ID: 959858482

View in Genome Browser
Species Human (GRCh38)
Location 3:111189780-111189802
Sequence TTATTAGGTACCTAGATAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 89}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959858476_959858482 10 Left 959858476 3:111189747-111189769 CCATGTTCAAAAATTAAGGCTGT 0: 1
1: 0
2: 4
3: 42
4: 232
Right 959858482 3:111189780-111189802 TTATTAGGTACCTAGATAGGGGG 0: 1
1: 0
2: 0
3: 11
4: 89
959858475_959858482 11 Left 959858475 3:111189746-111189768 CCCATGTTCAAAAATTAAGGCTG 0: 1
1: 0
2: 1
3: 24
4: 188
Right 959858482 3:111189780-111189802 TTATTAGGTACCTAGATAGGGGG 0: 1
1: 0
2: 0
3: 11
4: 89
959858474_959858482 12 Left 959858474 3:111189745-111189767 CCCCATGTTCAAAAATTAAGGCT 0: 1
1: 0
2: 3
3: 28
4: 235
Right 959858482 3:111189780-111189802 TTATTAGGTACCTAGATAGGGGG 0: 1
1: 0
2: 0
3: 11
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959858482 Original CRISPR TTATTAGGTACCTAGATAGG GGG Intronic
904355904 1:29939697-29939719 TTCTTAGGAACCCAGATAGGAGG - Intergenic
909713387 1:78677767-78677789 TTATGAGATACCTACATAGCAGG - Intergenic
910076832 1:83290621-83290643 TTATTAGTTACCAAGAAAGCTGG + Intergenic
911112969 1:94211327-94211349 TTATTAGGTACATAAATATATGG - Intronic
913615633 1:120557573-120557595 TTGTAAGGTACCTCGAAAGGTGG - Intergenic
914574643 1:148953329-148953351 TTGTAAGGTACCTCGAAAGGTGG + Intronic
918806900 1:189059722-189059744 ATTTTGGGTACCTAAATAGGAGG + Intergenic
919435824 1:197559536-197559558 TTCTTAGGTACAAAGATAAGAGG + Intronic
922130844 1:222775652-222775674 TTATTAGGTACTTTGATTTGTGG - Intergenic
922170066 1:223146667-223146689 TTATTAGGTATCTAAGTAAGTGG - Intergenic
924904453 1:248436981-248437003 TTATGAGGTACCTAACAAGGTGG - Intergenic
1067491564 10:46710516-46710538 TCATTAGATCCCTAGATATGAGG + Intergenic
1067603098 10:47629862-47629884 TCATTAGATCCCTAGATATGAGG - Intergenic
1068332796 10:55593799-55593821 TAATTAGATCCCTAGATATGAGG - Intronic
1069519599 10:69108177-69108199 TTAAGGGATACCTAGATAGGAGG - Intergenic
1074928773 10:118102130-118102152 TTTTTAATTTCCTAGATAGGGGG - Intergenic
1078837560 11:15045777-15045799 TTCTCAGGTATCTTGATAGGAGG + Intronic
1082640261 11:55651330-55651352 TTATTAGGGACGTGGGTAGGTGG + Exonic
1082894564 11:58176355-58176377 TCACTAGGCACCTACATAGGAGG - Intronic
1085879064 11:80444196-80444218 GTATTAGATACCTAGGTAAGTGG - Intergenic
1087864184 11:103203296-103203318 TTATTGGGTATCAAGATAAGGGG + Intronic
1088001754 11:104890316-104890338 TTAGTAGGTTTCTAGATAGTAGG - Intergenic
1089991227 11:122862120-122862142 CTAATAGGTAGATAGATAGGTGG + Intronic
1096418650 12:51436549-51436571 TAAATAGTTACCTAGAGAGGAGG - Intronic
