ID: 959856264

View in Genome Browser
Species Human (GRCh38)
Location 3:111162314-111162336
Sequence CCAGGTCCTTCCCATGATGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 406
Summary {0: 1, 1: 2, 2: 17, 3: 68, 4: 318}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959856264_959856276 30 Left 959856264 3:111162314-111162336 CCCACATCATGGGAAGGACCTGG 0: 1
1: 2
2: 17
3: 68
4: 318
Right 959856276 3:111162367-111162389 TCCCCATGCTGCTGTTCTTGTGG 0: 1
1: 2
2: 14
3: 31
4: 232
959856264_959856274 1 Left 959856264 3:111162314-111162336 CCCACATCATGGGAAGGACCTGG 0: 1
1: 2
2: 17
3: 68
4: 318
Right 959856274 3:111162338-111162360 GGGAGGTAACTGAATCATGGGGG 0: 617
1: 4140
2: 7141
3: 9563
4: 9963
959856264_959856272 -1 Left 959856264 3:111162314-111162336 CCCACATCATGGGAAGGACCTGG 0: 1
1: 2
2: 17
3: 68
4: 318
Right 959856272 3:111162336-111162358 GTGGGAGGTAACTGAATCATGGG 0: 656
1: 4093
2: 7335
3: 9736
4: 9769
959856264_959856271 -2 Left 959856264 3:111162314-111162336 CCCACATCATGGGAAGGACCTGG 0: 1
1: 2
2: 17
3: 68
4: 318
Right 959856271 3:111162335-111162357 GGTGGGAGGTAACTGAATCATGG 0: 313
1: 2764
2: 6496
3: 9801
4: 10403
959856264_959856273 0 Left 959856264 3:111162314-111162336 CCCACATCATGGGAAGGACCTGG 0: 1
1: 2
2: 17
3: 68
4: 318
Right 959856273 3:111162337-111162359 TGGGAGGTAACTGAATCATGGGG 0: 659
1: 4140
2: 7325
3: 9722
4: 10207
959856264_959856275 5 Left 959856264 3:111162314-111162336 CCCACATCATGGGAAGGACCTGG 0: 1
1: 2
2: 17
3: 68
4: 318
Right 959856275 3:111162342-111162364 GGTAACTGAATCATGGGGGCAGG 0: 260
1: 1792
2: 2678
3: 2767
4: 2418

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959856264 Original CRISPR CCAGGTCCTTCCCATGATGT GGG (reversed) Intronic
901305140 1:8227347-8227369 CCAGGCCCTTCCCATCTTCTAGG - Intergenic
901376003 1:8840045-8840067 CCAGGTCCCTCCCACGACATAGG - Intergenic
902674184 1:17997046-17997068 CCAGGTCTCTCCCATGACATGGG + Intergenic
902730337 1:18364846-18364868 CCAGGTGGTTGCCATGGTGTAGG + Intronic
902939979 1:19793987-19794009 CAAGGTCCTTACAATGATGATGG + Intronic
903002207 1:20274295-20274317 CCAGGGTCTTCCCATGCTTTTGG - Intergenic
903164637 1:21511569-21511591 CCAGGCCCTTCCCATCCTGTTGG + Intronic
903734799 1:25523304-25523326 CCACATCCTTCCCATGAGGCGGG + Intergenic
905095137 1:35463796-35463818 CCAGGTTCCTCCCATGAGGTGGG - Intronic
905302914 1:36997789-36997811 CTTGGTCCTTTCCAGGATGTGGG - Intronic
906580369 1:46930723-46930745 TCAGGTGCTTCCCATGTAGTGGG + Intronic
908068760 1:60435379-60435401 CTGGGTCCCTCCCATGATGTGGG + Intergenic
908889881 1:68834165-68834187 CCAGGTCTCTCCCTTGACGTGGG + Intergenic
909228896 1:73060845-73060867 CCAGGTCCCTCCCACGACATGGG - Intergenic
909414993 1:75396089-75396111 CCAGGTCCTACTCATGCTGCTGG + Intronic
909818575 1:80028353-80028375 ATAGGTCCTTCCCATGCTGAAGG - Intergenic
910538210 1:88324051-88324073 CCAGGTCCCTCCCATGATGGTGG + Intergenic
911167728 1:94739566-94739588 CCAGGTTCTTCCCAGGATCTGGG - Intergenic
911407643 1:97462802-97462824 CCAGGTCTTTTCCCTGATCTAGG + Intronic
911997742 1:104788317-104788339 GCAGCTGCTTCCCATAATGTGGG + Intergenic
912560272 1:110546569-110546591 CAAGGTCCTTTCAATGATGCTGG + Intergenic
913239674 1:116819268-116819290 CTGGGTTTTTCCCATGATGTTGG + Intergenic
913710144 1:121474473-121474495 CTGGGTCCCTCCCATGATGTGGG + Intergenic
914988292 1:152478161-152478183 CCAGGTCCCTCCAATGACATGGG + Intergenic
915106443 1:153537592-153537614 CCAGGCCCTTCCCTAGGTGTGGG - Intronic
915917094 1:159946704-159946726 CCAGGTCCTTCCCATTCAGTTGG + Intergenic
916384953 1:164256421-164256443 CCAGGTCCCTCCCTCAATGTTGG - Intergenic
916869790 1:168901250-168901272 CCAGGTGCTACCCAAGTTGTGGG - Intergenic
918308418 1:183267871-183267893 CCTGATCCTGCCCATGGTGTGGG - Intronic
