1094633200 12:32198250-32198272 AAATACCCTTAAAGTTTTTACGG + Intronic
1095142111 12:38676607-38676629 AAATATCCTTGAGATTTTGAGGG + Intronic
1095281688 12:40358758-40358780 AAATATCATTGGAGCTTTCATGG + Intronic
1095486060 12:42685959-42685981 TAACATCTTTGAGGTCTTAAAGG - Intergenic
1095671930 12:44871786-44871808 AAAAAACTTTAAGGTTTTAAAGG - Intronic
1096588325 12:52639753-52639775 TTATCTCTTTGTAGTTTTAATGG - Intergenic
1097257364 12:57689528-57689550 AAATATCTTCAAATTTTTTAGGG - Intergenic
1097490429 12:60262035-60262057 AAATATGTTTGAAATGTTTATGG + Intergenic
1097508467 12:60506292-60506314 TAATAGCTATGAAGTTTTGAGGG - Intergenic
1097568474 12:61300300-61300322 ATATATATTTTAATTTTTAATGG + Intergenic
1097728138 12:63098212-63098234 AAGCATTTATGAAGTTTTAATGG + Intergenic
1098296379 12:69008387-69008409 AACTTTCATTGAACTTTTAATGG + Intergenic
1098354910 12:69603360-69603382 AAATATCTTTCCAGTTTCAGAGG + Intergenic
1098543729 12:71687742-71687764 TCAGATCTTTAAAGTTTTAAAGG + Intronic
1098645621 12:72896759-72896781 AAATATTTTTGAAAGATTAAAGG - Intergenic
1098738245 12:74135625-74135647 AAAAATATTTGAAGTAATAATGG - Intergenic
1098862148 12:75722194-75722216 AAATAGATTTAATGTTTTAAAGG + Intergenic
1099120177 12:78679835-78679857 AAATAAATGTGAAATTTTAATGG - Intergenic
1099160141 12:79230814-79230836 TAATATCTTTGAAATGCTAATGG - Intronic
1099278971 12:80618016-80618038 AATTATCTGTGAAGAATTAAGGG - Intronic
1099706682 12:86162794-86162816 AAATAACTTGTTAGTTTTAATGG + Intronic
1099751984 12:86786716-86786738 CTCTATCTTTGAAGTTTTAAAGG + Intronic
1099774938 12:87113635-87113657 AAATACCTTTGAGATTTAAAAGG + Intergenic
1100011056 12:89953725-89953747 AAATATTTTTTAGGCTTTAAAGG - Intergenic
1100047788 12:90405004-90405026 AAATATCATTCATGTTTTTACGG - Intergenic
1100372891 12:93985000-93985022 CAATATCTCTGAAGTTGGAATGG - Intergenic
1101014598 12:100486865-100486887 AAATATATCTGATTTTTTAAAGG - Intronic
1101321746 12:103678848-103678870 AAATATCCAAGAAGTTTTTAGGG + Intronic
1101610806 12:106289869-106289891 TAATTTTTTTGTAGTTTTAATGG + Intronic
1101617456 12:106352129-106352151 AAATCTCTTTCAAGCTTCAAGGG + Intergenic
1101664140 12:106794388-106794410 AAATATATTTGAAGAAATAATGG + Intronic
1103588752 12:121975464-121975486 AAATGTCCTTGAAGTGTTCATGG + Intronic
1104530371 12:129564685-129564707 AAATATCTGTGAAGTCCTGAGGG + Intronic
1104710596 12:130982962-130982984 AAACATCTTTGATGTATTTAAGG + Intronic
1104866525 12:131959164-131959186 AAATCTCATTCAAGTTTTCAAGG - Intronic
1105374769 13:19833671-19833693 AAATATCTTTGTAATTTTGGTGG + Intronic
1105543152 13:21332213-21332235 GAATATGTTTGATGCTTTAATGG + Intergenic
1105655302 13:22430127-22430149 TAATATCTTTGCCTTTTTAATGG + Intergenic
1106003653 13:25748967-25748989 ACATTTCTATGAAGTTTGAAAGG + Intronic
1106008692 13:25796698-25796720 TAAAATCTTTGCAGTTTAAAAGG - Intronic
1106446260 13:29834553-29834575 AAATAAATTTGAAATTTGAATGG - Intronic
1106588964 13:31081997-31082019 AAATAATTTTGAACTTTTAAAGG - Intergenic
1106649853 13:31678518-31678540 AAATATCTGTGAAATTTTAGTGG - Intergenic
1107000563 13:35539589-35539611 AAAAATGTTTGAAGCTATAATGG + Intronic
1107095270 13:36528710-36528732 AAATTTCTGTCAAGTTTAAAAGG - Intergenic
1107702555 13:43062609-43062631 AAATCTCTTTGAAATTTTGGAGG + Intronic
1107904309 13:45048042-45048064 ATATATATTTGAAATTTAAAAGG - Intergenic
1108013532 13:46048600-46048622 AAAAAACTTTGAAGATTTCAAGG + Intronic
1108035071 13:46282251-46282273 AAAAATGTTTTAACTTTTAATGG + Intergenic
1108102780 13:46975095-46975117 AAATATTTTTGAAGAGATAATGG + Intergenic
1108239900 13:48453137-48453159 AAATCTATTTGCAGTTTGAATGG - Intronic
1108331875 13:49395003-49395025 AAATAATTTTGAAATGTTAACGG + Intronic
1108874606 13:55029823-55029845 AAATATCTTTCATGCTTCAAAGG + Intergenic
1109024570 13:57141934-57141956 AAATGTCTTCGAAATTTCAAGGG - Intronic
1109025557 13:57148504-57148526 AAATGTCTTCGAAATTTCAAGGG - Intronic
1109026547 13:57155077-57155099 AAATGTCTTCGAAATTTCAAGGG - Intronic
1109027539 13:57161648-57161670 AAATGTCTTCGAAATTTCAAGGG - Intronic
1109028525 13:57168213-57168235 AAATGTCTTCGAAATTTCAAGGG - Intronic
1109175215 13:59146984-59147006 AAATATTTTTAAAATTTAAAAGG + Intergenic
1109288522 13:60442441-60442463 AATTATTTTTAAAGTTTTACAGG + Intronic
1109456338 13:62596491-62596513 AAAAAAGTTTGAAGTTTGAATGG + Intergenic
1109497681 13:63195642-63195664 ACATATCTTTTAAGTCTTTATGG - Intergenic
1109521242 13:63512683-63512705 AAAGATTTTTGAACTGTTAAAGG + Intergenic
1109933310 13:69245306-69245328 AAATGTACTTGAAGTTTCAATGG - Intergenic
1109983033 13:69936067-69936089 AAATATCTTTAAACTTTTCATGG - Intronic
1110034261 13:70659728-70659750 AAATATTTCTGATATTTTAAGGG + Intergenic
1110183988 13:72651577-72651599 AAATATGCTTGAAGTTTTTTTGG - Intergenic
1110406920 13:75160945-75160967 AAATATATTCCAAGGTTTAAAGG - Intergenic
1111032877 13:82630073-82630095 AAATATTATTGATGTTTAAATGG - Intergenic
1111343286 13:86915529-86915551 AAAACTCTTTCAACTTTTAAAGG - Intergenic
1111343742 13:86922764-86922786 AAATATATTTGAAGATACAATGG - Intergenic
1111502144 13:89135697-89135719 AAATATTTTAGAAGCTTTGATGG - Intergenic
1111740817 13:92204054-92204076 AAATATCTTTCCAGTATGAAAGG + Intronic
1111909938 13:94299990-94300012 AATTAGATTTGATGTTTTAAGGG - Intronic
1112563896 13:100536069-100536091 AAATGTCTTTAAAGTTCTGAGGG - Intronic
1112856056 13:103770710-103770732 AACTATTTTTAAAGTTTTGAGGG - Intergenic
1113030143 13:105984117-105984139 GAAAATATTTGAAGCTTTAAGGG - Intergenic
1113124668 13:106963611-106963633 AAATATCTTTGTATGTTTAAGGG + Intergenic
1113371109 13:109726266-109726288 TCATATTTTTGAAGTTTTTATGG + Intergenic
1113390991 13:109896926-109896948 AATTATCCTTGAAGGTTAAAAGG + Intergenic
1114206393 14:20575652-20575674 AAATTTTTTTGAAGATATAATGG + Intergenic
1114862655 14:26544363-26544385 AAGTATGTTGGAAGTCTTAATGG - Intronic
1115290429 14:31766104-31766126 AAATAGAATTTAAGTTTTAAAGG + Intronic
1115538687 14:34398366-34398388 CAATTTTTTTGAATTTTTAAAGG - Intronic
1115575917 14:34711549-34711571 AAGTATCATTAAACTTTTAAAGG + Exonic
1116132935 14:40882394-40882416 AAATGTCTTTGTAATTTCAAAGG - Intergenic
1116148733 14:41109715-41109737 AAATATACCTCAAGTTTTAATGG - Intergenic
1116275377 14:42825520-42825542 AAATAACTTTCAATTTTTCATGG + Intergenic
1116521287 14:45850406-45850428 AAATTTCTTTGGAGTTCAAATGG - Intergenic
1116530276 14:45963666-45963688 AATTACCTTTGAAATTTTCATGG - Intergenic
1116756575 14:48956192-48956214 AAATATCTGTTAAGTTTTTTTGG - Intergenic
1116976673 14:51124417-51124439 AAATATCTCTTCAGTTATAAGGG + Intergenic
1117060740 14:51960049-51960071 AAAAATATTTGAAGATATAATGG - Intronic
1117403322 14:55377647-55377669 AATTATATTTGAACTTTTATGGG - Intronic
1118567891 14:67162321-67162343 AAGTAGTTTTGAAGTTTAAATGG + Intronic
1119135899 14:72219421-72219443 AAATATTTGTGAAATTTTAGGGG + Intronic
1120108983 14:80530541-80530563 AATTATCATTAAAGTTTTAGGGG + Intronic
