ID: 959855502

View in Genome Browser
Species Human (GRCh38)
Location 3:111151251-111151273
Sequence CTCATTCAAAACCTGTTTAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 435
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 411}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959855502 Original CRISPR CTCATTCAAAACCTGTTTAT CGG (reversed) Intronic
900213936 1:1471189-1471211 CTCACACAAAACCTGTTTGGTGG + Intergenic
902693547 1:18125606-18125628 TTCATTCAACTCATGTTTATTGG + Intronic
902950614 1:19880075-19880097 CCCATTCAAAATCTGTGTGTGGG + Intergenic
903163447 1:21505246-21505268 TTCATTCAACAAATGTTTATTGG - Intergenic
903171163 1:21554986-21555008 CTCACTCAAAGCCTGTTTGGTGG - Intronic
903395302 1:22997530-22997552 CTCATACAAAGCCTGTTTGGTGG - Intergenic
903728831 1:25474276-25474298 GTCAAACAAAACATGTTTATGGG + Intronic
904022968 1:27482343-27482365 CCCATTCTAAACATGTTTTTTGG + Intronic
904755445 1:32766228-32766250 CTCAGTGAAATCCTGTTTAGAGG + Intronic
905904182 1:41605883-41605905 TTCACTCAAAAAATGTTTATGGG - Intronic
907295506 1:53449779-53449801 CTCACACAAAGCCTGTTTGTTGG + Intergenic
909247631 1:73307866-73307888 CTAAGTCAGAAACTGTTTATAGG + Intergenic
909865779 1:80668427-80668449 CTCTTTAAAAAAATGTTTATAGG - Intergenic
910671317 1:89775582-89775604 TTCATTCAACACATGCTTATTGG - Intronic
911510097 1:98801078-98801100 CTCATGCAAAGCCTGTTTGGTGG - Intergenic
912444816 1:109727263-109727285 CTCACACAAAGCCTGTTTAGTGG - Intronic
912646785 1:111400530-111400552 CTCATTCCATACTTATTTATTGG - Intergenic
912815589 1:112825684-112825706 CTCACACAAAACCTGTTTGGTGG - Intergenic
914455698 1:147834247-147834269 CTCACACAAAGCCTGTTTAGTGG + Intergenic
915738826 1:158102455-158102477 CTCACACAAAGCCTGTTTAGTGG - Intergenic
915775117 1:158474602-158474624 CTGATTCATAACATCTTTATTGG - Intergenic
917447637 1:175120039-175120061 CTGATTAAAAACCTGTTTTGTGG + Intronic
918222241 1:182445489-182445511 CTCACACAAAGCCTGTTTAGTGG - Intergenic
920741621 1:208586494-208586516 CTACTTCAAACCCTGTTTCTTGG + Intergenic
921211924 1:212908334-212908356 CTCATACAAAGCCTGTTTGGTGG - Intergenic
921895116 1:220391660-220391682 CTCTTTGAAAACATGTTTCTGGG + Intergenic
922362974 1:224839954-224839976 CTCACACAAAGCCTGTTTAGTGG - Intergenic
922409845 1:225362016-225362038 TTCATCCAAAAACTATTTATAGG + Intronic
922934503 1:229412770-229412792 CTCACACAAAACCTGTTTGGTGG + Intergenic
923146041 1:231198818-231198840 GTCATTCAAATCTTGTTCATAGG - Intronic
923214431 1:231835260-231835282 CTCACACAAAGCCTGTTTAGCGG - Intronic
923228799 1:231964208-231964230 TTCATTCAATACATGTTTATTGG - Intronic
1063036992 10:2296219-2296241 CACAACCAAAACCTCTTTATGGG - Intergenic
1065046490 10:21751396-21751418 CTCACACAAAGCCTGTTTAGTGG - Intergenic
1065398387 10:25266712-25266734 CTTATTCAAAATATATTTATTGG - Intronic
1065422951 10:25567456-25567478 CTCATTCATAACAAGTTTCTGGG + Intronic
1065455451 10:25902412-25902434 CTCACACAAAGCCTGTTTAGTGG - Intergenic
1066183610 10:32987102-32987124 GGAATTCAAAACCCGTTTATAGG + Intronic
1066577092 10:36838131-36838153 CTGATTAAACACCTGATTATTGG + Intergenic
1066686003 10:37982332-37982354 CCAATTCAAAAACTGTTTCTGGG + Intergenic
1067409818 10:46054580-46054602 CTCATACAAAGCCTGTTTGGTGG - Intergenic
1067569478 10:47360843-47360865 CCCTTTCAAAACCGGTTTCTGGG + Intergenic
1068168220 10:53358836-53358858 CTCACTCAAAGCCTGTTTGGTGG - Intergenic
1068994490 10:63187198-63187220 CTCATTGAAAAAATGTTTAATGG - Intronic
1069006289 10:63321035-63321057 CTCATTCAAACTCTATTTTTAGG - Intronic
1069116008 10:64507167-64507189 CTCACACAAAGCCTGTTTGTTGG + Intergenic
1071590226 10:86865555-86865577 CTCACACAAAGCCTGTTTAGTGG + Intronic
1073351651 10:102824233-102824255 CTCTTTCCAACCCTGTTTACTGG + Intergenic
1073738311 10:106376732-106376754 CTAATTCAAAGCCTATTTAAAGG + Intergenic
1074425558 10:113348140-113348162 CTCAATCAAACTTTGTTTATAGG + Intergenic