919522035 1:198600546-198600568 CCAGGTCCCTCCCCCAATGTCGG - Intergenic
920031548 1:203040373-203040395 CCAGGCCCTTCCCAGTGTGTGGG + Intronic
920961541 1:210668375-210668397 CCGGGTCCTTCCCATGACCATGG - Intronic
921272289 1:213483274-213483296 CTGGGTCCCTCCCATGACGTGGG + Intergenic
921716183 1:218419115-218419137 CCAAGTCCTTACCATGACTTAGG + Intronic
923179318 1:231500532-231500554 CCAGGTCCCTCCCACGACATAGG + Intergenic
923932675 1:238720732-238720754 CCAGGTCCCTCCCATAACATTGG + Intergenic
924394881 1:243607787-243607809 CCAGGGCCCTCCCATGACATGGG - Intronic
1065707539 10:28484514-28484536 CCAGGTCCCTCCCATGACACTGG + Intergenic
1067410522 10:46060439-46060461 CCAGTTCCTCCCCAGGATGAAGG + Intergenic
1067743118 10:48912032-48912054 CCAGGACTTTCCTATGTTGTTGG - Intronic
1068583388 10:58768054-58768076 CCATATCTTTCCCATGATATGGG - Intronic
1069173765 10:65263909-65263931 CCAGGTTCCTCCCATGATGTGGG + Intergenic
1070871867 10:79761618-79761640 CTATGTCCTTCTCAGGATGTTGG - Intergenic
1070913527 10:80137977-80137999 CAAGGGCCTTCTCAGGATGTGGG + Intronic
1071656454 10:87454162-87454184 CTATGTCCTTCTCAGGATGTTGG + Intergenic
1071751160 10:88477716-88477738 CCATGACCTTCCTATGAGGTGGG + Intronic
1073130004 10:101182131-101182153 CCAGTTCCTGCCCATGAAGGGGG - Intergenic
1073540032 10:104310627-104310649 CCATGTCAGTCCTATGATGTAGG - Exonic
1075219313 10:120570783-120570805 CCAGGTCCATCCCATGAACAGGG - Intronic
1076448122 10:130532619-130532641 CCAGGTCCCTCCCCTGACATTGG + Intergenic
1076739661 10:132477062-132477084 CCAGCTCCTCCCCAGGCTGTCGG - Intergenic
1077667917 11:4131303-4131325 CCAGGTCCCTCCCGTAACGTGGG + Intronic
1078370729 11:10742572-10742594 CCAGGTGCTGCCCATGCTGCTGG - Intergenic
1078418773 11:11189389-11189411 CCAGGCCCCTCCTCTGATGTGGG + Intergenic
1078857383 11:15217324-15217346 CCAGGTCCCTCTCATGACATGGG + Intronic
1079519551 11:21309864-21309886 CTGGGTTCCTCCCATGATGTGGG + Intronic
1079656256 11:22989309-22989331 CCAAGTTCATCCCATGATGTGGG + Intergenic
1080850283 11:36062592-36062614 CCAGGTCCCTCCCATGACGTGGG - Intronic
1081155042 11:39680024-39680046 GCTGCTCCTTCCCATCATGTGGG + Intergenic
1081525996 11:43928187-43928209 CCAGCTCCTACGCCTGATGTGGG - Intronic
1082742240 11:56923840-56923862 CCAGGTCCCTCCCTTGACATGGG + Intergenic
1083488317 11:62997071-62997093 CCAGGCCCTTGCCATGGTTTTGG - Intronic
1084214318 11:67639349-67639371 CCAGGTCCTTCACAAGAGGGTGG - Intronic
1084687356 11:70704398-70704420 CCAGGACCTTCCCATGGGGAAGG - Intronic
1085463238 11:76707659-76707681 CCAGGCCCGCCCCATGGTGTTGG - Intergenic
1085811200 11:79682934-79682956 CCAGGTCCCTCCCTTGACATGGG - Intergenic
1087619299 11:100524141-100524163 TCATGTCCTTCCCAAGATTTGGG - Intergenic
1087887281 11:103495330-103495352 CCAGTTCCTGCCCATGAAGGGGG + Intergenic
1088117919 11:106333584-106333606 CCAGGTCCCTCCCCTGACATTGG + Intergenic
1088756234 11:112887481-112887503 CCAGGTCCTTGCTGTGATGGAGG + Intergenic
1088801975 11:113314706-113314728 CCAAGACCTTCCCATGCTCTGGG - Intronic
1090583496 11:128185125-128185147 CTGGGTCCCTCCCATGACGTGGG - Intergenic
1092993185 12:13923027-13923049 CCAGGTGCTTCCAAGGATGTAGG - Intronic
1094246003 12:28294336-28294358 CCAGGTCCCTCCCTTGACATGGG - Intronic
1094266557 12:28566381-28566403 CCGGGTCCCTCCCATGATGTGGG + Intronic
1094767696 12:33617264-33617286 CCAGGTCCCTCCAATGACGTGGG - Intergenic
1095144585 12:38710699-38710721 ACTAGTCCTTCCCATAATGTGGG + Intronic
1096135908 12:49200364-49200386 CCACGTCCTCCCCTTGATGTAGG - Intronic
1096174178 12:49501282-49501304 CAAGGTCCTTGCCAAGATGTGGG - Intronic
1097274013 12:57799178-57799200 CCAGCACCTTCTCATCATGTAGG - Intronic
1097315824 12:58170702-58170724 CCAGGTCCCTCCCATGATGTGGG - Intergenic
1098592456 12:72229424-72229446 CAAGGTCCCACTCATGATGTGGG + Intronic
1099765791 12:86981693-86981715 CCAGGTCCTTCCCTTGACACAGG - Intergenic