1120338700 14:83191106-83191128 AAATATATTTGAAGAAATAAAGG - Intergenic
1120422096 14:84301013-84301035 AAATATTATTGAAGTTTTATAGG + Intergenic
1120452912 14:84693303-84693325 AAAGATATTTGCAATTTTAAAGG + Intergenic
1120589107 14:86354257-86354279 AAATAACATTGAAATTTTTAGGG + Intergenic
1120918694 14:89734255-89734277 AAATTTATTTGAAGTAATAATGG - Intergenic
1121421102 14:93815112-93815134 AAATATATTTGAAGAAATAATGG + Intergenic
1121974214 14:98387592-98387614 AAATATGTCTGAAGTAATAAAGG - Intergenic
1122297878 14:100715390-100715412 AAATCACTTTGAAAGTTTAAAGG + Intergenic
1122454605 14:101840535-101840557 AAATATCCTTAAAGTTTGATAGG - Intronic
1124080383 15:26489004-26489026 AAGTATATCTGAAGGTTTAAAGG + Intergenic
1124267094 15:28246243-28246265 AAATATTTTTGTAATTTAAAGGG - Intronic
1125267092 15:37894966-37894988 CAATATCTTTAAAATTTTAAAGG - Intergenic
1125292196 15:38162280-38162302 AAATATCTTCAAAGTCCTAAGGG - Intergenic
1125378464 15:39060052-39060074 AAATAGCTTTGGAGCTATAACGG + Intergenic
1125804544 15:42481903-42481925 AAATATATTTAAAAATTTAATGG - Intronic
1125851304 15:42905560-42905582 AAATATCTTTTAAATTGTATAGG + Intronic
1126198628 15:45959284-45959306 ACATCTCATAGAAGTTTTAAAGG - Intergenic
1126374930 15:47988199-47988221 AACTATCTTTGAGGCTTTTAAGG - Intergenic
1126552445 15:49947576-49947598 AAATACCATTGAAATTTTGATGG - Intronic
1126752166 15:51887262-51887284 TAATCTCTTTAAAGTTTTATAGG + Intronic
1127001831 15:54517760-54517782 AAAGAACTTAGAAGTTTTTAGGG + Intronic
1128540323 15:68523901-68523923 AAATATCTTTGAAGAATTGTAGG - Intergenic
1128681282 15:69653728-69653750 ATATATGTTTGAAATTGTAAGGG + Intergenic
1129571786 15:76694128-76694150 AAATGTCATTGAAATTTTGATGG + Intronic
1129572469 15:76703077-76703099 TATTATTTTTGAAGTTTTAATGG - Intronic
1129806594 15:78465952-78465974 AAATTTCTTTTAAGTTGTTAGGG + Intronic
1131429228 15:92373095-92373117 AAATATTTTGGATTTTTTAAGGG - Intergenic
1131572191 15:93550299-93550321 AAATATATTTGAAGTTTCAAGGG - Intergenic
1132216540 15:100066649-100066671 AAATGTATTTCAAGTGTTAAAGG - Intronic
1132266416 15:100475657-100475679 AAATATATTTGATGAATTAATGG + Intronic
1132357964 15:101187024-101187046 AACTATATTTGAAGCATTAAAGG + Intronic
1132388537 15:101420662-101420684 AAATCTGTTTAAAGTTTTTATGG - Intronic
1133674205 16:8054876-8054898 AAATATGTTTGTTTTTTTAATGG - Intergenic
1134904210 16:17965620-17965642 CAATATGTATGAAGTTTTATTGG + Intergenic
1136734183 16:32448356-32448378 AAATATCATTGGAATTTTGATGG + Intergenic
1138368570 16:56504650-56504672 AAATGCTTTTGAAATTTTAAGGG - Intronic
1139451669 16:67032369-67032391 AAATTTCTGAGAAGTATTAAAGG + Intronic
1140129039 16:72142532-72142554 CAGTATCTTTGAAGACTTAAGGG + Intronic
1140602635 16:76496902-76496924 AAAAATATTTGAAGACTTAAAGG + Intronic
1140801618 16:78493542-78493564 AAATATCTTTGGGGTGTTTAAGG + Intronic
1141349708 16:83283135-83283157 AAAAATCTGTGAAGATCTAAGGG - Intronic
1203018894 16_KI270728v1_random:381243-381265 AAATATCATTGGAATTTTGATGG - Intergenic
1203037229 16_KI270728v1_random:654401-654423 AAATATCATTGGAATTTTGATGG - Intergenic
1143688715 17:8541686-8541708 AAACATCTTTGTACTTTAAAAGG + Intronic
1143998305 17:11028365-11028387 AAATAATTTTAATGTTTTAAAGG - Intergenic
1144154345 17:12484389-12484411 AAATATCTTTGAGGACTTCAGGG - Intergenic
1144165908 17:12610176-12610198 AAATATATTTTCAGTTTTGAGGG + Intergenic
1145170701 17:20654015-20654037 AAATATTTTTGAAGTGTAACAGG - Intergenic
1145356529 17:22160418-22160440 AAATATGTTTAAAGATTGAATGG + Intergenic
1146188395 17:30742709-30742731 AAATATATTTGAAGTTCATAAGG - Intergenic
1146333268 17:31947025-31947047 AAATATATTTGAAGTTCACAAGG - Intronic
1146393923 17:32446844-32446866 AAATATGTTTGAGTTTGTAATGG + Intronic
1146825098 17:36015035-36015057 AAATAACTATGCAGTTTTCACGG + Intronic
1146997276 17:37332304-37332326 AAATATTTTTAAATTTTTATGGG - Intronic
1147281684 17:39367226-39367248 AAATATTTTGGAAGTTTTTCTGG + Intronic
1147814931 17:43202500-43202522 AAGTATTTGGGAAGTTTTAAGGG - Intronic
1148068579 17:44892327-44892349 AAATATATTTTAAGTTGAAAAGG + Intronic
1148484154 17:47979853-47979875 AGATATCTGTGAAGTTTTAACGG + Intronic
1148536552 17:48444047-48444069 AAATACCGTTGAAGTTTTTAGGG - Intergenic
1148938433 17:51184733-51184755 AAATATATTTGAGCTTTTATTGG - Intronic
1149742709 17:59062858-59062880 CAATATCTTTTAAGTTTCAGGGG + Intronic
1149965340 17:61157234-61157256 ATATATCTTTGGAGTCTCAAGGG - Intronic
1150150660 17:62806662-62806684 ACATATCTGTGAAATTTTAATGG + Intronic
1150303667 17:64066470-64066492 TAATAACTCTGAAGTGTTAATGG + Intronic
1150665522 17:67132837-67132859 AAATATCAATCAAGTTTTTAAGG - Intronic
1151223886 17:72634282-72634304 AAATATCCTTGAGGTTTTTGGGG - Intergenic
1151291067 17:73150362-73150384 AAATATCTTTAAAATTCTGAGGG + Intergenic
1152913341 17:83018377-83018399 ATATATTTTTGAAGTTTTTAGGG - Intronic
1152974567 18:201874-201896 AAATATCTTAAAAGTTATAAAGG - Intronic
1152993302 18:382958-382980 AAAAATCATTGCATTTTTAAAGG - Intronic
1153137722 18:1935657-1935679 AAATATGTGTAATGTTTTAAAGG + Intergenic
1153360291 18:4187370-4187392 CAATATCTTGGAACGTTTAAAGG - Intronic
1153796187 18:8624291-8624313 AAATATATCTGAAGCTTTACAGG + Intronic
1153898971 18:9598246-9598268 AAATATATTTGAAGAAATAATGG + Intronic
1155099265 18:22593165-22593187 AAATGTCTTAGAAACTTTAAAGG - Intergenic
1155340392 18:24808144-24808166 AAAAATCCTTGAAGTAATAATGG + Intergenic
1155418755 18:25630669-25630691 AAATGTCTTAGAATTTTGAAGGG - Intergenic
1155782446 18:29853627-29853649 CAATCTCTTTGAATTTTTATAGG - Intergenic
1157058879 18:44262908-44262930 AAATATTAATGAATTTTTAAAGG - Intergenic
1157115810 18:44861850-44861872 AATTATATGTCAAGTTTTAAAGG + Intronic
1157265992 18:46222485-46222507 AAAAAGCTTTGAAGTCTTACTGG + Intronic
1158236099 18:55315996-55316018 AGTTATGTTTGAAGTATTAAGGG + Intronic
1158356230 18:56622426-56622448 AAATTTCTTGGGAGTTATAATGG + Intronic
1159367505 18:67487938-67487960 AAATATATTTGAAGAATTAATGG + Intergenic
1159425315 18:68277086-68277108 AAATTTCTTTTCAGTTTTATAGG + Intergenic
1159760928 18:72425487-72425509 AATTATCTTTGAAGAGTGAATGG - Intergenic
1159786884 18:72725424-72725446 AAGTATCTTTGACGTTTTTCAGG - Intergenic
1159839388 18:73379995-73380017 AAATATGTTTCAAGATTTAAAGG - Intergenic
1162664718 19:12200678-12200700 AAAGAACTTTGAAATTTAAAAGG + Intergenic
1163204444 19:15792310-15792332 AAATATATAGGTAGTTTTAAGGG + Intergenic
1163461881 19:17443490-17443512 TAATTTTTTTGAATTTTTAATGG + Intronic
1164659820 19:29954220-29954242 AAATGTCTTTGCAGTTTCATTGG + Intronic
1165308502 19:35016734-35016756 AAATATTTTTGTATTTTTAGTGG - Intronic
1165835109 19:38750248-38750270 AAAAATTTTTGAAGCATTAATGG + Intronic
1166578630 19:43870328-43870350 AAAAATATTTGAAGATATAATGG + Intergenic
1167484626 19:49754679-49754701 AAATATGTTCGAAGTGCTAAAGG + Intronic