1074871236 10:117577673-117577695 CTTATTCAAAACGTGTTAAGAGG - Intergenic
1075208007 10:120463324-120463346 CTCATTTGAAACTTGTTTCTAGG - Intronic
1075293394 10:121250807-121250829 GTCTTTCAACAGCTGTTTATTGG - Intergenic
1075365173 10:121881224-121881246 TTCATTCAAAACATGTTCACTGG + Intronic
1076075767 10:127532747-127532769 ATCTTTCAAAACCAGGTTATTGG + Intergenic
1077937403 11:6802210-6802232 CTCACTCAAAGCCTGTTTGGTGG + Intergenic
1078179611 11:9000138-9000160 CTCATTATAAACAGGTTTATAGG - Intronic
1078538344 11:12193159-12193181 TTCATTCAGCACCTGTCTATAGG + Intronic
1079727405 11:23892549-23892571 CTCACACAAAACCTGTTTGGTGG - Intergenic
1079992230 11:27258223-27258245 CTCATTCAGCACCTATTGATTGG - Intergenic
1081034571 11:38126940-38126962 TTCATTCAATACATATTTATGGG + Intergenic
1082625134 11:55475625-55475647 CCTATTTAAAACCTGTTTCTTGG - Intergenic
1082692526 11:56323790-56323812 CTCATACAAAGCCTGTTTGGTGG + Intergenic
1082704223 11:56473561-56473583 ATCACACTAAACCTGTTTATGGG + Intergenic
1083543205 11:63529342-63529364 CTCACACAAAACCTGTTTGGTGG - Intergenic
1084233742 11:67772205-67772227 TTCATTCAAGAACTGTTCATTGG - Intergenic
1084612736 11:70213973-70213995 CTCACACAAAGCCTGTTTAGTGG - Intergenic
1085565166 11:77507032-77507054 GTCATTCAACAACTATTTATGGG - Intergenic
1085750270 11:79155276-79155298 CTGCTTCACAACCTGTTTCTAGG + Intronic
1086929265 11:92674457-92674479 CTCACTCTAACCCTGCTTATTGG + Intronic
1087602730 11:100337435-100337457 CACATTCAACACCTGATTTTGGG - Intronic
1089987079 11:122824785-122824807 CTCACACAAAGCCTGTTTAGTGG + Intergenic
1089988154 11:122832777-122832799 CTCACACAAAGCCTGTTTAGTGG + Intergenic
1090686040 11:129121022-129121044 TTGATTCTAAACGTGTTTATGGG - Intronic
1093131019 12:15391787-15391809 ATCCTGCAAAACCTGTTTGTGGG + Intronic
1093258193 12:16899210-16899232 TTCATTCAAAAAATGTTTATAGG - Intergenic
1093508704 12:19901098-19901120 CTCATTAAAAAACTATTTGTAGG + Intergenic
1094270582 12:28609901-28609923 TTCATTTAATACCTTTTTATAGG - Intergenic
1094347575 12:29487692-29487714 ATCACTCAAAACCTGTTCACAGG - Exonic
1095431697 12:42141374-42141396 CTCAAGCAAAACATATTTATAGG - Intronic
1095591923 12:43913181-43913203 CTCATTCATGAACTGTCTATGGG + Intronic
1096392704 12:51241662-51241684 TTCATTCAAAAACTGTGTAAGGG + Intronic
1096821214 12:54236452-54236474 CTAATTCAGAACATGTTTTTGGG + Exonic
1099067115 12:77995428-77995450 CTCTTTCAAAACATTTTTATAGG - Intronic
1099292417 12:80788511-80788533 CTCATACAAAGCCTGTTTGGTGG - Intergenic
1100602934 12:96127867-96127889 TTCATTCAGAATATGTTTATTGG - Intergenic
1101259046 12:103010505-103010527 TTAATTCAAAAAGTGTTTATTGG - Intergenic
1101769661 12:107737354-107737376 CTCATTCAAAACCATTTTGAGGG + Intronic
1101803152 12:108040169-108040191 CTCATTCAAAACATATTTATTGG + Intergenic
1103196609 12:119048974-119048996 TTCATTCAAGACATCTTTATTGG + Intronic
1103667133 12:122577650-122577672 TCCTTTCAAACCCTGTTTATAGG + Exonic
1104312271 12:127664034-127664056 CTCACTCAACAAATGTTTATTGG - Intergenic
1104404689 12:128507745-128507767 CTCCTTCAAAACATGCTTCTGGG - Intronic
1105300415 13:19129177-19129199 CCCATTGAAAACCTTTTTCTTGG + Intergenic
1106850721 13:33787724-33787746 CTTATTCACAACCTCTTTATTGG - Intergenic
1106952333 13:34898221-34898243 CACATTAAAAACCTGTATGTAGG + Intergenic
1107408089 13:40133784-40133806 CTCATTTAAAAGCTTTTAATTGG + Intergenic
1107904253 13:45047615-45047637 CTCATTCAAATCATTTTTCTTGG - Intergenic
1108203225 13:48062244-48062266 CTCATACAAAGCCTGTTTGGTGG + Intronic
1108279120 13:48843262-48843284 CTCATTCAACAAATGGTTATTGG - Intergenic
1108832317 13:54495159-54495181 CTCACACAAAGCCTGTTTAGTGG + Intergenic
1109600621 13:64623106-64623128 CTCTTTTAAAACCATTTTATTGG - Intergenic
1111028103 13:82560642-82560664 CTCATTTAAAAGTTGTATATAGG - Intergenic
1111634411 13:90884983-90885005 CTCACTCATTACCTGTTCATTGG + Intergenic