1100201822 12:92306793-92306815 CCAGGTCCTTTCCAAGACGTGGG - Intergenic
1100747637 12:97662870-97662892 CCAGGTCCCTCCCATGACGTGGG + Intergenic
1100933748 12:99639555-99639577 CTGGGTCCCTCCCATGACGTGGG - Intronic
1101336215 12:103799325-103799347 CCAGGTCCCTCCCACAATCTGGG - Intronic
1101469558 12:104983956-104983978 CCAGTTCCTGCCCATGAAGGGGG - Intergenic
1101684344 12:107002731-107002753 CAGGGTCCCTCCCATGATGTGGG - Intronic
1102896708 12:116603919-116603941 TCATGTGCTTCCCATGAAGTGGG - Intergenic
1102956659 12:117063406-117063428 CCTGGTCCTTCCCTTCTTGTTGG - Intronic
1103002923 12:117399421-117399443 CCAGGTCCCTCCCACAACGTGGG + Intronic
1103403682 12:120660074-120660096 CCAGGAGCTTCCCAGGATGCTGG - Intronic
1103559344 12:121784613-121784635 TCAGGTTCTTCCTATGTTGTGGG - Intronic
1105074089 12:133260121-133260143 CCAGGTCCTTCCCCTAACATTGG + Intergenic
1106229773 13:27812902-27812924 CCCTGTCCTTCCCATCATTTTGG - Intergenic
1107515627 13:41125978-41126000 CCGGGTCCCTCCCATGATGTGGG - Intergenic
1109416711 13:62050546-62050568 CCAGATCCCTCCTATGACGTGGG - Intergenic
1109681999 13:65763734-65763756 CCAGGTCCCTTCCTTGACGTGGG + Intergenic
1111172308 13:84543298-84543320 CCGGGTCCCTCCCATGACATGGG + Intergenic
1111510681 13:89258015-89258037 CCAGGTCCCTCCCATGACGTGGG - Intergenic
1111791234 13:92858173-92858195 CCAGGTCCCTCCCATGACACAGG - Intronic
1112073649 13:95883488-95883510 CCAGGCCCCTCCCCTGACGTGGG - Intronic
1112325636 13:98441271-98441293 CCAGCTCCTCCCCATCATGAGGG + Intronic
1112792868 13:103022499-103022521 CCAGGTCAGTCCCAGGATCTTGG + Intergenic
1112984621 13:105432723-105432745 CCAAATCCTTCCCATGGTCTTGG + Intergenic
1113642407 13:111967215-111967237 CCATGGCCTTCCCAGGATGGTGG - Intergenic
1114931774 14:27478791-27478813 TCAGGTCCTTCTAATTATGTTGG - Intergenic
1114948262 14:27714817-27714839 CGGGGTCCTTCCCATAACGTGGG - Intergenic
1115744931 14:36427059-36427081 CCAGGCCTCTCCCTTGATGTAGG + Intergenic
1116316545 14:43402793-43402815 CGAGGTTCCTCCCATGACGTGGG + Intergenic
1116664675 14:47759601-47759623 GCAGGTCTTTCCCATGGTGTTGG - Intergenic
1117703907 14:58443120-58443142 CAAGGTGTTTCCCAGGATGTAGG - Intronic
1117854054 14:60009497-60009519 CTGGGTCCCTCCCATGACGTGGG + Intronic
1117880249 14:60306264-60306286 CCTGGTCCCTCCCATAACGTGGG + Intergenic
1119035829 14:71230054-71230076 CCGGGTCCCTCCCACGATGTGGG + Intergenic
1119175376 14:72564625-72564647 CCTGCTCCTCCCCATGATGCAGG + Intronic
1119200676 14:72749625-72749647 CCGGGTCCTTCCCACAACGTGGG - Intronic
1120661510 14:87256654-87256676 CCAGGTCCCTCCCTTGACATGGG - Intergenic
1120696107 14:87647482-87647504 CCGGGTCCCTCCCATGACGTGGG + Intergenic
1120785268 14:88528561-88528583 CCAGGTCCCTCCCACAACGTGGG - Intronic
1121099572 14:91241259-91241281 CCAGGTCTTTCCCAGGATGAAGG + Intronic
1122177235 14:99929979-99930001 CCTGGGCCTTCCCAGGATGTGGG + Intronic
1122935777 14:104955422-104955444 CCAGGTCCCTCCCATCCTGGTGG + Intronic
1123114971 14:105890486-105890508 CCAGGTCCTCCCCAAGATAGGGG - Intergenic
1124426146 15:29564761-29564783 CCAGGTCCTTCTGATGCTGGTGG + Intronic
1125206685 15:37161434-37161456 CCAGGTCCCTCCCTTGACATGGG - Intergenic
1125534972 15:40437457-40437479 CCAGGGGCTTCCTATGATGGGGG + Intergenic
1125679717 15:41523144-41523166 CCAGGTCCATCCCAGGGTGCAGG - Intronic
1126246482 15:46512062-46512084 CCAGGTCTCTCCCTTGATGTGGG - Intergenic
1127009708 15:54610013-54610035 CCAGGTCCCTCCAATGACATGGG + Intronic
1127244770 15:57160424-57160446 CCAGGTCCCTCCCACGACGTGGG + Intronic
1127356531 15:58206234-58206256 CCAGGTCCTGCTCAATATGTAGG + Intronic
1127957095 15:63863048-63863070 CCAGCTCCTTGCCAAGATGCTGG - Intergenic
1127992174 15:64128066-64128088 GCAGGTCCTTGGCATGTTGTAGG + Intronic
1128873899 15:71186337-71186359 CCTGGTCCTGCCCATGGTTTTGG + Intronic