1167734672 19:51286313-51286335 AAATATCTTTCAACTATGAAGGG - Intergenic
1167975246 19:53221361-53221383 AAATATCTTTGAATTCTCAGAGG - Intergenic
1202685399 1_KI270712v1_random:44902-44924 AAATAGTTTTTAATTTTTAAAGG - Intergenic
925426728 2:3754909-3754931 AAATATATTTGGACTTTTACGGG + Intronic
925559669 2:5177155-5177177 AAATGTTCTTCAAGTTTTAAAGG - Intergenic
925697906 2:6601860-6601882 AAATATATTTGAAGAAATAATGG - Intergenic
926184212 2:10675810-10675832 AATTATCCTTGAAGTTTGAAAGG - Exonic
926495156 2:13577345-13577367 AAATATATTTGAAAATTAAAAGG + Intergenic
926663656 2:15495928-15495950 AAATATCATTGAATTTTTCTTGG - Intronic
927021484 2:19021568-19021590 TAAACTCTTTGGAGTTTTAATGG + Intergenic
927320535 2:21739791-21739813 AAACATTTTGCAAGTTTTAAAGG - Intergenic
927389439 2:22578122-22578144 AAATATCTATAATGTTTGAATGG - Intergenic
927626427 2:24725214-24725236 AAACAGCCTTGGAGTTTTAAGGG - Intronic
927728371 2:25446804-25446826 AAAAATGTTTGAAGAATTAATGG - Intronic
928303833 2:30148886-30148908 AAATATCATTCTAGGTTTAATGG + Intronic
928823789 2:35394092-35394114 AAATATCCTTGAGGATTTACAGG - Intergenic
928960843 2:36924481-36924503 AAATAGTTTTTAATTTTTAAAGG - Intronic
929290983 2:40190963-40190985 AAATCTATTTGCACTTTTAAAGG + Intronic
929302656 2:40323777-40323799 AAATATTTTTAAATGTTTAAGGG + Intronic
929347264 2:40899971-40899993 AAATATCTTTATAGTTTCAAAGG + Intergenic
929356821 2:41035454-41035476 AAAGATCTGTGCAGTCTTAAAGG - Intergenic
930399213 2:50861797-50861819 AAATAGATTTTAAGTTTAAATGG + Intronic
930458611 2:51639729-51639751 ACATATATTTGAAAATTTAATGG + Intergenic
930629803 2:53740138-53740160 AATTATATATGAATTTTTAATGG + Intronic
930712590 2:54563014-54563036 ACATACCTGTGAAGTTTTAGAGG + Intronic
931215846 2:60243803-60243825 AAATACCTCTGAAGATTTTAGGG - Intergenic
931323961 2:61199225-61199247 AAAAATCATTGAAATATTAAAGG - Intronic
931662515 2:64579808-64579830 AAATATCTAGGTAGTTTAAAAGG + Intronic
931789946 2:65656035-65656057 AAACATCTGTTAAGATTTAATGG + Intergenic
933425588 2:82108187-82108209 GATTATCTTTGATGTTTTCATGG + Intergenic
933544187 2:83689104-83689126 AATTATGTTAGAAATTTTAACGG + Intergenic
933873349 2:86592518-86592540 AGAAATCTTTGAAATTGTAAAGG + Intronic
934138526 2:89020863-89020885 AAATATATTTTATGTTTTTAAGG + Intergenic
934144611 2:89078964-89078986 AAATATATTTTATGTTTTTAAGG + Intergenic
934224641 2:90121585-90121607 AAATATATTTTATGTTTTTAAGG - Intergenic
934230717 2:90179689-90179711 AAATATATTTTATGTTTTTAAGG - Intergenic
934246326 2:90309929-90309951 AAATAGTTTTTAATTTTTAAAGG + Intergenic
935140309 2:100347379-100347401 AAATATATTTGAAGAAATAATGG - Intergenic
935489888 2:103705758-103705780 ATATATCTTTCCAGTTTTTAAGG - Intergenic
936633197 2:114226943-114226965 TAATACATTTGAAGTCTTAAAGG - Intergenic
936656586 2:114495306-114495328 AAATGTGGTTGAACTTTTAAAGG - Intronic
936660120 2:114533756-114533778 AAATGCCTTTGAAATTTTGAAGG - Intronic
937466694 2:122139220-122139242 AAGTATACTTGAAATTTTAAAGG + Intergenic
937562210 2:123240147-123240169 ATATAGCTTTGAAGCTTTGAAGG + Intergenic
937580311 2:123478052-123478074 AAAGATATTTGAAGAATTAAAGG - Intergenic
937683982 2:124675768-124675790 AAATATCTCTAAAGAATTAAAGG - Intronic
938155552 2:128936849-128936871 AAATATGTCTGAAGTCATAATGG - Intergenic
938605906 2:132892401-132892423 GAATATGTTTTAAGGTTTAAAGG - Intronic
938907815 2:135855189-135855211 AAAAATCTTGAATGTTTTAAAGG + Intronic
939206397 2:139109497-139109519 AAAAAGCTTTGAAATTTGAAAGG - Intergenic
939248877 2:139661214-139661236 AGGAATCTTTGAAGTTATAATGG + Intergenic
939532274 2:143378994-143379016 ATTTATTTTTTAAGTTTTAAAGG + Intronic
939609520 2:144292975-144292997 AAATATCTTCAAAATTTTATTGG - Intronic
939658475 2:144857006-144857028 AAAATTATTTGAAGTTTTATTGG - Intergenic
939859346 2:147398744-147398766 ACAAATCCTTGAAGTTTTGATGG - Intergenic
940405308 2:153294357-153294379 AAATTTCTTTTCAGTTATAATGG + Intergenic
940706507 2:157111220-157111242 CCATATATTTGTAGTTTTAAGGG - Intergenic
940748602 2:157598123-157598145 AATTATTTTTGAAATTTTACTGG - Intronic
940812081 2:158256097-158256119 CATTACCTTTGAAGTTTTCATGG - Intronic
941309459 2:163911254-163911276 AGCTATCTTTGGAGTTATAAAGG - Intergenic
941453838 2:165692513-165692535 AAATGTCTTTGCAGTCTTAAAGG - Intergenic
941551608 2:166923189-166923211 AAATAGCTTTCATGTTTGAACGG + Intronic
942751611 2:179294050-179294072 AAATATCTTTCAATTTTTTTAGG + Intergenic
943008260 2:182413353-182413375 AAATATCATTAAATTTTAAATGG + Intronic
943074904 2:183182155-183182177 ACATGTCTTTGAAATTTTGAAGG + Intergenic
943104881 2:183532215-183532237 AAATATCTTTTAATTTTTGAAGG - Intergenic
943149370 2:184092290-184092312 AAAAATCTCTAAAGGTTTAAAGG + Intergenic
943432934 2:187826684-187826706 AAATATTTTTAAGGTTTAAAAGG - Intergenic
943455269 2:188099440-188099462 AAATAATTTTTAAATTTTAAAGG - Intergenic
943497512 2:188641088-188641110 AAATATCTTTGAGGAATTAAGGG + Intergenic
943537826 2:189174632-189174654 AAATATCTAGGAAGTTTGGATGG - Intronic
943556510 2:189412361-189412383 AAAGATCTTTGGATTTTTAGTGG - Intergenic
943711212 2:191097263-191097285 AAACTACTTTGAAGTTTTTATGG + Intronic
943822615 2:192345932-192345954 TAATTTCTTTGAAGTTTTTTTGG - Intergenic
943892587 2:193309554-193309576 AAATATCACTGAAATGTTAAAGG + Intergenic
943907940 2:193524529-193524551 AAAAATCTTTGAAGCAGTAAGGG - Intergenic
944123853 2:196271230-196271252 CAATATCTTTGAAATTCTACAGG - Exonic
944244087 2:197514358-197514380 AAAATTATTTGAAGTTTTATAGG + Intronic
944334024 2:198508053-198508075 AAATATTTGGGAATTTTTAAAGG - Intronic
944404556 2:199368426-199368448 AAATATCTTCTTAGTTTTAAGGG + Intronic
944756522 2:202767718-202767740 AAATTGCTTAGATGTTTTAAAGG - Exonic
945617570 2:212091844-212091866 ACATATCTTTAAAGTTTATAAGG + Intronic
945716347 2:213362260-213362282 AAATATCTTTGATTCCTTAATGG + Intronic
945895662 2:215478800-215478822 AAATGTCTGTGAACTTTTGAAGG + Intergenic
945940808 2:215947916-215947938 AAATTTCTATGACATTTTAAAGG - Intronic
946028959 2:216690422-216690444 AAATATCTTAAAAGTTTCATAGG + Intronic
946892331 2:224290611-224290633 TAATCTCTTTGATGTTTTTAAGG + Intergenic
946940546 2:224765620-224765642 TAATTTATTTGAAGTTTTCATGG - Exonic
947133462 2:226953780-226953802 AAACTTATTTTAAGTTTTAATGG + Intronic
947416299 2:229900069-229900091 AAATAACTTCAAAGTTTTTAAGG + Intronic
947766733 2:232642678-232642700 AAAGATCTTTACAGTTTTAAAGG - Intronic
948552243 2:238781191-238781213 AAATATATTTGAAGCAGTAATGG - Intergenic
1169631187 20:7634116-7634138 AAATAAATTTGTAGTTTAAAAGG - Intergenic
1169661090 20:7979357-7979379 ACAGATATTTAAAGTTTTAATGG + Exonic
1169788042 20:9381576-9381598 AAATTCCTTCTAAGTTTTAAAGG + Intronic
1169855613 20:10099315-10099337 AAATATCATTGATGTTTTCAAGG - Intergenic
1169953055 20:11068765-11068787 AAATATTCTTGAAATTTGAATGG - Intergenic
1170185265 20:13582448-13582470 AAATCATTTTGAAGTTTTGATGG - Intronic