1111841914 13:93459723-93459745 TTCATTTAGAACCTGTTTCTTGG + Intronic
1112965960 13:105194106-105194128 CTCTGTCAAAATCTGTTTCTGGG + Intergenic
1113730151 13:112635809-112635831 AACATTCAAAACCAGTTTTTAGG + Intergenic
1114346083 14:21796621-21796643 CTCACACAAAACCTGTTTGGTGG + Intergenic
1116124062 14:40758859-40758881 CTCACACAAAGCCTGTTTGTTGG - Intergenic
1116263108 14:42656457-42656479 CTAATTCAAAACTTGTTTAAAGG + Intergenic
1116573939 14:46549623-46549645 CTCACACAAAGCCTGTTTAGTGG + Intergenic
1117479219 14:56126448-56126470 CTCATGCAGAATCTGTTTTTAGG + Intronic
1117957387 14:61133264-61133286 CTCACACAAAGCCTGTTTAGTGG - Intergenic
1117958229 14:61138780-61138802 CTCACACAAAGCCTGTTTAGTGG - Intergenic
1119022894 14:71129961-71129983 CTCACACAAAGCCTGTTTAGTGG + Intergenic
1119373919 14:74172967-74172989 TTCATTCAATACGTATTTATTGG - Intronic
1120055073 14:79914793-79914815 CTCATCCAAGACATGTTAATTGG + Intergenic
1120250865 14:82060926-82060948 CTCACACAAAGCCTGTTTAGTGG - Intergenic
1120329255 14:83068370-83068392 TTCATTGAAAACCTGTTCTTGGG + Intergenic
1120538991 14:85732455-85732477 CTCATACAAAGCCTGTTTGGTGG - Intergenic
1120936134 14:89897025-89897047 CTCATTTAAAATGTGTTTAGCGG - Intronic
1121222657 14:92298469-92298491 CTGTTTCAAGACCTGATTATGGG + Intergenic
1121973871 14:98384848-98384870 CTTATTCAAACCTTGTTCATTGG + Intergenic
1125853325 15:42924992-42925014 CTCTATAAAAACTTGTTTATGGG - Intergenic
1125882410 15:43206158-43206180 TTCATTCAACACATATTTATTGG - Intronic
1126790120 15:52213187-52213209 CTCATTCAGAACCTCATTCTTGG - Exonic
1126843432 15:52738942-52738964 CTCACACAAAACCTGTTTGGTGG + Intergenic
1127308907 15:57733998-57734020 GTCATTCAATAAATGTTTATCGG - Intronic
1127438137 15:58978796-58978818 GTCATTTAAAAACCGTTTATCGG + Intronic
1129533433 15:76289782-76289804 CTCATTCCAAACCCATTTACAGG + Intronic
1131463662 15:92637694-92637716 CTCATTGAAAGCCTGCTTACAGG - Intronic
1131563851 15:93467938-93467960 CTCATACAAAGCCTGTTTGGTGG - Intergenic
1132266772 15:100480509-100480531 CTCTTTCAAAACCTACTTTTAGG - Intronic
1132268626 15:100503181-100503203 CTCTGTCAAAACCTCTTAATCGG + Intronic
1133631779 16:7628911-7628933 TTCATTTAAAAACAGTTTATCGG - Intronic
1134585808 16:15409680-15409702 CTCATACAAAGCCTGTTTGGTGG + Intronic
1134908169 16:17999963-17999985 TTCATTCAACAAATGTTTATTGG + Intergenic
1135147027 16:19971646-19971668 TCCATTCAACACATGTTTATTGG + Intergenic
1135434766 16:22419486-22419508 AACATTCAAAACCTGTTGATGGG - Intronic
1136325504 16:29521099-29521121 CTCACACAAAGCCTGTTTAGTGG + Intergenic
1137659847 16:50195133-50195155 CTAATTAAAAAAATGTTTATGGG - Intronic
1137779397 16:51085029-51085051 CTCATTCAAAACACACTTATTGG + Intergenic
1138815775 16:60201084-60201106 CTCACACAAAACCTGTTTGGTGG + Intergenic
1138935523 16:61716720-61716742 CTTAATCATAACCAGTTTATGGG - Intronic
1139020730 16:62745564-62745586 CTCATTCAGAGCCTTTTGATGGG + Intergenic
1139428395 16:66897326-66897348 CTCACACAAAACCTGTTTGGTGG - Intergenic
1140590027 16:76340622-76340644 TTCATTCAATACATATTTATAGG + Intronic
1142043944 16:87913277-87913299 AACATTCAAAACCTGTTGATGGG - Intronic
1143614478 17:8041610-8041632 TTCATTCAAAACTTGCTTTTGGG - Intronic
1143844102 17:9759291-9759313 CTCATTCCAAACTTTTTTGTGGG - Intergenic
1144016668 17:11202738-11202760 CTTATTCAAAACCTGAGTTTTGG - Intergenic
1144940448 17:18935810-18935832 CCCATTTAAAACATGTTTTTGGG - Intergenic
1145080909 17:19893517-19893539 CTCACACAAAGCCTGTTTAGTGG - Intergenic
1146301492 17:31693151-31693173 CTCATTCAAAACCAAATCATGGG + Intergenic
1147785347 17:42974470-42974492 TTCATTCAAAAGATATTTATTGG + Intronic
1149161163 17:53694772-53694794 TGGATTAAAAACCTGTTTATTGG + Intergenic
1149310424 17:55387646-55387668 TTCATTCAACAGATGTTTATTGG - Intergenic
1149476867 17:56969122-56969144 CTAATTCAAAACTTATTTAAAGG + Intergenic
1149549590 17:57530560-57530582 CTCATTAACACCCTGTTAATAGG - Intronic