1129187605 15:73919739-73919761 CCTGGTCCTTCCCATACTGCAGG + Intergenic
1129704976 15:77788975-77788997 CCTGGTCCTGGCCATGAGGTAGG + Intronic
1131370287 15:91875357-91875379 CCAGCTCCATGGCATGATGTTGG + Intronic
1131956607 15:97742709-97742731 CTGGTTCCTTCCCATCATGTAGG - Intergenic
1131984021 15:98023227-98023249 CCAGGTCCCTCCCATGATGTGGG - Intergenic
1133026173 16:2989853-2989875 TCAGTCCCTTCCCATGATGGGGG - Intergenic
1133615970 16:7477344-7477366 CCAGGTCCTCACAATGATTTAGG - Intronic
1133752570 16:8736224-8736246 CTGGGTCCCTCCCATGACGTGGG + Intronic
1133823038 16:9253762-9253784 CCAGGTCCCTCCCATGACATGGG + Intergenic
1134258710 16:12633188-12633210 CCAGGTGAAGCCCATGATGTCGG - Intergenic
1134753928 16:16649617-16649639 CCAGGTCATACCCATGCTGCAGG + Intergenic
1134992131 16:18709427-18709449 CCAGGTCATACCCATGCTGCAGG - Intergenic
1135178986 16:20256755-20256777 CCAGGCCCTTTCAATGATGCTGG - Intergenic
1137513849 16:49125397-49125419 CACAGTCCTTCCCAAGATGTAGG + Intergenic
1137537101 16:49335769-49335791 CCAGGTCCTCCCCATCAAGGAGG - Intergenic
1137614991 16:49841132-49841154 CCACGTCCTTGCCATGTTATTGG - Intronic
1139032338 16:62900298-62900320 CCAGGTCTCTCCCATAATTTTGG - Intergenic
1140848315 16:78910815-78910837 CCGGGTCCCTCCCATGACGTGGG + Intronic
1141345195 16:83238446-83238468 CCAGGTCACTCCCATGACATGGG + Intronic
1142202340 16:88767305-88767327 CCAGGTCCTGCCCATGAGGAAGG + Intronic
1142959147 17:3541770-3541792 CCTGATCCTTCTCATCATGTCGG + Intronic
1144619457 17:16807767-16807789 CCAGGTCCTGCCCATGTTGCTGG + Intergenic
1144893235 17:18507937-18507959 CCAGGTCCTGCTCATGTTGCTGG - Intergenic
1145138989 17:20436354-20436376 CCAGGTCCTGCCCATGTTGCTGG + Intergenic
1147055735 17:37833467-37833489 CCAGGTCCTGCCCATGTTGCTGG - Intergenic
1148072157 17:44914859-44914881 TCTGGTCCCTCCCATCATGTTGG + Intronic
1149303736 17:55328849-55328871 CCAGGTCCCTCCCATGACACAGG + Intergenic
1149510087 17:57233758-57233780 CCAGGTCCTGGGGATGATGTTGG + Intergenic
1149902179 17:60490685-60490707 CCAGGTCCCTCCCATAATGTGGG - Intronic
1151372090 17:73654365-73654387 CCAGGTGATGCCCATGCTGTTGG - Intergenic
1151438330 17:74112363-74112385 CTAGGTACTTTCCATGATATAGG + Intergenic
1152125778 17:78445662-78445684 CCAGGTCCTGTCCATGAAGAAGG - Exonic
1152233867 17:79128416-79128438 CCAGGGCTTTCCCAGGATGGAGG + Intronic
1152460674 17:80440685-80440707 CCATGTCCTTCCCACGATGGCGG + Intergenic
1156953456 18:42933465-42933487 CCAGGTCCCTTCCAGGATGTGGG - Intronic
1157288996 18:46396846-46396868 CCAGGTTCTTGGCATGACGTGGG + Intronic
1157843225 18:50978561-50978583 CCGGGTCCCTCCCATGATGTAGG + Intronic
1157876862 18:51281809-51281831 CCAGGTCTTTTCCCTGATCTAGG - Intergenic
1158061638 18:53349810-53349832 CCAGGTTCCTCCCATGACGTGGG + Intronic
1158616455 18:58992190-58992212 TTAGGTTCTCCCCATGATGTTGG - Intergenic
1158795148 18:60837224-60837246 ACAGGTAATTCCCATTATGTAGG + Intergenic
1159138295 18:64362396-64362418 CTCGGTCACTCCCATGATGTGGG + Intergenic
1160547595 18:79670711-79670733 CCGGGTCCCTCCCATGACGTGGG - Intergenic
1161250172 19:3276063-3276085 CCAGCTCCTCCCCATGCTGCAGG - Intronic
1163023180 19:14494869-14494891 TCAGGCCCTTCCCAGGATGAGGG - Intronic
1167008019 19:46787959-46787981 CCCGGTGCTTCCCATCATGGTGG - Exonic
1167303540 19:48694158-48694180 CCAGGTCATTCCCATGACTTTGG + Intergenic
1167745233 19:51346888-51346910 CCAGGGGCTCACCATGATGTTGG + Exonic
1168585338 19:57587174-57587196 CCAGGTCCCTCCCATGACATGGG + Intronic
925117852 2:1395660-1395682 CCAGGTCCCTCCCTTGACATGGG - Intronic
925151825 2:1620184-1620206 CCAGGTGCCTCCCTTGCTGTTGG + Intergenic
925565159 2:5244546-5244568 CCAGGACCTCCTCATGATTTGGG - Intergenic
926057980 2:9787215-9787237 CCAGGTTCTTCCCAAGGTCTTGG + Intergenic
926882726 2:17565808-17565830 CCTGGTCCCTCCCATGACGTGGG - Intronic