1170249718 20:14267025-14267047 AAATATCTATTAATTTTTAAGGG + Intronic
1170838877 20:19907751-19907773 ACATATCTTTGATGCATTAAAGG - Intronic
1171049539 20:21842496-21842518 GAAGATATTTGAAGTTTGAAAGG - Intergenic
1171288594 20:23966242-23966264 AACTACCTTTGAAGTTTAACTGG - Intergenic
1172459409 20:35105243-35105265 AAGCATCTTTTAAGTTTTGATGG + Intergenic
1172580376 20:36042670-36042692 AAATAAGATTGAAGTTTCAAGGG + Intergenic
1173711796 20:45163988-45164010 AAAAATATTTGAAGTAATAATGG + Intergenic
1174688913 20:52483225-52483247 AAATGTCTTTGAAAATTTTATGG + Intergenic
1174719189 20:52793002-52793024 AAATATGTTTGAAGATATTAGGG + Intergenic
1175330902 20:58163127-58163149 AAACATCTTTGGAGTTTGAGGGG - Intergenic
1176950420 21:15038984-15039006 AAATTTCATTGTATTTTTAAAGG + Intronic
1177371197 21:20206010-20206032 AAACATATTTGAAGTAATAATGG + Intergenic
1177413460 21:20762275-20762297 AAATATAGTTGATGTTCTAAAGG + Intergenic
1177448501 21:21232405-21232427 AAATATTTTTTAGGTTTTAGAGG + Intronic
1177528283 21:22327195-22327217 AATTATTTCTGAAGTTTAAATGG + Intergenic
1177992111 21:28049359-28049381 AAATATGTTTTAATTTCTAATGG - Intergenic
1178162246 21:29931895-29931917 ATATTTTTTTGAATTTTTAAAGG + Intronic
1178182612 21:30180564-30180586 AACTATCTATGTAGTTCTAATGG + Intergenic
1180758103 22:18177395-18177417 AAAGGACTTTGCAGTTTTAACGG + Exonic
1180768392 22:18361187-18361209 AAAGGACTTTGCAGTTTTAACGG + Intergenic
1180777918 22:18501204-18501226 AAAGGACTTTGCAGTTTTAACGG - Intergenic
1180810642 22:18758515-18758537 AAAGGACTTTGCAGTTTTAACGG - Intergenic
1180826269 22:18864411-18864433 AAAGGACTTTGCAGTTTTAACGG + Intergenic
1181196790 22:21192770-21192792 AAAGGACTTTGCAGTTTTAACGG - Intergenic
1181212738 22:21300354-21300376 AAAGGACTTTGCAGTTTTAACGG + Intergenic
1181675988 22:24452796-24452818 AAATCTATTGGAAATTTTAAAGG - Intergenic
1182140079 22:27946854-27946876 AAACATCTTTAAAGTTCTATGGG - Intergenic
1182819498 22:33203013-33203035 ACATATCTCTGAAGTTTGACAGG + Intronic
1182914294 22:34014516-34014538 AAAAATATTTGAAGTAATAATGG - Intergenic
1184836230 22:47022899-47022921 AAATATCTTTGAATTTTTGCTGG - Intronic
1203230010 22_KI270731v1_random:102075-102097 AAAGGACTTTGCAGTTTTAACGG + Intergenic
1203276410 22_KI270734v1_random:90317-90339 AAAGGACTTTGCAGTTTTAACGG + Intergenic
949211572 3:1509314-1509336 AAATATCTGTGAAGGTCTATAGG + Intergenic
949521859 3:4863711-4863733 TAATATCTTTGATGTTTCACAGG + Intronic
949732575 3:7130898-7130920 AAATACCTTGGAAATTTTACAGG + Intronic
951189439 3:19751086-19751108 AAATTTCTTTGATGGGTTAATGG + Intergenic
951407764 3:22322304-22322326 AAATATATTTGAGGATATAAAGG - Intronic
951495646 3:23322309-23322331 AAAGTTTTTTAAAGTTTTAAAGG - Intronic
951680472 3:25289664-25289686 AATTATCTTTTGAGTTGTAAAGG - Intronic
951924975 3:27899351-27899373 AAATGTCTTTGGAATTTCAAAGG - Intergenic
951943791 3:28111744-28111766 TAATAACTTTAAAGATTTAAGGG - Intergenic
952244114 3:31566647-31566669 AAACATCTGTGAAGTCTTTAAGG - Intronic
952480593 3:33757194-33757216 AACTATACTTGAATTTTTAATGG - Intergenic
952696950 3:36276837-36276859 AAATATGTTTGACATTTTAGAGG - Intergenic
953196642 3:40740493-40740515 AATAATATTTGAAATTTTAATGG + Intergenic
953349615 3:42205540-42205562 AGATATCTTTCTAGTTTGAATGG - Intronic
953939114 3:47075148-47075170 AAAAATCTCTGCAGTATTAAAGG + Intronic
954720316 3:52556139-52556161 AAATATGTTTGAAATCTTCAGGG - Intronic
954962044 3:54575206-54575228 AAATATTTTTACAGTTTTACTGG - Intronic
955421732 3:58744971-58744993 TTATATCTTTGAAGTATGAAAGG + Intronic
955552546 3:60099720-60099742 AAATTTTTTTGACTTTTTAATGG + Intronic
955583957 3:60456184-60456206 AAATATTTGTGAATATTTAAAGG - Intronic
956238109 3:67097937-67097959 AAAAATATTTGAAGTGATAATGG + Intergenic
956340489 3:68217938-68217960 AAATACCTTTAAAGGTTTAGAGG + Intronic
956551381 3:70463101-70463123 AAGTATTTGTGAAGTGTTAATGG - Intergenic
956616733 3:71179874-71179896 AAATAATTTTGAATTTTCAACGG - Intronic
956861862 3:73332511-73332533 AAATATTACTGAAGTTTTTAAGG + Intergenic
957015390 3:75057520-75057542 ATAAATTTTTGCAGTTTTAAGGG + Intergenic
957216560 3:77327747-77327769 AAAAAACATTGAAGATTTAATGG + Intronic
957533357 3:81468819-81468841 TTATATCTTTGGAGATTTAAAGG + Intergenic
957560484 3:81814706-81814728 AAATATCATAGAAGTTTTTAGGG - Intergenic
957586436 3:82138523-82138545 AAATTTGTTTGTATTTTTAAAGG - Intergenic
957665588 3:83220888-83220910 AAATATAATTTAAGTATTAAAGG - Intergenic
957732867 3:84163770-84163792 AATTATCATTGAAGTTTTGGTGG + Intergenic
957839140 3:85643772-85643794 ATATATATTTTAAGTTTTTAAGG + Intronic
957891030 3:86358070-86358092 AAATCTCTTTGAAATATAAAGGG - Intergenic
958121591 3:89296707-89296729 ACCTAGCTTTGAAGTTTCAAAGG - Intronic
958569361 3:95860310-95860332 CAATATCTTTGATGGTTTGATGG + Intergenic
958574658 3:95932895-95932917 AAATAGCTTAGAAGTTATATAGG - Intergenic
958653512 3:96971048-96971070 TATTATCTTTGAAGATTTATAGG - Intronic
958654959 3:96989200-96989222 TAATATATGTGAAGTTTTAAAGG + Intronic
958697071 3:97541449-97541471 AAAAGTCTTTTAAGTTTTAATGG - Intronic
958817237 3:98929136-98929158 TACTATCTTTGCTGTTTTAAAGG + Intergenic
958840166 3:99193651-99193673 AAATATCCTTGAAATGTAAAGGG + Intergenic
959136127 3:102423590-102423612 AAATTTATTTTAATTTTTAATGG - Intronic
959387785 3:105733411-105733433 AAATTGATTTGAAGTTTTATAGG - Intronic
959855169 3:111145374-111145396 AAATATCTTTGAAGTTTTAATGG + Intronic
960042979 3:113168993-113169015 AATTATTTTTGATGATTTAAGGG - Intergenic
960316608 3:116186227-116186249 AAGTCTTTTTGATGTTTTAAAGG + Intronic
960334790 3:116403458-116403480 AGATATTTGTGAACTTTTAAAGG + Intronic
960661484 3:120064664-120064686 AAATATATATGAAATTGTAAGGG + Intronic
960833376 3:121876240-121876262 AAATATTTTTCAAGTGTTGAAGG + Intronic
960903864 3:122578066-122578088 AAAGAACTTTTAAATTTTAAGGG - Intronic
961241400 3:125415068-125415090 CAATTTTTTAGAAGTTTTAAGGG - Intergenic
961396453 3:126595412-126595434 AAATATATTTGAAGAACTAATGG + Intronic
962030339 3:131593199-131593221 AAATGCCTTTGAGATTTTAATGG + Intronic
962229532 3:133649921-133649943 ATATATCTTTGCGGTTTTAGTGG - Exonic
962973541 3:140426616-140426638 AGCTATCTTTGAAGTCTTTAAGG + Intronic
963065375 3:141259720-141259742 AAAAAACCTTGAAGATTTAAAGG + Intronic
963324312 3:143844585-143844607 AAATATATTTTAAGATTTAGTGG - Intronic
963545653 3:146654746-146654768 ATATATCTTTGATTTTATAAAGG - Intergenic
963709576 3:148731653-148731675 AAATATCTTGTAATATTTAAAGG + Intronic
963861895 3:150320249-150320271 AAATATCTTTGGAGTTAAATTGG + Intergenic
963969305 3:151411961-151411983 AAATATCTTTGAGGTGGAAAAGG - Intronic
964246637 3:154661418-154661440 AAAAACCTTCGAAGTTTTATCGG - Intergenic
964554355 3:157919265-157919287 ACATATTTTTTCAGTTTTAAAGG - Intergenic
964669213 3:159206903-159206925 AAGTAAATTTGAAGTTTGAAAGG + Intronic
964764468 3:160166231-160166253 AAAAATATTTGAAGATATAATGG + Intergenic