1149937981 17:60828768-60828790 TTCTTTCAAGACATGTTTATGGG + Intronic
1152985457 18:316787-316809 TTCTTTCAAAAGCTGTTTAGAGG + Intergenic
1153834851 18:8954715-8954737 CTCACACAAAACCTGTTTGGTGG + Intergenic
1155158752 18:23178983-23179005 CAGATTCAAAACCAGTTTCTTGG + Intronic
1162266807 19:9582597-9582619 CTCATACAAAGCCTGTTTGGTGG + Intronic
1163896033 19:20060013-20060035 CTCACACAAAACCTGTTTGGTGG + Intergenic
1163918183 19:20261404-20261426 CTCACACAAAGCCTGTTTGTTGG - Intergenic
1166799173 19:45445315-45445337 CTCAATAAATACCTGTTGATTGG - Intronic
1167887889 19:52516873-52516895 CTCACACAAAGCCTGTTTAGTGG + Intergenic
1167900826 19:52621065-52621087 CTCACACAAAACCTGTTTGGTGG + Intronic
1168052141 19:53837303-53837325 CTCATACAAAGCCTGTTTGGTGG + Intergenic
1168131287 19:54321270-54321292 CTCACACAAAGCCTGTTTAGTGG - Intergenic
1168135420 19:54347974-54347996 CTCATACAAAGCCTGTTTGCTGG - Intergenic
925742037 2:7014269-7014291 TTCATTCAACAACTATTTATGGG - Intronic
926599603 2:14828063-14828085 CTCATTCAGCATATGTTTATTGG + Intergenic
927190409 2:20513232-20513254 CTCACTCAAAACCCTTTTGTGGG + Intergenic
928779217 2:34801022-34801044 CTCACACAAAACCTGTTTGGTGG - Intergenic
928988545 2:37205590-37205612 CTCATGCAAAGCCTGTTTGGTGG + Intronic
929368509 2:41192161-41192183 TTCATTCAACAACTATTTATTGG - Intergenic
930113414 2:47698304-47698326 CTCACACAAAGCCTGTTTAGTGG - Intronic
930654236 2:53992324-53992346 CTGATTAAAAACTTGTCTATAGG - Intronic
931165547 2:59743635-59743657 CTCATTAAAAGCCTGTATTTAGG + Intergenic
931981735 2:67700363-67700385 CTCTTTCAACAGCTATTTATGGG - Intergenic
933866307 2:86521247-86521269 CTCATACAAAGCCTGTTTGGTGG + Intronic
934888321 2:98044578-98044600 CTCACACAAAGCCTGTTTAGTGG - Intergenic
935314782 2:101821173-101821195 CTCATTCAAACCCTGCATATAGG - Intronic
935701274 2:105814148-105814170 CTTATTCAAAACCTGTGTTAAGG - Intronic
936175672 2:110218285-110218307 CTCACACAAAGCCTGTTTACTGG + Intergenic
936466299 2:112754267-112754289 TTCATTCAAAACTTAGTTATTGG - Intronic
936793753 2:116183776-116183798 CTCACACAAAGCCTGTTTAGTGG - Intergenic
936870553 2:117130949-117130971 CTCATACAAAGCCTGTTTGGTGG + Intergenic
937026111 2:118699095-118699117 CTCATTCAAAACATGCTTATAGG + Intergenic
938684671 2:133726545-133726567 CTCATTTAAAAACTGATTTTTGG - Intergenic
938864020 2:135399735-135399757 CTCATTCAAAAGCATGTTATTGG - Intronic
940595490 2:155786919-155786941 CTCATTCAAGACCAGTTGATTGG + Intergenic
941045324 2:160668978-160669000 CTGATTCCCAAACTGTTTATTGG + Intergenic
941328841 2:164151126-164151148 CTCAATTCAAATCTGTTTATTGG - Intergenic
941464384 2:165808592-165808614 TTCATTCAAAAACTATTTGTGGG + Intergenic
941485264 2:166072415-166072437 CGCATTCAAATATTGTTTATAGG + Intronic
941846078 2:170134843-170134865 CTCCTTCTATACCTGTTTATTGG - Intergenic
943278011 2:185893015-185893037 CTTTTTCAGCACCTGTTTATTGG - Intergenic
943562380 2:189479072-189479094 ATCATTTAAAACTTGGTTATAGG - Intergenic
943864890 2:192916797-192916819 CTCACACAAAACCTGTTTGGTGG + Intergenic
944904698 2:204251126-204251148 CTCAGCCAAAAGCTGTTTCTGGG - Intergenic
945360816 2:208894122-208894144 CTCACACAAAACCTGTTTGGTGG + Intergenic
945760293 2:213905549-213905571 TTGATTCAACAGCTGTTTATTGG + Intronic
946214554 2:218174043-218174065 CTCACACAAAACCTGTTTGTTGG - Intergenic
946813622 2:223553154-223553176 CTCATTCAGCACATATTTATTGG + Intergenic
947066981 2:226238425-226238447 CTTATTTTAAACATGTTTATGGG + Intergenic
947775205 2:232703113-232703135 TTCATTCAAAACCCCATTATAGG - Intronic
947817948 2:233050662-233050684 TTAATTCAACACATGTTTATTGG + Intergenic
1169332621 20:4728775-4728797 CTCATTCTAAACCTGGTCCTTGG + Intergenic
1169721250 20:8679103-8679125 CTCAGTAAAAACGTGTTCATTGG + Intronic
1171155537 20:22869534-22869556 CTCATTCAAAAACTCGTTTTAGG - Intergenic
1171265099 20:23765131-23765153 CTCACACAAAGCCTGTTTAGTGG + Intergenic