927443038 2:23133009-23133031 CCAGCTCCATCCCATGCTGAGGG - Intergenic
927611730 2:24548377-24548399 CCAGGTCTTTCCCACAACGTGGG + Intronic
930507593 2:52304194-52304216 CTAGGTCCCTCCCATGACATGGG - Intergenic
930675184 2:54192943-54192965 CCTGGTCCTACCCTTGACGTGGG + Intronic
930879483 2:56255179-56255201 CCAGTTCCTTGCCGTGAAGTGGG - Intronic
930942256 2:57026950-57026972 CTGGGTCCCTCCCATGACGTGGG + Intergenic
932707035 2:74034362-74034384 CCAGGTAATTTCAATGATGTTGG - Intronic
932822015 2:74909477-74909499 CCAGTTCCTGCCCATGAAGGGGG + Intergenic
933980235 2:87543224-87543246 CCAGGGCCTTTCCAGGATTTTGG + Intergenic
935534195 2:104274018-104274040 CCAGGTGATTCCCAGGATGCTGG + Intergenic
936261470 2:110962932-110962954 CCAGGTCCTTCCCCTTCTGAGGG - Intronic
936313591 2:111407567-111407589 CCAGGGCCTTTCCAGGATTTTGG - Intergenic
937297201 2:120816912-120816934 CAAAGGCCTTCCCATGCTGTTGG + Intronic
939508154 2:143074649-143074671 TCTGGTCCCTCCCATGACGTGGG - Intergenic
939968808 2:148637858-148637880 CCATTTCATTCCCATGAAGTAGG + Intergenic
940355836 2:152739999-152740021 CCAGGTCCCTCCCATGACGTGGG + Intronic
946656242 2:221951184-221951206 CCAGTTCCTTCTCATGAGATGGG - Intergenic
946995137 2:225383009-225383031 ACAGGTCCTTCCCACTATATTGG - Intergenic
947296562 2:228636804-228636826 GCAGGTCTTTCCCATGATAGTGG - Intergenic
948268194 2:236654028-236654050 CAATGTCCTTCCCAAGATGAAGG + Intergenic
948755459 2:240157217-240157239 CCAGGTCCTGCCCACTATGCTGG + Intergenic
1169061028 20:2660444-2660466 CCATGCCCCTCACATGATGTTGG + Exonic
1169324501 20:4664400-4664422 CCAGTTCCTGCCCATGAAGGGGG - Intergenic
1169898759 20:10532451-10532473 TCAGGTCCTTCCCATCAGGAGGG - Intronic
1170092718 20:12608872-12608894 CCAGCTCCCTCCCATTAGGTGGG + Intergenic
1170790503 20:19505207-19505229 CAAGGGGCTTCTCATGATGTTGG + Intronic
1172138951 20:32708311-32708333 TCAGGGCCTTCCCTTGATGGTGG - Intronic
1173281050 20:41628133-41628155 CCAGGTCCTTCCCCTAACATTGG + Intergenic
1173946691 20:46956997-46957019 CTGGGTCCCTCCCATGATATGGG + Intronic
1175052766 20:56170190-56170212 CCAGGTCCCTCCCATGACATGGG - Intergenic
1176264189 20:64200142-64200164 CCGTGTCCTTGCCATGATGCTGG - Intronic
1177271387 21:18852788-18852810 CCAGGTCCTTCCCATGAAAAGGG + Intergenic
1178041138 21:28642294-28642316 CCAGTTCCTGCCCATGAAGGGGG - Intergenic
1178454341 21:32733448-32733470 CCTGGTCCCGCCCTTGATGTGGG - Intergenic
1178782733 21:35620800-35620822 CTGGGTCCCTCCCATGACGTGGG - Intronic
1179794007 21:43771891-43771913 CCAGGTCCCTCCCATGACACGGG + Intergenic
1180189694 21:46156786-46156808 CCGGGTCCCTCCCATGACGTGGG - Intergenic
1180982527 22:19885556-19885578 CCAGCTCCTTCCTCTGATGTGGG - Intronic
1181671261 22:24426604-24426626 CCAGGTTCTGCACAGGATGTGGG - Intronic
1183114457 22:35679612-35679634 CCAGGTCCCTCCCACGACATTGG - Intergenic
1184439382 22:44499422-44499444 CCAGGTTCCTCCCACGATGTGGG - Intergenic
949403301 3:3688182-3688204 CTGGGTCTTTCCCCTGATGTGGG - Intergenic
950245990 3:11418992-11419014 CCAGGTCCCTCCCCTGACATGGG + Intronic
950293376 3:11805897-11805919 CCAGGTCCCTCCCACGACGTGGG - Intronic
950574790 3:13825753-13825775 CTCGGTCCTGCCCATTATGTTGG - Intronic
951205073 3:19917624-19917646 CCAGGTTCCTGCCATGTTGTTGG - Intronic
951911626 3:27755971-27755993 ACAGGCACTTCCTATGATGTAGG - Intergenic
952581523 3:34838831-34838853 CCAGGTCCCTCCTATGATACAGG + Intergenic
952631384 3:35472429-35472451 CCAGGTCCCTCCCAAGACGTGGG + Intergenic
953320088 3:41963580-41963602 CCAGGTCTTTTCCCTGATGCTGG + Intergenic
956004299 3:64762219-64762241 CCTGGTCCTACGCATAATGTAGG + Intergenic
957779287 3:84797828-84797850 TTGGGTCCCTCCCATGATGTGGG - Intergenic
958090329 3:88869383-88869405 CCTGGTCCTTCCCATGACATGGG + Intergenic
959550380 3:107649211-107649233 CCAGGTCCGTCTCATGACATGGG + Intronic