965218775 3:165899651-165899673 AAATATATTTAACATTTTAATGG - Intergenic
965238505 3:166160548-166160570 ATATATGTTTAAAGTTTTAAGGG + Intergenic
965330392 3:167366507-167366529 AAATATTTTTGAAGTTATCAAGG + Intronic
965790309 3:172380377-172380399 AAATATAATTTAATTTTTAAAGG + Intronic
965829082 3:172762766-172762788 AAGTTTCTTTGAAGGTTCAAAGG - Exonic
965878334 3:173355910-173355932 AAAAAACTTTGAAGATATAAAGG - Intergenic
965896785 3:173586903-173586925 AAATATTTTCAAAGTTTAAACGG + Intronic
965929011 3:174018902-174018924 AAATATATTTGCATTTTTATTGG - Intronic
966053927 3:175658507-175658529 AAAAATCTTTGATAGTTTAATGG + Intronic
966102452 3:176288029-176288051 AAATATCTTCATACTTTTAAAGG - Intergenic
966249993 3:177854512-177854534 AAATTTCTTTAAAGATTTACGGG - Intergenic
966433407 3:179856615-179856637 AAATATGTGTGAAGTTTTGGAGG + Intronic
967668070 3:192198309-192198331 AAAAATCTTGTCAGTTTTAAAGG - Intronic
967817096 3:193808799-193808821 AAATATCTCCTGAGTTTTAAAGG - Intergenic
968177871 3:196567153-196567175 TAATTTCTTTGAAGTCTTCAAGG - Exonic
968353865 3:198085085-198085107 AAATGTCTTTGGGGTTTTGATGG - Intergenic
968743711 4:2345883-2345905 CAACATCTTTAAAGTATTAAGGG + Intronic
968860944 4:3169321-3169343 AAAAATCTTTGAAGAAATAATGG - Intronic
969127875 4:4967215-4967237 AAATATCTTTCAATTTTTAAAGG + Intergenic
970209552 4:13694750-13694772 AAATATAATAGAAGGTTTAAGGG - Intergenic
970466464 4:16328487-16328509 AAGTATTTTTAAAGTTCTAAAGG + Intergenic
971171703 4:24240385-24240407 AAATATCTTGGCAGTCTGAAGGG + Intergenic
971266712 4:25102367-25102389 AACTACCTTTGAAGGTTGAAAGG - Intergenic
971460158 4:26887230-26887252 AAATAAATTCTAAGTTTTAAAGG - Intronic
971517595 4:27508378-27508400 AAATATCTTTGAATTGTAGAGGG - Intergenic
971681884 4:29710527-29710549 ACATTTCTTTGAATTGTTAAAGG + Intergenic
971960054 4:33473886-33473908 AAATATTTATGCAATTTTAAAGG + Intergenic
972938218 4:44166468-44166490 AAATACCTCTGAAGTATTAATGG - Intergenic
973060117 4:45713468-45713490 TAAGATTTTTGAAGTTTTAGAGG - Intergenic
973690425 4:53423146-53423168 AAATATCTCTGAAGTTACAATGG - Intronic
973989598 4:56390692-56390714 AATTATTTTTGAACTTTTTAAGG - Intergenic
974117260 4:57594745-57594767 AAATTACTTTGAAATTTCAAGGG - Intergenic
974149086 4:57982486-57982508 AAATATGTTTGCAGTTTAACTGG - Intergenic
974367268 4:60966567-60966589 AATTATGTTTAAAGTGTTAATGG - Intergenic
974456673 4:62138112-62138134 TATTGTCTTTGAACTTTTAAAGG + Intergenic
974713817 4:65639653-65639675 ACAAATATTTGAAGTATTAATGG - Intronic
974900077 4:67985691-67985713 TAATATTTTTAAAGTATTAAAGG - Intergenic
975190758 4:71459037-71459059 AAATAGCTAATAAGTTTTAAAGG - Intronic
975200164 4:71578107-71578129 AAATATCATTGCAGTTTTGGTGG - Intergenic
975373751 4:73618754-73618776 TAATATCATTGGTGTTTTAATGG - Intronic
975423165 4:74193434-74193456 AAATGTATATGAAGATTTAAAGG - Intronic
975966576 4:79979817-79979839 ACATATCCTTGCAGTTGTAAAGG + Intronic
976103409 4:81590325-81590347 AAATTCCTATGAAATTTTAAAGG + Intronic
977065864 4:92314210-92314232 AAATTTCTATGAAATTTGAATGG - Intronic
977119941 4:93086873-93086895 AAATACCATTTAAGTTATAAAGG - Intronic
977326611 4:95581482-95581504 AAATGTCTTTGAAGTTTATTTGG + Intergenic
977614415 4:99072012-99072034 ACATAACGTTGAACTTTTAAGGG - Exonic
977908890 4:102509280-102509302 AAATATTTTTAAAGTTTCTAAGG - Intronic
978268617 4:106859597-106859619 AAATATCTTTGTGGTTTTTCTGG - Intergenic
978659235 4:111104060-111104082 GAATATGTTTTAAATTTTAATGG + Intergenic
978913083 4:114088888-114088910 AAATATCTCTAAAGTTTTGAGGG + Intergenic
978935952 4:114376073-114376095 AAATATCATTGATATTTTAATGG - Intergenic
979007885 4:115325858-115325880 AAATATCATTGAAGATTAAACGG + Intergenic
979302053 4:119097726-119097748 GTATATCTTTGCAGTTTTATGGG - Intergenic
979450079 4:120860292-120860314 AAATATTTTTGAACATTTAAAGG - Intronic
979907270 4:126310898-126310920 AAATCTCTTTCCAGTTTTATGGG - Intergenic
979980125 4:127244691-127244713 AAATCTCATTGTGGTTTTAATGG - Intergenic
980107867 4:128605244-128605266 AAAAACCTTGGAGGTTTTAATGG + Intergenic
980251115 4:130316349-130316371 AAATAGATTTGAAGATTCAAAGG + Intergenic
981397588 4:144272253-144272275 AAATGTCTTTATTGTTTTAAAGG + Intergenic
981778369 4:148396360-148396382 AAATTGCCTTGAAATTTTAATGG - Intronic
982194620 4:152898462-152898484 AAGCATCTTTGAAAATTTAAGGG - Intronic
982366824 4:154587990-154588012 AACTTTCTTTGGAATTTTAAAGG + Intronic
982628457 4:157799789-157799811 AAATAACTGTGTATTTTTAATGG + Intergenic
982822543 4:159960688-159960710 AAATATTTTTGAAGAAATAATGG - Intergenic
982942690 4:161578206-161578228 AAATAGGTTTAAAGATTTAAAGG + Intronic
983084933 4:163431567-163431589 AAATATCTTTCAGGAGTTAAAGG + Intergenic
983160570 4:164408834-164408856 AATTATCTTTAATGTCTTAAAGG - Intergenic
983369220 4:166837909-166837931 AAATATCTTTCAAGAATTAAGGG - Intronic
983643435 4:169965564-169965586 AAAACTCTTTGATGTTTGAATGG - Intergenic
983743116 4:171160211-171160233 AAATATATTTGAAAATTTAGGGG + Intergenic
984020464 4:174478723-174478745 ATGTATATTTGTAGTTTTAAGGG - Intergenic
984272752 4:177567688-177567710 AAATAACTTTGAATTTTTGTAGG + Intergenic
984376130 4:178932643-178932665 TAATAACTTTGATTTTTTAAAGG - Intergenic
984423695 4:179556664-179556686 AAAAATATTTTAAGTGTTAACGG - Intergenic
984463346 4:180063639-180063661 AACTATCTTTCATGTTTTAAAGG + Intergenic
984486862 4:180381771-180381793 AAATATCTTTGTAGATGTAGTGG + Intergenic
984670496 4:182479774-182479796 AAATATTTTTGATCTCTTAATGG + Intronic
984868246 4:184301947-184301969 AAATATATTTGAAAAATTAATGG + Intergenic
985690360 5:1306469-1306491 CAATTTTTTTGAATTTTTAATGG + Intergenic
985910858 5:2880529-2880551 AACTATCTTTGTAATTTAAATGG - Intergenic
986082230 5:4407052-4407074 AAATATCTGTGAACTTTCTAAGG - Intergenic
986328421 5:6699817-6699839 CAATTTCTTTGAAGGTTTTAGGG + Intergenic
987056040 5:14192651-14192673 AAATGTCTTTGAACATTTACAGG + Intronic
987419199 5:17698773-17698795 AAATGTGTTTGAATTTATAATGG - Intergenic
987428242 5:17797948-17797970 AAATATCTTTGTAGTGTTGTGGG + Intergenic
987498791 5:18679431-18679453 AAATATTTTCGAATTTTTAGAGG + Intergenic
987604060 5:20109797-20109819 AAACCTCTTTGAAGTTAGAAAGG - Intronic
988006956 5:25426617-25426639 GCATATCTTTGAAGTTTTTAAGG + Intergenic
988024522 5:25668104-25668126 AAATCTCTTTTCAGTTTTACAGG - Intergenic
988057535 5:26118907-26118929 AAATCTCCTTTAAGTTATAAAGG + Intergenic
988179804 5:27775421-27775443 AAATATATTTACAGTTATAATGG - Intergenic
988361696 5:30243964-30243986 AAATATTTTAGAATTTTGAAAGG - Intergenic
988940595 5:36141329-36141351 AAATTTCTTTGAAATTTTATGGG - Intronic
990068710 5:51751608-51751630 AAATGCCTTTGAGATTTTAATGG - Intergenic
990120692 5:52447339-52447361 AAAAGTAGTTGAAGTTTTAAAGG + Intergenic
990196763 5:53325903-53325925 AAATATCTTTAAAAATTTACTGG - Intergenic
990500907 5:56396443-56396465 CAATATTTTTAAAGTCTTAAAGG + Intergenic
990688655 5:58337026-58337048 AAAAATATTTGAAGAATTAATGG + Intergenic