1173436829 20:43040879-43040901 CTCATTCAAAGACTGTCTGTTGG + Intronic
1174708427 20:52680546-52680568 GTCATTCAAAAGATGTGTATTGG - Intergenic
1174881330 20:54282413-54282435 CTTATTCAAGACATATTTATTGG - Intergenic
1175137757 20:56837786-56837808 CTCAAACACAACCTGTCTATTGG - Intergenic
1177046830 21:16181527-16181549 CTCATTCAAAAACTTCCTATAGG - Intergenic
1177884763 21:26734295-26734317 CTCACACAAAACCTGTTTGGTGG - Intergenic
1178001695 21:28166879-28166901 CTCACACAAAACCTGTTTGGTGG + Intergenic
1178420666 21:32440797-32440819 TTCATTCAAGAGCTGTTCATTGG + Intronic
1179650621 21:42806155-42806177 CTCATACAAAGCCTGTTTGGTGG - Intergenic
1179893018 21:44346673-44346695 CTCACTCAAAGCCTGTTTGATGG + Intergenic
1180892440 22:19299568-19299590 CTCATGCAAAATCTGGTTAAAGG + Intergenic
1181744146 22:24944113-24944135 CTCATTCAACAAATATTTATTGG + Intronic
1182663672 22:31942809-31942831 CACATTCAAATCCTGTTTCATGG + Intronic
1182732777 22:32508456-32508478 CTCACACAAAGCCTGTTTAGTGG + Intergenic
1182954990 22:34415751-34415773 TTCATTCAAAAGGTATTTATTGG + Intergenic
1182999177 22:34840734-34840756 CTCACACAAAACCTGTTTAGTGG - Intergenic
1184197069 22:42937013-42937035 TTCTTTCAACACCTGTATATTGG + Intronic
949181005 3:1131392-1131414 CTCATTCAAAGGCTGCTTAGGGG + Intronic
950257087 3:11514295-11514317 CTCTTGCAAATCCTGATTATGGG - Intronic
950571384 3:13802280-13802302 CTCATTCAATAAGTATTTATTGG + Intergenic
951066717 3:18275618-18275640 CTCACTCTAACCCTATTTATTGG + Intronic
951331747 3:21377925-21377947 CTCACACAAAGCCTGTTTGTTGG - Intergenic
951338664 3:21457121-21457143 CTCATTCAAGAAATATTTATTGG - Intronic
952296573 3:32067881-32067903 CTCACACAAAGCCTGTTTAGTGG + Intronic
955319570 3:57964605-57964627 CTCATTAAAAACTTGATTAGAGG + Intergenic
956040013 3:65135752-65135774 TTCATTCACTGCCTGTTTATGGG + Intergenic
956868469 3:73392330-73392352 CTCACTTAAAACCTTTTGATGGG - Intronic
957051036 3:75412125-75412147 TTCATTCAAGAACTGTTCATTGG - Intergenic
957863936 3:85998011-85998033 CTCAATGAAAACCTTTTCATGGG - Intronic
959180708 3:102976206-102976228 CTCATTCAAAAAATGTATATTGG - Intergenic
959729777 3:109588628-109588650 CCCATTCAAAACCTCAATATCGG + Intergenic
959855502 3:111151251-111151273 CTCATTCAAAACCTGTTTATCGG - Intronic
959916670 3:111824196-111824218 CAGATAAAAAACCTGTTTATAGG - Intronic
961712177 3:128836108-128836130 CTCACACAAAGCCTGTTTGTTGG - Intergenic
961883330 3:130078551-130078573 TTCATTCAAGAACTGTTCATTGG - Intergenic
963294790 3:143534044-143534066 TTCACTTAAAAACTGTTTATGGG + Intronic
963548201 3:146687221-146687243 CTTTTTAAAAACGTGTTTATTGG + Intergenic
963800034 3:149667072-149667094 TTCAATCAAACCCTGATTATTGG + Intronic
964050074 3:152380506-152380528 CTCTTTCAATACCTCTTTAGGGG - Intronic
964375566 3:156045364-156045386 CTCATACAAAGCCTGTTTGGTGG - Intronic
964439096 3:156686654-156686676 CTGAGTAAAAACCTTTTTATGGG + Intronic
964511772 3:157460419-157460441 CTCATTCAAAAAATATTTATTGG + Intronic
965336041 3:167431641-167431663 CTCACACAAAGCCTGTTTAGGGG + Intergenic
965336859 3:167437085-167437107 CTCACACAAATCCTGTTTAGTGG + Intergenic
965700096 3:171451791-171451813 TTCATTCAGTACCTGATTATTGG - Intronic
965703643 3:171483879-171483901 CTCCTTAAAAACCACTTTATTGG + Intergenic
967005621 3:185379627-185379649 CTCACACAAAGCCTGTTTAGTGG - Intronic
967211665 3:187175527-187175549 CTCATACAAAGCCTGTTTGGTGG - Intronic
967603696 3:191418696-191418718 CACATTGAAAACCTGTTGTTTGG - Intergenic
970205875 4:13655035-13655057 CTCATTAACATGCTGTTTATTGG - Intergenic
970226192 4:13859629-13859651 TTCATTCAAAAAATATTTATTGG - Intergenic
970256688 4:14175549-14175571 CTCATACAAAGCCTGTTTGGTGG - Intergenic
971449357 4:26786054-26786076 CTCTTTCAAAACCTTTTGACAGG - Intergenic
972011974 4:34194401-34194423 ATCATTCAAACCCTGCATATAGG + Intergenic
972070787 4:35018087-35018109 CTCACACAAATCCTGTTTAGTGG - Intergenic
972952576 4:44346295-44346317 CTCATTCAAAAGATATTTATTGG + Intronic