959856264 3:111162314-111162336 CCAGGTCCTTCCCATGATGTGGG - Intronic
960710837 3:120526431-120526453 CCAGGGCCTTCCAATAATTTGGG - Intergenic
961440008 3:126947124-126947146 CCAAGTCGTTCCCATGACGGCGG - Intronic
962402201 3:135070109-135070131 CCAGCTCCATTCCATGATGGTGG - Intronic
963345599 3:144093388-144093410 TCAGGTTCCTCCCATGACGTGGG - Intergenic
964405729 3:156347473-156347495 CTAGCTCCTTCCAATGATTTAGG - Intronic
964453119 3:156831757-156831779 CCAGGTCCCCCTCACGATGTGGG + Intronic
964792859 3:160469424-160469446 TCAGATCCATCCCATGACGTGGG - Intronic
969780539 4:9398978-9399000 CCAGGTCATTAGAATGATGTGGG - Intergenic
970309468 4:14766991-14767013 CCAGGTCCCTCCCCTAATATCGG + Intergenic
970351670 4:15207567-15207589 CCTGGTCCTGCCCTTGACGTGGG - Intergenic
970571533 4:17388054-17388076 CCAGGTCCCTCCCATGACAGTGG + Intergenic
971748414 4:30614136-30614158 GCAGGTCTTTCCCATGCTGTTGG + Intergenic
972332430 4:38076328-38076350 CCTGGTCCCTCCCATGACATGGG + Intronic
972890857 4:43554351-43554373 CCTTGTCCTTCCCATGACATGGG - Intergenic
973601700 4:52548876-52548898 CCAGGTCCCTCCCAAGACGTGGG + Intergenic
975036353 4:69687714-69687736 CCTGGTCCCTCCCATGACGTGGG + Intergenic
975240566 4:72052700-72052722 CCAGGTCTTTTCCCTGATTTAGG + Intronic
975381343 4:73703632-73703654 CCAAGCCCTTCTCAGGATGTGGG + Intergenic
976852001 4:89558476-89558498 CCGGGTCTCTCCCATGATGTGGG + Intergenic
976926358 4:90502416-90502438 CCAGGTCCTTCCCTTAACATTGG + Intronic
977076884 4:92464856-92464878 CCAGGTCCTTCCCCTAACATCGG - Intronic
977943093 4:102879149-102879171 CCAGGTTCCTCCCTTGACGTGGG + Intronic
979310081 4:119192926-119192948 CCAGGTCCCTCCCTTGATTTGGG - Exonic
981653143 4:147081727-147081749 CCAGCACAATCCCATGATGTGGG + Intergenic
981945589 4:150339929-150339951 CGGGGTCCTTCTCACGATGTGGG - Intronic
982070227 4:151687861-151687883 ACATGTCTTTCCCATGATTTTGG - Intronic
982730837 4:158953752-158953774 CCAGGTCATGCTGATGATGTAGG - Intronic
983070042 4:163257098-163257120 CCAGTTCCTGCCCATGAAGGGGG - Intergenic
983713799 4:170753393-170753415 CTGGGTCCCTCGCATGATGTGGG - Intergenic
984113048 4:175643952-175643974 CCTGGTTCTTCCCTTGAGGTGGG - Intronic
984592509 4:181632336-181632358 CCAGGTCCCTCCCCTGACATTGG + Intergenic
985544498 5:502357-502379 CCAGGTCTTTCCTCTGCTGTGGG - Intronic
986352466 5:6893339-6893361 CCCTGCCCTCCCCATGATGTTGG - Intergenic
986557530 5:9026339-9026361 CCTGGTCCCTCCAATGATGTGGG - Intergenic
986900051 5:12420597-12420619 CCAGGTCCCTCCCTTGACATGGG - Intergenic
987151603 5:15046243-15046265 CAAGGTCTTTTCCATGGTGTGGG - Intergenic
987196782 5:15534922-15534944 CCAGGTCCCTCCCCTGACATGGG - Intronic
987384237 5:17313898-17313920 CCAGGTCCCTCCCATGACACAGG - Intergenic
987806761 5:22779570-22779592 CTAGGTCCCTCCCTCGATGTGGG - Intronic
988177746 5:27748874-27748896 CTAGGTCCCTCCCATGACATGGG + Intergenic
988679917 5:33474895-33474917 CAGGGTTCCTCCCATGATGTGGG + Intergenic
991276185 5:64849680-64849702 CCAGGTCCCTCCCTTGACATGGG - Intronic
991578009 5:68125062-68125084 CCAGGTCTCTCCCATGACATGGG - Intergenic
993569696 5:89522004-89522026 CCAGGTCCCTCCCATGACGTGGG + Intergenic
993671877 5:90770329-90770351 CCAGGTCCCTCCCATGACGTGGG + Intronic
994357952 5:98816210-98816232 CCAGGTCCCTCCCATGACATGGG - Intergenic
994793545 5:104263728-104263750 CCAGGTCCCTCCCATGACACAGG - Intergenic
994994988 5:107049597-107049619 CCAGGTCTCTCCCATGACGTGGG - Intergenic
996150831 5:120032674-120032696 CTGGGTCCTTCTCATGACGTGGG + Intergenic
997573225 5:134949804-134949826 ACAGGACCTTCCCCTGGTGTTGG - Intronic
997841248 5:137242258-137242280 CCGGGTCCCTCCCATGACCTGGG - Intronic
998756467 5:145386304-145386326 CCAGGTCCCTCCCATGACACAGG + Intergenic
999513929 5:152281428-152281450 CCAGGTCCCTCCCATGACGTGGG - Intergenic
999687052 5:154112550-154112572 CCAGGCCCTTGAAATGATGTGGG + Intronic