990762454 5:59144941-59144963 AAATGTCTTTGTTCTTTTAAAGG + Intronic
990851515 5:60210587-60210609 AAATATCTCTGAAGTAAAAAAGG + Intronic
991664239 5:68981711-68981733 AAAAATTTTTAATGTTTTAAAGG + Intergenic
991937885 5:71819838-71819860 AAATATGTTTGAATTTTGACTGG - Intergenic
992630926 5:78679460-78679482 AAATGTCTTTCAAATTTCAATGG - Intronic
992764285 5:79981576-79981598 AAATGTGTTTAAAGTTTTACAGG - Exonic
993186303 5:84625808-84625830 AAACAACTTTGAATTTTTCAAGG - Intergenic
993188951 5:84656516-84656538 AGATTTCTTTGAATTGTTAAGGG - Intergenic
993233804 5:85276369-85276391 AAATTTCATTGAAATTTTCAAGG + Intergenic
993249842 5:85506418-85506440 CAATATCTTTATACTTTTAAAGG + Intergenic
993732443 5:91438771-91438793 AAATATATTTGTAGTTTTGTTGG + Intergenic
993777724 5:92022018-92022040 AAAAAGTTTTGAAGATTTAAAGG - Intergenic
993928768 5:93909093-93909115 AAATATATTTGAAAATTTATAGG - Intronic
994836045 5:104854129-104854151 AAATATTTTTCTAATTTTAATGG + Intergenic
994961330 5:106607605-106607627 AAAAATCTATGAAGTCTTAAAGG + Intergenic
994969095 5:106713399-106713421 AAATATCTTTTTAATTTTATAGG - Intergenic
994980501 5:106869559-106869581 ATGTATTTTTAAAGTTTTAATGG + Intergenic
995069362 5:107900471-107900493 TAATAGCTTTGAAGGTTAAAAGG + Intronic
995402601 5:111758859-111758881 CAATGGCTTTGTAGTTTTAAAGG - Intronic
995546493 5:113237437-113237459 AAATATTTTTGAACATTAAATGG - Intronic
995597284 5:113761573-113761595 TAACATCTTTGAAGTGCTAAGGG - Intergenic
995680458 5:114712553-114712575 ACATATCTTTGAATTTATATAGG + Intergenic
996133736 5:119813211-119813233 AGAAATATTTGAAGTTATAATGG - Intergenic
996475486 5:123915102-123915124 AAATATATTTGAAGAAATAATGG + Intergenic
996593565 5:125176077-125176099 AATTATGTTGGAAGTTTTATGGG + Intergenic
996645249 5:125806662-125806684 AAATATCTTTAAAATGTTTAAGG - Intergenic
996670926 5:126116066-126116088 ATATATGCTTGAAGTTTTACAGG + Intergenic
996898028 5:128509160-128509182 AAATATATTTGAAGAAATAATGG - Intronic
997029919 5:130115291-130115313 AATTATGTTTAATGTTTTAATGG + Intronic
997124309 5:131210561-131210583 TATTATCTGTGAAGTGTTAAAGG - Intergenic
997312141 5:132895798-132895820 AATTATCTTGGAAGTATTTAGGG + Intronic
998306992 5:141088199-141088221 AACTATCTTTAAGGTTTTACCGG + Intergenic
999787745 5:154907410-154907432 AAACATCTTTGAAGTTTTAAAGG - Intronic
1000472661 5:161665057-161665079 AATTATGATTGAAGTTTTAGTGG + Intronic
1000576913 5:162986434-162986456 AAAAATCTTAGAAGGTTTATTGG - Intergenic
1000905601 5:166962608-166962630 GAATATCTTTGAAGTGTTCCTGG + Intergenic
1001387587 5:171352816-171352838 AAATGTGTTTGAAATTTTCAGGG + Intergenic
1001843068 5:174896705-174896727 AAATATCTTTAAAGAAATAATGG - Intergenic
1002262257 5:178001974-178001996 AAATATCTTGAAGGTTTCAACGG - Intergenic
1002388608 5:178891283-178891305 GAAAATCTTTGAAATATTAATGG + Intergenic
1002438379 5:179249087-179249109 ACATATTTGTGAATTTTTAAAGG - Intronic
1003408834 6:5845587-5845609 GAATATGTTTGATGCTTTAATGG - Intergenic
1005251167 6:23948105-23948127 AAATGTCATTGGAATTTTAATGG - Intergenic
1005602679 6:27443689-27443711 AATTATAGTTGAAGTATTAAAGG - Intergenic
1006234640 6:32618074-32618096 AAATGTCTTTGGATTTTAAAAGG - Intergenic
1006962822 6:37950905-37950927 AAATGTCTTTGTAGTTTGATGGG + Intronic
1008182502 6:48349016-48349038 AAATTTCTTTGAGGAGTTAATGG + Intergenic
1008197130 6:48538145-48538167 AAATTTGTTTGAGTTTTTAAAGG - Intergenic
1008634055 6:53391890-53391912 AAATATCTTTAAAAGTCTAAGGG + Intergenic
1008873183 6:56297112-56297134 AAACATTTTTTAATTTTTAAAGG + Intronic
1008901934 6:56630138-56630160 AAATATCTTGGATTTTTGAATGG - Intronic
1009055946 6:58335214-58335236 AAATATACTTTAAGTTATAAGGG + Intergenic
1009235235 6:61115382-61115404 AAATATACTTTAAGTTATAAGGG - Intergenic
1009327898 6:62376561-62376583 AAATATTTATGAAGTCATAAAGG - Intergenic
1009603565 6:65836525-65836547 AACATTCGTTGAAGTTTTAAGGG - Intergenic
1009633953 6:66239422-66239444 AAGTATTTTTAAAATTTTAACGG + Intergenic
1010326478 6:74569122-74569144 AACTGTCTATGGAGTTTTAAAGG + Intergenic
1010701869 6:79058988-79059010 AAATTTTTTTGTTGTTTTAATGG + Intronic
1010762562 6:79740404-79740426 TAATATCTTTAAAGTACTAAAGG + Intergenic
1010970549 6:82258481-82258503 AAATATATTTAAAATGTTAATGG + Intergenic
1011058657 6:83235908-83235930 AAATATTTTTCTAGCTTTAAAGG + Intronic
1011058846 6:83238488-83238510 AAACCTCTTTGAATTTTCAAAGG - Intronic
1011680447 6:89778327-89778349 AAATATATTTTAATTTTAAAAGG - Intronic
1011782135 6:90801345-90801367 AGATTTCTTTGAATTTTTACAGG + Intergenic
1011884016 6:92070212-92070234 AAATATTCTCAAAGTTTTAATGG + Intergenic
1011904367 6:92344179-92344201 TAATATATTTGAAATTTTAAAGG + Intergenic
1012029805 6:94044193-94044215 AAATACCTTTGGAATTTTACTGG + Intergenic
1012159957 6:95872312-95872334 AAATTTTTCTAAAGTTTTAAAGG + Intergenic
1012343866 6:98162711-98162733 AAGTATTTGTGAATTTTTAAAGG - Intergenic
1012572708 6:100750264-100750286 ATATACCTTTGAAATTTTTAAGG - Intronic
1012637309 6:101560366-101560388 AAATATATTTTAGGTTTTTAGGG + Intronic
1012712880 6:102631054-102631076 AAATATCTTTATGGTTTTATTGG - Intergenic
1012817804 6:104046289-104046311 CAATCTCTTTGAAGATTTTAAGG + Intergenic
1013388586 6:109659066-109659088 AAAAATCTTTCATGTTTTCAAGG - Intronic
1013686304 6:112588342-112588364 AAATATCTTTAAGTTTTTATAGG - Intergenic
1013889100 6:115004605-115004627 AAATATCTTAAAAGTTATATTGG - Intergenic
1014496725 6:122133757-122133779 AAAAATCTTTGCACTTTTAGAGG + Intergenic
1014682138 6:124444276-124444298 ACATTTTTTTGAAGTTGTAAGGG - Intronic
1014842316 6:126234986-126235008 AAATATGTTTGAAATTTACAAGG + Intergenic
1015060043 6:128952189-128952211 AAATATGTTTGAATTTGAAATGG - Intronic
1015160346 6:130146297-130146319 CAATATTTTAGAAGTTTTAGTGG + Intronic
1015676151 6:135751769-135751791 AAATATATTTGAAGAAATAATGG + Intergenic
1015723494 6:136272305-136272327 AAATAAGTTTGATGTTTTAAAGG - Intronic
1016276091 6:142354406-142354428 AAAAAACTTTTGAGTTTTAATGG + Intronic
1016603041 6:145885159-145885181 TAATATCTTTACTGTTTTAAAGG - Exonic
1017068856 6:150554378-150554400 AAAAGTTTTTGAAGTTTTGAAGG + Intergenic
1017702028 6:157083756-157083778 AAATGTCTTTGAAGTTATGTTGG - Intronic
1017712108 6:157179871-157179893 ACATATTTTTGAAGGTTTAGGGG - Intronic
1017789425 6:157783397-157783419 AAATATCTATGAAGTCAAAATGG - Intronic
1017831046 6:158128830-158128852 AAAGGGATTTGAAGTTTTAATGG + Intronic
1017982138 6:159408616-159408638 AAATATGTTTAAAGACTTAAAGG + Intergenic
1018347450 6:162916444-162916466 AAATATATTTGAAGAAATAAGGG - Intronic
1018410840 6:163545864-163545886 AAATATTTTTGCATTTGTAAAGG + Intronic
1018471664 6:164102639-164102661 AAATACTTTTGAAGTTGGAAGGG - Intergenic
1019063156 6:169272108-169272130 ACATATAATTGAAGTTTCAAAGG + Intergenic
1020590199 7:10125843-10125865 AAATATCTTTGTAGTGTTACAGG + Intergenic
1020617710 7:10479965-10479987 AAATATATTTTAAATTATAAAGG + Intergenic