973257182 4:48125334-48125356 CTCATTCAGCAACTATTTATTGG + Intronic
973944875 4:55945980-55946002 CTCACACAAAACCTGTTTGGTGG + Intergenic
974486730 4:62514803-62514825 CTCACACAAAACCTGTTTGGTGG + Intergenic
975089053 4:70378752-70378774 CTCACACAAAGCCTGTTTGTTGG + Intronic
975544869 4:75550118-75550140 TTCATTCAACAACTATTTATTGG - Intronic
977224778 4:94382948-94382970 CTCACACAAAGCCTGTTTAGTGG - Intergenic
977379234 4:96249952-96249974 CACATTCAAAAACTGTTTTTTGG + Intergenic
977446822 4:97141317-97141339 CTCACACAAAACCTGTTTGGTGG - Intergenic
978008083 4:103643297-103643319 ATCATTGAAAAACTTTTTATTGG + Intronic
978303474 4:107295499-107295521 CTCATACAAAGCCTGTTTGATGG - Intergenic
978497065 4:109370944-109370966 CTCAATCAGAATCTGTTAATTGG - Intergenic
978668302 4:111212902-111212924 GTCATTCAATAAATGTTTATTGG - Intergenic
978970456 4:114797778-114797800 CTCATTCAACAACTCTTTCTGGG + Intergenic
980471909 4:133263586-133263608 CTCACACAAAACCTGTTTGGTGG - Intergenic
981525547 4:145703458-145703480 CTCACACAAAACCTGTTTGGTGG + Intronic
981547775 4:145911845-145911867 TTCATTCAACAAATGTTTATTGG - Intronic
982791372 4:159595370-159595392 CTCACACAAAGCCTGTTTTTTGG + Intergenic
983415013 4:167441102-167441124 CTCACACAAAACCTGTTTGGTGG - Intergenic
983953664 4:173672549-173672571 TTCACTCAACACATGTTTATTGG + Intergenic
984222092 4:176991248-176991270 CTCATTAAATACCTGTTGAGTGG + Intergenic
984321866 4:178207486-178207508 CTCACACAAAACCTGTTTGGTGG + Intergenic
985078459 4:186241981-186242003 CTCACACAAAGCCTGTTTAGTGG - Intronic
985372702 4:189303129-189303151 CCCATTCAGAACCTGCTCATAGG + Intergenic
986388462 5:7262697-7262719 CTCACACAAAACCTGTTTGATGG + Intergenic
986792037 5:11171273-11171295 CTCATTCATTACCTGTCCATGGG - Intronic
987701925 5:21411219-21411241 CTCAATCAAGAGCTGTTTGTTGG - Intergenic
987755475 5:22095016-22095038 CTCACACAAAGCCTGTTTAGTGG + Intronic
987870958 5:23615880-23615902 TACATTCAAAACATGTTTGTTGG + Intergenic
989073275 5:37534263-37534285 CCCATTCAAAACCTTTTAAATGG - Intronic
989477108 5:41886819-41886841 CTAATTCAAAAACTATTTAAAGG - Intergenic
992343355 5:75849153-75849175 CTCACTCAACAACTATTTATTGG - Intergenic
995123000 5:108554973-108554995 CTCACACAAAGCCTGTTTAGTGG + Intergenic
995407511 5:111816163-111816185 CTTATTCAAAAACTTTTTTTTGG - Intronic
995879025 5:116822616-116822638 CTCACTCAAAGCCTGTTTGATGG + Intergenic
995890705 5:116947444-116947466 CTCACACAAAACCTGTTTGGTGG + Intergenic
996309056 5:122082307-122082329 CTCATACAAAGCTTGTTTTTTGG + Intergenic
996455959 5:123681210-123681232 CTCTTTCAAAAATTTTTTATAGG - Intergenic
996528524 5:124502694-124502716 CTCACACAAAGCCTGTTTAGTGG + Intergenic
997129876 5:131265511-131265533 TTCATTAAGCACCTGTTTATGGG + Intronic
997770846 5:136551595-136551617 CTCACACAAAACCTGTTTGGTGG - Intergenic
997851895 5:137340328-137340350 CTCAGTGAAGACCTGTTTATTGG - Intronic
998928875 5:147158106-147158128 CTCATTCAAAATGAGTTTACTGG + Intergenic
1000022493 5:157330693-157330715 GTCATTCACAATCTGTTTACTGG + Intronic
1000432976 5:161173022-161173044 TTCATTCAACTCCAGTTTATTGG + Intergenic
1000764770 5:165273462-165273484 CTCTTTCAAAACCTTATTACTGG + Intergenic
1001243101 5:170085065-170085087 GACTTTCAAACCCTGTTTATGGG - Intergenic
1005132440 6:22524554-22524576 GTTATTCAAGACCTGTGTATCGG - Intergenic
1005297055 6:24436974-24436996 CTCATTCAAGATCTGTCTAAAGG + Intronic
1005595815 6:27378279-27378301 CTCACACAAAGCCTGTTTAGTGG - Intronic
1006277180 6:33014439-33014461 TTCATTAAATACATGTTTATAGG + Intergenic
1007252383 6:40504707-40504729 CTCACTCCACACCTGTTTCTTGG - Intronic
1007300092 6:40861421-40861443 CTCATACAAAGCCTGTTTGGTGG - Intergenic
1008476241 6:51938642-51938664 CTCATACAAAACCTGTTTGGTGG + Intronic
1008778100 6:55065622-55065644 CTCATTCAGCACCTGTAGATAGG + Intergenic
1008850602 6:56016411-56016433 CTCACACAAAGCCTGTTTAGTGG - Intergenic