999954015 5:156680867-156680889 CCAGTTCCTGCCCATGAAGGGGG - Intronic
1001107487 5:168867555-168867577 CCAGGGCCATACCCTGATGTAGG + Intronic
1001396512 5:171422247-171422269 CCAGCTCTTTCCCAAGATGCTGG - Intronic
1001813402 5:174647851-174647873 CCAGGTTCTTCCAAGGATGAAGG + Intergenic
1001855153 5:175004318-175004340 CCAGGTCCCTCCCATGACACAGG - Intergenic
1004875561 6:19948838-19948860 CCTGGTCCCTCCCATGACGTGGG + Intergenic
1005801009 6:29424767-29424789 CCAGGTCCCTCCCTTGACATGGG - Intronic
1006635822 6:35460455-35460477 CCAGGGCCTTGCCCTGCTGTGGG + Intronic
1008040940 6:46797522-46797544 CCTGGTCTTCCTCATGATGTGGG + Intronic
1008583723 6:52929983-52930005 CCAGGTGCTGCCCATGCTGCTGG + Intergenic
1009889771 6:69666537-69666559 CAAGCTTCTTCACATGATGTCGG - Intergenic
1010044187 6:71420889-71420911 CCAGCGCCCTCCAATGATGTCGG + Intergenic
1010810293 6:80292514-80292536 CCGGGTCCCTCCCATGACGTGGG + Intronic
1012254557 6:97016775-97016797 CCAGGTCCCTCCCAGGATTATGG - Intronic
1012690645 6:102307398-102307420 TCAGGTTCCTCCCATGACGTGGG + Intergenic
1013558631 6:111282879-111282901 CTGGGTCCCTCCCATGATGTGGG + Intergenic
1015336006 6:132039691-132039713 CAAGGTACTTCCCTTTATGTCGG + Intergenic
1016106830 6:140173039-140173061 CCAGGTCCCTCCCATGACATGGG + Intergenic
1016901053 6:149102582-149102604 CCTGGTCTCTCCCTTGATGTGGG + Intergenic
1017351903 6:153452543-153452565 CCAGGTCCCTCCCTCCATGTGGG - Intergenic
1017593653 6:156005288-156005310 TATGGTCTTTCCCATGATGTAGG - Intergenic
1019257035 7:59176-59198 CCAGCTCCTTCCCACGATAAGGG - Intergenic
1022455575 7:30555565-30555587 CCAGGTCCCTCCCTTGACATGGG + Intergenic
1022580384 7:31547559-31547581 CCGGGTCCTTCCCTCGATATGGG + Intronic
1023300594 7:38766639-38766661 TCTGGTCACTCCCATGATGTGGG - Intronic
1023384030 7:39636954-39636976 CCAGGTCCATCCCCTGATGTGGG + Intronic
1023384449 7:39641704-39641726 CCAGTTCATTTTCATGATGTTGG + Intronic
1027661039 7:80988424-80988446 CCAGGTCCTTCCCACGACGTGGG + Intergenic
1027673700 7:81133342-81133364 CTGGGTCCCTCCCATGACGTGGG - Intergenic
1028189287 7:87826182-87826204 CCAGGTTCCTCCCATGACGTGGG - Intronic
1028354927 7:89895463-89895485 CCAGGTCCTGCCCATAGTATGGG - Intergenic
1028360532 7:89961688-89961710 CCAGGTCACTCCCATGACGTGGG - Intergenic
1029814422 7:103078305-103078327 CCGGGTCCCTCCCACGATGTAGG - Intronic
1030470122 7:109952969-109952991 TCAGGTTCATCCCATGATGTGGG + Intergenic
1031445571 7:121849426-121849448 CTGGGTCCCTCCTATGATGTGGG + Intergenic
1032981775 7:137292345-137292367 CCAGGTCCCTCCCGTGACATGGG - Intronic
1033311499 7:140265139-140265161 CCCAGTCCTACCCATGATCTAGG + Intergenic
1033336349 7:140455882-140455904 CCAGGTCCTGCCCAGAATGCCGG - Exonic
1033801268 7:144905238-144905260 CCAGGTCTTTTCCTTGATTTAGG - Intergenic
1034412914 7:150950558-150950580 CCAGGTCCTTCCCAAGACACTGG - Intronic
1034534332 7:151717636-151717658 CCAGGCCCTCCCCATCCTGTTGG - Intronic
1034980083 7:155470171-155470193 CCAGATCCTTCTCATCATGATGG - Intergenic
1035116571 7:156529568-156529590 CCAGGTCCCTCCCATGACATGGG + Intergenic
1035716441 8:1758890-1758912 CCAGGTCTTTTCCCTGATCTAGG - Intronic
1035917210 8:3637777-3637799 CTGGGTCCCTCCCAAGATGTGGG - Intronic
1036868962 8:12422724-12422746 CCTGGACCTGCCCATGAAGTTGG + Intergenic
1037087745 8:14873715-14873737 CCAGCTCCTTCCACTGATTTTGG + Intronic
1037385797 8:18339356-18339378 CCATTTCCTTCCCTTGATTTGGG - Intergenic
1037558079 8:20045705-20045727 CCAGATCTCTCACATGATGTTGG + Intergenic
1039107289 8:34003484-34003506 CTGGGTCCCTCCCATGATGTGGG + Intergenic
1040475555 8:47774197-47774219 CCAGGTTCTGCCAAGGATGTTGG + Exonic
1041312037 8:56526753-56526775 CCAGGTCCCTTCCTTGATTTGGG + Intergenic
1041894585 8:62908519-62908541 CTGGGTCCCTCCCATGACGTGGG - Intronic