1020735604 7:11945536-11945558 GAATATCATTGAAGTCTGAAAGG + Intergenic
1021022910 7:15625970-15625992 AAATATTTTTGAAATTGTATCGG - Intronic
1021108706 7:16669494-16669516 ACATATATTTCAAGATTTAAAGG - Intronic
1021182642 7:17525813-17525835 AAATACAATGGAAGTTTTAACGG + Intergenic
1021182824 7:17528263-17528285 AATTATACTTGTAGTTTTAAAGG + Intergenic
1021371350 7:19851959-19851981 AAATATGTTTATAGTTTTAGGGG + Intergenic
1021819596 7:24483395-24483417 ACATATGTTTAAATTTTTAAAGG + Intergenic
1022580211 7:31545456-31545478 AAATCTCTTTAAAGTTGGAAAGG + Intronic
1022667587 7:32426664-32426686 ACATATCTTTGTGGTATTAATGG - Intergenic
1022814386 7:33900542-33900564 AAATATTTTGGATGTTTTGATGG + Intergenic
1023247877 7:38225960-38225982 AAAAATGTTTGAAGAATTAATGG - Intronic
1023415897 7:39932132-39932154 AAGTATGTTTAACGTTTTAAAGG + Intergenic
1023428460 7:40064374-40064396 AAATATATATGAAGTTTTTTAGG + Intronic
1023578097 7:41651582-41651604 AAAGATTTTTGAAATTTTGAGGG + Intergenic
1024437168 7:49371579-49371601 AAATATGTTTGATGGTTTAAAGG - Intergenic
1024467179 7:49723560-49723582 CAATCTCTTTAGAGTTTTAAAGG + Intergenic
1024764300 7:52638944-52638966 AAAAATCTCTGAAGTTGTTATGG - Intergenic
1025165927 7:56712321-56712343 AAATATTAGTGTAGTTTTAAGGG + Intergenic
1026503746 7:70964704-70964726 AAATACCTTTGGAGTTTTTTTGG - Intergenic
1027334067 7:77129831-77129853 AAATATGTTTGAAGAATGAAAGG - Intronic
1027547528 7:79547114-79547136 AAATATCTTATAAGTATTATTGG + Intergenic
1027590166 7:80109484-80109506 TAGTATATTGGAAGTTTTAAAGG + Intergenic
1027704867 7:81517503-81517525 GAATATCTTTTAAGATATAAAGG - Intergenic
1027748393 7:82108258-82108280 GAATTTCTTTGACCTTTTAAGGG + Intronic
1028025336 7:85830081-85830103 GAGTATATTTGAAATTTTAATGG + Intergenic
1028465400 7:91145885-91145907 TAATCCCTTTGAAGTTTAAAGGG - Intronic
1028658878 7:93243653-93243675 AAATACCTTTCATGTTTAAATGG - Intronic
1028804987 7:95015655-95015677 AAATATGTTTGAAGAAATAATGG + Intronic
1028807056 7:95039835-95039857 AAAAATATTTGAAGTGATAATGG + Intronic
1028928864 7:96390710-96390732 AAATTTCTTTGTAGTTTCAAGGG + Intergenic
1029034526 7:97504829-97504851 ACCTAGTTTTGAAGTTTTAAAGG + Intergenic
1029322023 7:99770728-99770750 AAATATGTTCCTAGTTTTAAAGG - Intronic
1029601721 7:101567979-101568001 AAATCTCATTGATGTTTTAATGG - Intergenic
1029659542 7:101950685-101950707 AAATATATTTTAAGTTTTGCAGG - Intronic
1029872130 7:103705735-103705757 ACACAGCTTTGAAGTTTCAAAGG - Intronic
1030504770 7:110407596-110407618 AAATATTTTTGAAATTATTATGG + Intergenic
1030582036 7:111369191-111369213 ACATATCTTAGAAGATTTAGTGG + Intronic
1030821717 7:114100769-114100791 ATATGTATTTGAAATTTTAATGG + Intronic
1030864855 7:114688428-114688450 AAGTAACTTTGAATTTTAAAAGG - Intronic
1031028398 7:116707133-116707155 AAATATTTTTGAAGTATATATGG - Intronic
1031179809 7:118399866-118399888 AGAAATATTTGAGGTTTTAATGG + Intergenic
1032054137 7:128671343-128671365 TTATATCATTTAAGTTTTAAAGG + Intergenic
1032989568 7:137377844-137377866 AAATATATTTGAAGATGTAATGG - Intergenic
1033218290 7:139510114-139510136 GACTTTCTTTGAAGTATTAAAGG + Intergenic
1033466811 7:141598941-141598963 AAATATATTTGCATTTTTAAAGG + Intronic
1033530914 7:142263203-142263225 AAGTATGTTTGCAGTTTTAGTGG + Intergenic
1033545705 7:142398196-142398218 AAATAGGTTTGAAGTTTTAAGGG - Intergenic
1033774646 7:144594499-144594521 AAATATATTTGAAGAAATAATGG + Intronic
1033924142 7:146436670-146436692 AAATATTTATCAAGTTTTAGAGG - Intronic
1033955057 7:146837121-146837143 AAATATGTTTGAAGAAATAATGG - Intronic
1034613790 7:152396838-152396860 ACATATGTTTCAAGTTTTGATGG - Intronic
1034889226 7:154825036-154825058 AAATATTTTTCAAATTGTAATGG - Intronic
1035593892 8:839397-839419 AAATGTCTTTGTCTTTTTAAAGG - Intergenic
1035820397 8:2585146-2585168 AAAAATCTTTGATGTTTTTTGGG + Intergenic
1035821726 8:2600147-2600169 AAGTATTTTTGAAGATTAAATGG + Intergenic
1035822488 8:2608644-2608666 AAATTTGTGTGAAGTCTTAAAGG - Intergenic
1035973153 8:4275373-4275395 AATCATCTTTAATGTTTTAAAGG + Intronic
1036040971 8:5081242-5081264 AAATATCTCAGTAGTTATAAAGG + Intergenic
1036093340 8:5694005-5694027 AGTTACATTTGAAGTTTTAATGG + Intergenic
1036415899 8:8548048-8548070 AAATGTTTTTGAAGTTTAACTGG + Intergenic
1036623227 8:10442608-10442630 AAAAATATTTGAAGATTTCATGG - Intergenic
1037047487 8:14326245-14326267 AAATATCTTTTATGTGTTCAGGG + Intronic
1037122626 8:15307394-15307416 AATTATCTTTGACTTTTTTATGG + Intergenic
1037378122 8:18254317-18254339 AAATGTCATTGAAATTTTGATGG - Intergenic
1037447066 8:18975995-18976017 AAATTTCTTAGAAGTGTAAATGG - Intronic
1037574414 8:20187656-20187678 AAATATTTTTGATGTTGTGAAGG - Intergenic
1037631629 8:20662599-20662621 AAATATATTTGCATTTTAAAAGG + Intergenic
1037674135 8:21039763-21039785 AAACAGCTTTTTAGTTTTAAGGG - Intergenic
1037694583 8:21212380-21212402 ATATATCTTAGAGGTTTGAATGG + Intergenic
1038434247 8:27523655-27523677 AAATATTGTTAAAGTTTTCATGG + Intronic
1038773393 8:30504964-30504986 AAATTTCCTTAAAGTTTTACTGG - Intronic
1038876153 8:31552084-31552106 AAATGTATTGGAAGTTTTACTGG + Intergenic
1039325225 8:36478168-36478190 AAATATTTTTGTAGCTTTATGGG - Intergenic
1039449878 8:37664020-37664042 AAATAGCTCTGAAATGTTAATGG + Intergenic
1040076702 8:43243689-43243711 AAATGTCTTTGAGATTTTGATGG + Intergenic
1040784335 8:51148012-51148034 CATTTTCTGTGAAGTTTTAAAGG - Intergenic
1041331592 8:56731992-56732014 AAAAATCTTAGAAGATGTAATGG - Intergenic
1041591549 8:59591204-59591226 TAATATCTATTAAGTTTTCAAGG + Intergenic
1041673188 8:60513425-60513447 AAATATGTTTGGATTTTTATGGG + Intergenic
1041675465 8:60534109-60534131 AAATATGTACGAAGTTCTAAAGG + Intronic
1041947820 8:63466326-63466348 AAACATTTTTGGAGTTTTACAGG + Intergenic
1042300575 8:67276127-67276149 AAATATCTCTAAAATTTTCATGG - Intronic
1042471618 8:69196356-69196378 AAATAGCTATTATGTTTTAAAGG + Intergenic
1042702630 8:71633216-71633238 TAATATCTTTAAAGTCCTAAAGG - Intergenic
1043061111 8:75504362-75504384 AACTATCTTTGATATTTTAAAGG - Intronic
1043734051 8:83722858-83722880 ATATAACCTTGAAGTTTTCATGG + Intergenic
1043766650 8:84142919-84142941 AAACATCTCCAAAGTTTTAAAGG + Intergenic
1044477767 8:92648185-92648207 AATTGTCTCTGAAGTTTAAATGG - Intergenic
1044572551 8:93735755-93735777 AAATGTCATAGAAGTTTTATGGG - Exonic
1044732815 8:95245112-95245134 AAACATCTTGAAAGTTTTATAGG + Exonic
1044773463 8:95662261-95662283 TGATATCTTTGAAGATTTAATGG - Intergenic
1045196745 8:99940274-99940296 AAAAATATTTGAAGATATAATGG - Intergenic
1045444725 8:102248873-102248895 GAATATCTGTGAAGCTTTTAGGG + Intergenic
1045667876 8:104510298-104510320 AAATAGCTTGGAAGTATTAATGG - Intronic
1046079300 8:109351789-109351811 AAATATTATTGAAATTTTAATGG + Intergenic
1046143847 8:110131042-110131064 AATTCTCTTTCAATTTTTAATGG - Intergenic
1047029829 8:120864373-120864395 AAATACCTTTAAAATTTAAAGGG + Intergenic
1047085849 8:121514414-121514436 AAATAGATCTGAAGTTTTAGGGG - Intergenic