1009993743 6:70876708-70876730 CTCATTCAGAAGCTCTTTAGGGG + Intronic
1010074583 6:71785533-71785555 CCCATTCACATCCTGCTTATTGG - Intergenic
1010498156 6:76561380-76561402 CTCACACAAAACCTGTTTGGTGG + Intergenic
1011709256 6:90035338-90035360 CTCATTTAAATACTGGTTATGGG - Intronic
1011758616 6:90532983-90533005 TGGATTCAAAACCTGGTTATAGG + Intronic
1011771169 6:90675015-90675037 CTCACACAAAGCCTGTTTAGTGG - Intergenic
1012316312 6:97785280-97785302 CTCACACAAAGCCTGTTTAGTGG + Intergenic
1012817236 6:104039567-104039589 CTCCTACAAAACCTGTTATTTGG - Intergenic
1012842861 6:104352048-104352070 CTCACTCTATACCTGTTTCTTGG - Intergenic
1013407400 6:109855798-109855820 CTCATACAAAGCCTGTTTGGTGG - Intergenic
1013844042 6:114427870-114427892 CTCACACAAAACCTGTTTGGTGG - Intergenic
1014221630 6:118804242-118804264 CTCATTCAACAAATATTTATCGG + Intergenic
1014611815 6:123557210-123557232 CTCACTCAAAGCCTGTTTGGTGG + Intronic
1015241042 6:131023931-131023953 CTCATTCAGGATCTGTGTATTGG + Intronic
1015278635 6:131408497-131408519 CTCACACAAAACCTGTTTGGTGG + Intergenic
1016256648 6:142114170-142114192 CTCATTCAAATCCTCTTTTCTGG - Intergenic
1017269542 6:152490697-152490719 CTCACACAAAGCCTGTTTGTTGG + Intronic
1017711976 6:157178169-157178191 CTCGGTGAAATCCTGTTTATAGG + Intronic
1018396843 6:163384492-163384514 CTCATTCAAAGTCTGTTCAACGG - Intergenic
1019816546 7:3205224-3205246 ATCATTCAACACTTGTTTTTTGG - Intergenic
1019881067 7:3861625-3861647 CTCATTCAAAACCTTATTTGGGG + Intronic
1019997899 7:4736712-4736734 CCAGTTCAAAACCTGATTATGGG - Intronic
1020316473 7:6908947-6908969 CTCACACAAAACCTGTTTGGTGG + Intergenic
1020317350 7:6915285-6915307 TTCATTCAAGAACTGTTCATTGG - Intergenic
1020532223 7:9353428-9353450 CTCACACAAAGCCTGTTTGTTGG - Intergenic
1021229647 7:18070721-18070743 ACCATTTAAAAGCTGTTTATTGG + Intergenic
1021393343 7:20121120-20121142 CTCACACAAAGCCTGTTTAATGG + Intergenic
1021637870 7:22709268-22709290 CTCACACAAAGCCTGTTTAGTGG + Intergenic
1022447966 7:30485236-30485258 CTCATGCAAAGCCTGTTTGGTGG + Intergenic
1022709592 7:32838226-32838248 CTCACACAAAGCCTGTTTGTTGG + Intergenic
1023131147 7:37004779-37004801 CTATTTAAAAACCTGTTTAAAGG - Intronic
1024906730 7:54391210-54391232 CTAATTCAAAACTTATTTAAAGG - Intergenic
1026220130 7:68388932-68388954 CTCACACAAAGCCTGTTTAGTGG - Intergenic
1026528259 7:71174473-71174495 CTCACACAAAGCCTGTTTAGTGG - Intronic
1028510634 7:91621598-91621620 GTTATTCAACACCTGTTTGTTGG - Intergenic
1030288721 7:107851163-107851185 GTCATTCAATAACTATTTATTGG + Intergenic
1030446024 7:109647189-109647211 CTCATACAAAGCCTGTTTGGTGG - Intergenic
1030641716 7:112013684-112013706 CTCATACAAAACCTGTTTGCTGG - Intronic
1030842613 7:114374785-114374807 TTCATTCAAAAGCTATTTACAGG - Intronic
1031364293 7:120885723-120885745 CTCACACAAAGCCTGTTTAGTGG - Intergenic
1031837473 7:126695717-126695739 GTCTTTCAATACCTTTTTATTGG - Intronic
1031843279 7:126772978-126773000 CACATTCAATTCCTGCTTATTGG - Intronic
1032804993 7:135344658-135344680 CTCATTCAAGAACTGTTGTTGGG - Intergenic
1033080830 7:138295635-138295657 CCCATTTAAAATCAGTTTATGGG + Intergenic
1033345022 7:140519832-140519854 CTGATTCAGAGCATGTTTATAGG - Intronic
1034029308 7:147742611-147742633 CTTATTCAAAGCCTGATTCTTGG - Intronic
1034631020 7:152530614-152530636 CTGATGCAAAACCTTTTTTTAGG + Intergenic
1035599435 8:888900-888922 CTCACACAAAACCTGTTTGGTGG - Intergenic
1036070404 8:5436489-5436511 CTCACACAAAGCCTGTTTAGTGG - Intergenic
1036493100 8:9245907-9245929 TTCATTCAATGACTGTTTATTGG + Intergenic
1038377455 8:27056214-27056236 CAAATTCAAAACCTGGTTCTTGG + Intergenic
1038905436 8:31897073-31897095 CCCATTCAAATTCTGTTTCTAGG + Intronic
1039399580 8:37257910-37257932 TTCATTCAACAACTATTTATTGG - Intergenic
1040620490 8:49086398-49086420 CTCATTAAAACCATGTCTATAGG - Intergenic
1041563392 8:59247101-59247123 CTCTTTAAAATCATGTTTATTGG + Intergenic