1098191008 12:67948557-67948579 TTATTAGGTATATAAATATGGGG - Intergenic
1099339854 12:81415958-81415980 TTATTAGGGAACTACATAGATGG - Intronic
1099997516 12:89795324-89795346 TTAGTAAGTATCTAGAGAGGAGG + Intergenic
1102733383 12:115135121-115135143 TTAATTGGTACATAGATAGGTGG + Intergenic
1105301222 13:19136634-19136656 TTGTTGAGTACCTAGATAGGAGG + Intergenic
1107197049 13:37665331-37665353 TAATTAGCTACCAACATAGGGGG - Intronic
1110104522 13:71654853-71654875 TTATTTGGTACAGAGATAGGTGG + Intronic
1110165036 13:72431463-72431485 CTATGAGGTAGCTAGAGAGGTGG - Intergenic
1112943426 13:104894452-104894474 TTATTAAGTAACTACATAAGTGG - Intergenic
1116023882 14:39492839-39492861 TTATAAGGTAGCTAGATGGATGG - Intergenic
1116294973 14:43095902-43095924 TTATATGTTACCTAAATAGGAGG - Intergenic
1116812267 14:49550496-49550518 TTAATAGGTACCTAGAGATCAGG - Intergenic
1117347600 14:54848842-54848864 TTTTTAAGCTCCTAGATAGGAGG + Intronic
1127385246 15:58461748-58461770 TTCTTCGGCACATAGATAGGAGG - Intronic
1134673431 16:16072728-16072750 TTATTAAGTGCCTAGAGAGATGG - Intronic
1135716897 16:24778696-24778718 TTATTTGGCACCTAGATACCAGG - Intronic
1135817782 16:25651620-25651642 TAGTCAGGTATCTAGATAGGCGG - Intergenic
1135858953 16:26037687-26037709 TTTTCAGGTACCTAGGTATGTGG + Intronic
1141319972 16:82999150-82999172 TTACAAGGTACATAGATAAGAGG - Intronic
1149371663 17:56000475-56000497 TAATTAGGTAGATAGATAGATGG + Intergenic
1149619600 17:58033524-58033546 CTATTAGGTCCCTGGAGAGGGGG - Intergenic
1155824055 18:30416824-30416846 TTCTTAAGAAACTAGATAGGAGG - Intergenic
1156198918 18:34808109-34808131 TTAATAGGTACCTGGATAGAAGG + Intronic
1156481762 18:37440774-37440796 TAGTTAGGTAGGTAGATAGGTGG - Intronic
927796101 2:26050443-26050465 TAATTACGTACCTTGGTAGGTGG + Intronic
931264849 2:60651669-60651691 TAATTAGGTACCCAGCTAGGTGG + Intergenic
933038487 2:77430756-77430778 TTAAGAGATACCTAGATAGCTGG + Intronic
937327544 2:121000292-121000314 ATAATAGGTAGATAGATAGGTGG - Intergenic
938108143 2:128547113-128547135 TGAATAGGTACACAGATAGGTGG - Intergenic
940105103 2:150090534-150090556 TTATTAGTTACCTGGCTAGTGGG - Intergenic
942002622 2:171663815-171663837 TTTTTAGGTACCTTTATTGGGGG - Intergenic
1173085707 20:39914502-39914524 TCATTAGGTACTTATGTAGGTGG - Intergenic
1174947572 20:55005247-55005269 TTATTATATACTTAGATATGGGG - Intergenic
1183103347 22:35597604-35597626 GTATTAGGTACCTGATTAGGTGG + Intergenic
1183552813 22:38501779-38501801 TTATTAGGTACCAAGTTACTAGG + Intronic
1184046480 22:41975654-41975676 TTATTAGGTGCCTAGAAACCCGG + Intergenic
952566473 3:34665381-34665403 ATATTAGATAACTAGTTAGGAGG - Intergenic
952607062 3:35161111-35161133 TTATTATGTAACTTGATGGGTGG + Intergenic