1047268576 8:123332211-123332233 AAATATCTTGGAAATTTTTTTGG - Intronic
1047388081 8:124427934-124427956 AAATATCTTGGAAATGTGAAGGG + Intergenic
1047566824 8:126053591-126053613 AAAAATATTTGAAGTAATAATGG + Intergenic
1047598837 8:126406319-126406341 AAATGTGTTTCATGTTTTAAAGG - Intergenic
1047783796 8:128134086-128134108 AAATATCTGTAAAGGTTTATGGG - Intergenic
1048276842 8:133072542-133072564 AAATATGCTGGAAGTTTTGATGG + Intronic
1048493460 8:134915757-134915779 AAATATATATGAAGATTTACAGG - Intergenic
1048870934 8:138797569-138797591 ACATATCTTTGCATTTTTGAGGG + Intronic
1049080831 8:140442112-140442134 AAATATTTTTGAAATTTTGTGGG - Intronic
1049908284 9:240127-240149 AAATATCTTTAACCTTTTAAAGG - Intronic
1050123612 9:2333733-2333755 AAAAATCTTTGACATTTTATTGG + Intergenic
1050170225 9:2807975-2807997 AAAAATATTTGCAGATTTAAGGG - Intronic
1050330198 9:4537963-4537985 AAATATCTCATAATTTTTAATGG - Intronic
1050436588 9:5617190-5617212 AATTATCTGTCAAGTTTGAATGG - Intergenic
1050568716 9:6915141-6915163 AAGTATCTTTGAAGTAGTAAAGG - Intronic
1051386275 9:16512663-16512685 ATAAAACTTTGATGTTTTAAGGG + Intronic
1051678737 9:19584701-19584723 AAATTTCTTTAAAATTTTCATGG - Intronic
1051950643 9:22627455-22627477 AAATATTTGTAAAATTTTAAAGG + Intergenic
1052001864 9:23293204-23293226 AACTATTTTTGCAGTTTTGATGG - Intergenic
1052052967 9:23869184-23869206 AAATATCTAAGAAATTTTGAAGG - Intergenic
1052069286 9:24061941-24061963 AAATTTCTGGGAAGTTTTCAAGG + Intergenic
1052763815 9:32619979-32620001 AAGCATCTTTGAAAATTTAATGG + Intergenic
1054096319 9:60905879-60905901 AAATGTCATTGAAATTTTGATGG + Intergenic
1054721908 9:68612397-68612419 AAATATTTTAAAAATTTTAATGG + Intergenic
1055186098 9:73455822-73455844 AAATATCTGTTAAATTATAATGG - Intergenic
1055261898 9:74446954-74446976 AAAGATCTTTGAAGGGTAAAGGG + Intergenic
1055418219 9:76107472-76107494 CCAAACCTTTGAAGTTTTAAAGG - Intronic
1055477707 9:76679360-76679382 AAATTTATTTGAAATTTCAAGGG + Intronic
1055852266 9:80645752-80645774 AAATATCTTTGAATTTATTTAGG + Intergenic
1055867479 9:80832660-80832682 AAATATTGATGAATTTTTAAAGG - Intergenic
1055955762 9:81772319-81772341 AAATAACTTGGAAATTCTAAAGG - Intergenic
1056885424 9:90438643-90438665 AAAAATATTTGAATTTATAATGG + Intergenic
1057287139 9:93765871-93765893 AAATATATTTGAAGTAATAATGG + Intergenic
1057405396 9:94765713-94765735 AAACATATTTGAAGCTGTAAAGG + Intronic
1058747349 9:108004676-108004698 AAATGTCATTGAATTTTTATTGG + Intergenic
1059008453 9:110430051-110430073 AAAAATCTTTGAAATTTCAAGGG + Intronic
1059241738 9:112811937-112811959 ACTTATCTTTGGAGTTTTACTGG + Intronic
1059550016 9:115219734-115219756 AAATATCTTGGGAGATTTCATGG - Intronic
1059634096 9:116154981-116155003 TGATTTCTTTGACGTTTTAATGG + Intronic
1060151378 9:121290454-121290476 AAATATCTTTGAATCTCTGATGG + Intronic
1060648749 9:125306066-125306088 AAATATCCTTGAATTTTCATTGG - Intronic
1060903049 9:127278602-127278624 CAACATTTGTGAAGTTTTAAAGG - Intronic
1061690118 9:132320767-132320789 AAATCTCTTTGGTGTTTTAGTGG - Intronic
1186016176 X:5196819-5196841 AAAAATTTTTGAAGATTTGAAGG + Intergenic
1186070888 X:5818842-5818864 AAATGTTTCTGAAGTTTAAATGG + Intergenic
1186197476 X:7124040-7124062 AGATGTCTGTCAAGTTTTAATGG - Intronic
1186553289 X:10529831-10529853 AAATATCATTGCATATTTAAGGG - Intronic
1186788877 X:12977453-12977475 AAATATCTTTGCAGTTCTTACGG + Intergenic
1187710617 X:22049895-22049917 ATATTTTTTTGATGTTTTAAAGG + Intronic
1187716728 X:22109795-22109817 AAAAATCTGTTAAATTTTAAGGG - Intronic
1188745928 X:33843408-33843430 AAATATATTCAAAGTCTTAAAGG + Intergenic
1188762272 X:34047550-34047572 AAATATCTCTGATGTTTAAGTGG + Intergenic
1188833454 X:34928857-34928879 AAATTACTTTAAAGTTTTAAAGG - Intergenic
1188847514 X:35091588-35091610 GAATATCTTAGAATTTTAAATGG - Intergenic
1188945781 X:36299882-36299904 ATACATCTGTGAAATTTTAAAGG + Intronic
1189399688 X:40655699-40655721 AAATCCATTTGAATTTTTAAAGG - Intronic
1189445767 X:41079785-41079807 AAATATCTATGAAGTAAAAATGG + Intergenic
1190005746 X:46736352-46736374 TAATATTTTTGAAGCTCTAATGG - Intronic
1190955535 X:55189427-55189449 AAAAAAATTTGAAATTTTAAAGG + Intronic
1191075436 X:56448316-56448338 AAATATGTTTGCAGTATCAAAGG + Intergenic
1192116593 X:68417583-68417605 AAAAATCTTTGCTGGTTTAATGG + Intronic
1192595688 X:72405952-72405974 AAATATGTTTAAAGTAATAAGGG - Intronic
1193381096 X:80816641-80816663 AAATATATTTGAAGGACTAAAGG + Intergenic
1193864393 X:86712345-86712367 AAATATGCTTCTAGTTTTAAAGG + Intronic
1194313743 X:92347692-92347714 AACTATCTATGAGGTTATAATGG - Intronic
1194551650 X:95308393-95308415 AATTATCTTTAAAATTTTTACGG + Intergenic
1194728214 X:97424240-97424262 AAATATCACTGATGTATTAAAGG - Intronic
1194795565 X:98207877-98207899 ACATACCTTTGAAGGTCTAAAGG - Intergenic
1194926139 X:99826588-99826610 AAATATCCTTGCAGTTCCAATGG + Intergenic
1195642714 X:107194434-107194456 AAATATCTTAAAAGTGTTAAGGG + Intronic
1195864632 X:109416283-109416305 AAATATATTTGAAGATTTAAAGG + Intronic
1195987658 X:110647878-110647900 AAATACGTTTGAAGATATAATGG + Intergenic
1196030938 X:111095514-111095536 AGAAAGCTTTGAAGGTTTAAGGG + Intronic
1196038629 X:111175653-111175675 AAATAGCATTGAATTTTAAAAGG + Intronic
1196506698 X:116453868-116453890 AAATATGTTTGAGATTTTCAAGG - Intronic
1196691797 X:118567369-118567391 AAATAGCTTTGAAGTTTATGAGG - Intronic
1196965762 X:121053132-121053154 AATTATCTTTGAAAATTTTAAGG + Intergenic
1197202537 X:123760537-123760559 AAATATCTCTGAAAGTTTATGGG + Intergenic
1197289140 X:124633351-124633373 AAATAGTTTTAAAGCTTTAATGG + Intronic
1197549805 X:127876462-127876484 AAATATCTTTGGGTTTTTAATGG - Intergenic
1197616761 X:128700676-128700698 AAATACATTTCAAGTTTTACAGG + Intergenic
1197666192 X:129226230-129226252 AAATATTTTTGAAGAAATAATGG + Intergenic
1197955968 X:131948375-131948397 AAATAATTTTGAATTTTGAAGGG + Intergenic
1198091038 X:133330312-133330334 AATTTTCTTAGAAGTTTGAAAGG - Intronic
1198384342 X:136114301-136114323 AAATATCTTTGAAATTTATAAGG + Intergenic
1198532411 X:137559609-137559631 ACATATCTTTATAGTTTAAAGGG + Intergenic
1198882671 X:141298119-141298141 AAATATTTTAGAAATATTAATGG - Intergenic
1198999638 X:142619447-142619469 ACCTGGCTTTGAAGTTTTAAAGG - Intergenic
1199177055 X:144801546-144801568 AATTATCTTTGCAGTTTTGGGGG + Intergenic
1199479391 X:148281435-148281457 CAATGTCTTTAAAGTTCTAATGG - Intergenic
1199705885 X:150424620-150424642 CAAAATCTTTTAAGTTTTGAAGG - Intronic
1199795246 X:151189443-151189465 AAACATCTTTGAAGTGATAATGG + Intergenic
1199985483 X:152947068-152947090 AAGTATTTTTGAATTATTAAAGG + Intronic
1200129936 X:153836163-153836185 TAATTTTTTTGAATTTTTAATGG - Intergenic
1200622008 Y:5461806-5461828 AACTATCTATGAGGTTATAATGG - Intronic
1201379227 Y:13354497-13354519 AAATATCGTTGTTGTCTTAAGGG + Intronic
1202588231 Y:26454690-26454712 AAATAGTTTTTAATTTTTAAAGG + Intergenic