1042419956 8:68575634-68575656 CTCATCCTAAACCTGTTTGGAGG + Intronic
1042705825 8:71664981-71665003 CTCACACAAAGCCTGTTTAGTGG + Intergenic
1042729557 8:71917062-71917084 TTCACTCAAACCCTGTGTATGGG - Intronic
1045109711 8:98928846-98928868 CTCATTCTAAACCTGTTATCAGG - Intronic
1046540548 8:115575824-115575846 ATCATTCAAACTCTGTTTAATGG - Intronic
1048135168 8:131741106-131741128 CTCACACAAAGCCTGTTTAGTGG + Intergenic
1048345878 8:133573830-133573852 TTCATCCAAAAACTCTTTATTGG - Intergenic
1048848397 8:138621068-138621090 CTCATTCAAAGTTTGTATATGGG - Intronic
1049448697 8:142645943-142645965 CTCATTCAAAGCTTATTTAAAGG - Intergenic
1049868289 8:144953942-144953964 CTCACACAAAACCTGTTTGGTGG - Intergenic
1050114643 9:2251083-2251105 TTCATTCAACAAATGTTTATTGG - Intergenic
1050735472 9:8757320-8757342 CTCATTCAAACCATGTATTTGGG - Intronic
1050896594 9:10890662-10890684 CTCACACAAAGCCTGTTTAGTGG + Intergenic
1050896605 9:10890759-10890781 CTCACACAAAGCCTGTTTAGTGG + Intergenic
1050966305 9:11807647-11807669 CTCAATCAAAAACTGTTTCAGGG - Intergenic
1051756196 9:20403434-20403456 CTCCTTCAAATCTTGTTTTTTGG + Intronic
1052547751 9:29902392-29902414 CTCATACAAAGCCTGTTTGGTGG - Intergenic
1052716008 9:32118233-32118255 TTCATTCAACAAATGTTTATTGG + Intergenic
1056676853 9:88683165-88683187 TTCATTCAAAACCTTTTGGTAGG + Intergenic
1057779182 9:98035877-98035899 CTCATTCAGAAAATATTTATTGG + Intergenic
1057909934 9:99011581-99011603 CTCATTCAAAGCTTATTTAAAGG - Intronic
1058600549 9:106665204-106665226 CTGATTCAAAAGCTGTATCTTGG + Intergenic
1185586579 X:1245689-1245711 CTCATTAATAACCCGTTTATAGG - Intergenic
1185956302 X:4494737-4494759 GTCATTCAGAACATGTTTATGGG - Intergenic
1186531406 X:10299455-10299477 CTAATTCAACATATGTTTATGGG + Intergenic
1186892017 X:13968264-13968286 CTCATTCCAAAGCAATTTATTGG + Intergenic
1187667034 X:21625340-21625362 GCCATTCAAAATCTGTTTAAAGG + Intronic
1188333296 X:28897737-28897759 CTCACACAAAACCTGTTTGGTGG - Intronic
1188344201 X:29044129-29044151 ATCATTTAAAACATATTTATGGG + Intronic
1189116364 X:38347068-38347090 CTAGTTCAGAACCTATTTATTGG - Intronic
1189472394 X:41324068-41324090 CTTATTCAAGAGATGTTTATTGG - Intergenic
1189634912 X:42996854-42996876 TTCATTCAATACTTATTTATTGG - Intergenic
1190321593 X:49183200-49183222 CTCATTCAACACATAGTTATGGG - Intronic
1193144735 X:78064994-78065016 CTCAGTCAAAAGCTCATTATAGG - Intergenic
1193536808 X:82727150-82727172 CTCACACAAAACCTGTTTGGTGG + Intergenic
1194060600 X:89191924-89191946 CTCATACAAAGCCTGTTTGGTGG + Intergenic
1194424896 X:93724678-93724700 CTCATTCAACACATATATATAGG + Intergenic
1194534795 X:95093082-95093104 CTCACACAAAACCTGTTTGGTGG + Intergenic
1194610492 X:96036822-96036844 CTCTGCCAAAACCTCTTTATTGG + Intergenic
1194822275 X:98524269-98524291 CTCACACAAAGCCTGTTTAGTGG - Intergenic
1195492262 X:105484828-105484850 GTCATTTAAAACTTGTTTTTAGG + Intronic
1196226617 X:113176156-113176178 CTCATACAAAGCCTGTTTGGTGG - Intergenic
1196470165 X:116014789-116014811 CTCACACAAAGCCTGTTTGTTGG + Intergenic
1197134268 X:123042486-123042508 TTCATTCAAGAGATGTTTATTGG - Intergenic
1197359880 X:125487871-125487893 CTGATTCTAAACATTTTTATGGG - Intergenic
1197932766 X:131712401-131712423 CTCACACAAAGCCTGTTTAGTGG + Intergenic
1198300277 X:135327651-135327673 CTCATGCAAAATCTGTTAACAGG + Intronic
1198685078 X:139220232-139220254 CTCACTCAACACATATTTATTGG - Intronic
1198966534 X:142233011-142233033 CTCACACAAAACCTGTTTGGTGG + Intergenic
1199213333 X:145239703-145239725 CTCATTCAATAAATATTTATTGG + Intergenic
1199581266 X:149362720-149362742 CTCATGGTAAACCTCTTTATAGG + Intergenic
1201744689 Y:17358988-17359010 GTCATTCAGGACATGTTTATGGG - Intergenic
1201936117 Y:19412419-19412441 CTCACACAAAGCCTGTTTAGTGG + Intergenic
1201937970 Y:19427693-19427715 CTCACACAAAGCCTGTTTAGTGG + Intergenic
1202062537 Y:20902946-20902968 CTCATACAAAGCCTGTTTGGTGG - Intergenic