1041918232 8:63157480-63157502 CCAGTTCCTGCCCATGAAGGGGG - Intergenic
1043003396 8:74787244-74787266 CCAGGGACTTACCATCATGTCGG + Intronic
1046495519 8:115009519-115009541 CCAGGTCCCTCCCATAGTGCTGG + Intergenic
1047206755 8:122808543-122808565 CCAGGTCCCTCCCGTGATGTGGG + Intronic
1048036593 8:130683040-130683062 CTGGGTCCTTTCCATGCTGTGGG + Intergenic
1048774664 8:137932486-137932508 CCACGTCCAGCCCATAATGTGGG + Intergenic
1048868530 8:138778521-138778543 CCAAGTGCTGCCCATGCTGTTGG + Intronic
1049076155 8:140397938-140397960 CCAGGTCCCTCCTACAATGTGGG - Intronic
1049862756 8:144911291-144911313 CCAGGTTGCTCCCATGACGTGGG - Intergenic
1050175399 9:2864727-2864749 CCAGGTCCTTCACATAAATTTGG + Intergenic
1050441454 9:5668221-5668243 CCAGGTCCCTCCCATGACACAGG + Intronic
1050587299 9:7125796-7125818 CCTGGACCTTCCCATGAGCTTGG + Intergenic
1050666467 9:7943234-7943256 CTGGGTCCCTCCCATGACGTGGG - Intergenic
1051243236 9:15082301-15082323 CTGGGTCCCTCCCATGACGTGGG + Intergenic
1051933077 9:22410298-22410320 CCAGCTTTTGCCCATGATGTTGG - Intergenic
1054797809 9:69318775-69318797 CCAGGTCCTTCCTCTGACATTGG + Intergenic
1054999527 9:71433250-71433272 CTGGGTCCCTCCCATGATATGGG - Intronic
1055311719 9:74989583-74989605 CCAGGTCCCTCCCTCCATGTGGG - Intronic
1056092367 9:83217464-83217486 CTGGGTCCCTCCCATGACGTGGG - Intergenic
1057642067 9:96834166-96834188 CCTGGTCCGTCCCATGACGTGGG - Intronic
1057877636 9:98770081-98770103 TCAGGTCCCTCCCATGATGCGGG - Intronic
1057967024 9:99514053-99514075 CCAGGTCCTTGCTCTGAAGTTGG + Intergenic
1058755640 9:108080553-108080575 CCTGGTCCTTGTCTTGATGTTGG + Intergenic
1058961391 9:109995708-109995730 CCAGGTCCCTCCCATGGCGTGGG + Intronic
1059424511 9:114212235-114212257 CCAGGTCCTTGCCCTGAAGCTGG - Intronic
1059560948 9:115333904-115333926 CCAGGGCCTTCACACGAAGTGGG - Intronic
1185846966 X:3446847-3446869 CTCGGTCCCTCCCATGACGTGGG - Intergenic
1186288538 X:8071497-8071519 CCAGGTCCCTCCCTTGACGTGGG + Intergenic
1186392859 X:9178710-9178732 TCAGGTCATCCCCATGAAGTAGG - Intergenic
1186704774 X:12129449-12129471 CCAGGTCCCTCCCATGACACAGG + Intergenic
1186895198 X:13998322-13998344 CCAGGTCCCTCCCTTGACGTGGG - Intergenic
1187105696 X:16239235-16239257 CCAAGTCCTTCCTATAGTGTTGG + Intergenic
1187928379 X:24271336-24271358 CCTGGTCCCTCCCATGACATAGG - Intergenic
1188115474 X:26238116-26238138 CCAGGTCCCTCCCACAATATTGG + Intergenic
1188521475 X:31042981-31043003 CCAGGTCTTTTCCGTGATATAGG - Intergenic
1189663204 X:43326104-43326126 CAAGGTCCTGACCTTGATGTGGG + Intergenic
1190614941 X:52220634-52220656 CCAGGTCCCTCCCATGACGTGGG + Intergenic
1192431053 X:71111808-71111830 ACAGATCCTTCCCAGGATCTAGG - Intronic
1193199099 X:78666548-78666570 CCAGGTCCATCCCACGACATGGG - Intergenic
1193467202 X:81864888-81864910 CCAGGTCTTTTCCATGACGTGGG + Intergenic
1193475059 X:81953618-81953640 ACAGGATCTTCCCATGATTTGGG - Intergenic
1194507190 X:94746735-94746757 CTCAGTCCCTCCCATGATGTGGG - Intergenic
1194952761 X:100145916-100145938 CCAGGTCCCTCCCATGACACAGG - Intergenic
1195758693 X:108223944-108223966 CCCCTTCCTTCCCTTGATGTGGG - Intronic
1196326890 X:114416135-114416157 CCAGGTCCTTCCCATAACACGGG - Intergenic
1196405619 X:115359638-115359660 CCAGGTCCCTCCCACGACGTGGG - Intergenic
1197534100 X:127666063-127666085 CCAGGTCCCTCCCATGACATGGG - Intergenic
1199067265 X:143434177-143434199 CTGGGTCCCTCCCATGACGTGGG - Intergenic
1199146680 X:144377214-144377236 CCAGGTCCCTCCCTTGACATAGG + Intergenic
1199746599 X:150775763-150775785 CCAGCTCCCTCCCATGCTGCTGG - Intronic
1199854337 X:151747893-151747915 CAATGTCCATCCCATGATGTGGG - Intergenic
1199977657 X:152903861-152903883 CCAGCTCCTTCCCAAGGTGGTGG - Intergenic
1200926118 Y:8656534-8656556 GCAGGTCCTTCACATCATGAAGG + Intergenic
1201341837 Y:12942575-12942597 CCAAGTCATTCCCATCAGGTAGG + Intergenic