953346678 3:42181884-42181906 TTATTAGGTACCTAGAGGAAAGG - Intronic
954913788 3:54131733-54131755 TTATTATGTCCCTAGGGAGGTGG + Intronic
956014026 3:64862193-64862215 TTAGTAGATACCTAGGTAGGTGG + Intergenic
957177585 3:76831256-76831278 TTATTACATACCTAAATAGCAGG - Intronic
957843734 3:85703663-85703685 TTACCAGGTTCCTAGACAGGAGG + Intronic
958734665 3:97994706-97994728 TAATTATTTACCTAGATATGTGG - Intronic
959455488 3:106555161-106555183 TTATTAGCTATTTAGATATGTGG - Intergenic
959858482 3:111189780-111189802 TTATTAGGTACCTAGATAGGGGG + Intronic
960091451 3:113643364-113643386 TTAGTAGGTATCTAGATACCTGG - Intergenic
965794356 3:172423933-172423955 TCATTATGTATCTAGATAGTAGG - Intergenic
974277364 4:59740352-59740374 TTGTTAGGTAGATAGATAGATGG - Intergenic
979085439 4:116404376-116404398 TTTTTAGGTCCCTAGATATGTGG - Intergenic
979782746 4:124674782-124674804 TTATTAAGTATTTAGATTGGGGG - Intronic
981848342 4:149196417-149196439 TTTTTAGGTACCTCTAAAGGTGG - Intergenic
983807491 4:172013275-172013297 TTAATAAGTACATAGATAGGAGG - Intronic
986892280 5:12323600-12323622 TTTTTAGGCAGCTAGAAAGGGGG + Intergenic
991398335 5:66227576-66227598 TTATTATCAACCTTGATAGGGGG + Intergenic
998914035 5:146994950-146994972 TTCTTGGGAACCTATATAGGAGG + Intronic
1001379920 5:171298197-171298219 ATATTAGGTACCAAGACAAGAGG + Intronic
1003447305 6:6196409-6196431 TTATTAACTATATAGATAGGTGG - Intronic
1005570939 6:27145073-27145095 TTATTGTTTACCTATATAGGAGG - Intergenic
1008482992 6:52006148-52006170 TTTTTAGTGACCTAGATGGGAGG - Intronic
1023266848 7:38415469-38415491 CTATTAGGTTGCTAGATACGTGG - Intronic
1024485623 7:49914910-49914932 TTATTAGGTACTTATAGAGCAGG - Exonic
1027294598 7:76755849-76755871 TTATTAGTTACCAAGAAAGCTGG + Intergenic
1028079610 7:86558493-86558515 TTACTAGATACCTATAAAGGTGG + Intergenic
1029948136 7:104555147-104555169 TTAATGGATACCTAGATAGCTGG - Intronic
1030712601 7:112768422-112768444 TCAATAGGTACCTACATATGAGG - Intronic
1037891363 8:22625423-22625445 TTATGAGGAACCCAGAGAGGAGG + Intronic
1038765315 8:30422628-30422650 TTATTAAGTTCCTACAAAGGAGG - Intronic
1050815645 9:9808412-9808434 TGATTAGGTTCCTAGAAAGGGGG - Intronic
1055435690 9:76289998-76290020 TCATTAAGTTCCTAGATGGGAGG + Intronic
1061368901 9:130187024-130187046 TTAGGAGGTACCTGGAGAGGCGG + Intronic
1186472657 X:9833513-9833535 TTATGAGGTCCCTAATTAGGAGG - Intronic
1191904009 X:66068354-66068376 ATACAAGGTAGCTAGATAGGAGG - Intergenic
1195055782 X:101143264-101143286 TTGTTGACTACCTAGATAGGAGG + Intronic
1197171364 X:123438206-123438228 ATATGAGGTACTTAGATAGGTGG - Intronic
1197381913 X:125754993-125755015 TTATTTGGAAACTAGATAGAAGG + Intergenic
1201692393 Y:16781154-16781176 CTAATAGGTACATAGATAGATGG - Intergenic