ID: 959860282

View in Genome Browser
Species Human (GRCh38)
Location 3:111208210-111208232
Sequence CAGGTGTACGAGAAGTGAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 109}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959860282_959860288 12 Left 959860282 3:111208210-111208232 CCCCCTCACTTCTCGTACACCTG 0: 1
1: 0
2: 0
3: 4
4: 109
Right 959860288 3:111208245-111208267 TGCTAGTGCATTCTCTTCTGTGG 0: 1
1: 0
2: 0
3: 9
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959860282 Original CRISPR CAGGTGTACGAGAAGTGAGG GGG (reversed) Intronic
903955282 1:27021303-27021325 CAGCTGTACAAGGAGTGAGCTGG - Intergenic
904456245 1:30649880-30649902 CAGGTGAACGGGCAGGGAGGAGG - Intergenic
912454690 1:109789585-109789607 CAGGTGCACCAGAGGTGAGCAGG - Intergenic
915607049 1:156959002-156959024 GAGGTGAACGAGGAGAGAGGTGG + Intronic
918157600 1:181864453-181864475 CAGGAGCAAGAGAAGTGGGGAGG + Intergenic
919129053 1:193431518-193431540 AAAGTTTAGGAGAAGTGAGGGGG + Intergenic
1063930200 10:11020174-11020196 CATTTGGAAGAGAAGTGAGGTGG - Intronic
1070621075 10:78011614-78011636 CAGGAGTAAGAGCAGTCAGGTGG - Intronic
1075758020 10:124831645-124831667 CAAGTGTCAGAGAATTGAGGGGG - Intronic
1078318210 11:10308986-10309008 GAGGTGTGCCAGAATTGAGGAGG + Intronic
1080946551 11:36980750-36980772 CAGGAGAAAGAGAAGGGAGGAGG + Intergenic
1083966418 11:66046589-66046611 CAGGAGTAAGAGAGGGGAGGAGG + Intronic
1087269843 11:96100025-96100047 CATGTGAACCAGAAGTGAAGGGG + Intronic
1088091623 11:106046713-106046735 CAGGGGTACTAAAAGTGTGGTGG - Intergenic
1093163162 12:15773027-15773049 CTGATGTAGGAGAAGTGAAGAGG + Intronic
1095041490 12:37446654-37446676 CAGGTGAATAAGAAGGGAGGGGG - Intergenic
1097275080 12:57807594-57807616 CAGATGTACAAGATGTGATGTGG + Exonic
1097287922 12:57891957-57891979 CAGGGGTACCAGATGTAAGGGGG + Intergenic
1098531054 12:71542334-71542356 CAGCTGAAGCAGAAGTGAGGTGG + Intronic
1101875687 12:108595775-108595797 CAGGTGCCAGAGAGGTGAGGGGG - Intronic
1104781277 12:131422095-131422117 CAGGTGGAGGAGGAGGGAGGAGG - Intergenic
1106372895 13:29153702-29153724 CAGGAGGAAGAGAATTGAGGAGG - Intronic
1112322171 13:98417612-98417634 CAGGGGTAAGAGATGTGAGAAGG + Intronic
1113002413 13:105657361-105657383 CAGGTGCAAGAGAGGTGGGGAGG + Intergenic
1118953275 14:70454568-70454590 CAGGTATAGCAGAAGTAAGGGGG + Intronic
1119599646 14:75966926-75966948 CAGGTGTAGGAGAGGTCATGGGG + Intronic
1120713808 14:87819164-87819186 CAGGTCTGAGAGAAGGGAGGAGG + Intergenic
1121106769 14:91285353-91285375 CAGGTGCAAGAGACGGGAGGGGG + Intronic
1121431554 14:93891720-93891742 CAGGTGAAGGAGAGGAGAGGGGG - Intergenic
1123697579 15:22890408-22890430 CAGGGCTTCGGGAAGTGAGGGGG + Intronic
1125598708 15:40903784-40903806 TAGGTGTCCCAGAAGTGAGAAGG + Exonic
1126856835 15:52847153-52847175 CAGTTGTAAGAGAAGAGAAGGGG + Intergenic
1127394836 15:58536284-58536306 CAGGAGAACGAAAAGAGAGGAGG + Intronic
1130037861 15:80378061-80378083 GAGATGTACCAGAAGTGAGATGG + Exonic
1131928762 15:97415883-97415905 CAGATGTACAAGGAGGGAGGTGG - Intergenic
1133490788 16:6265857-6265879 CAAATGTACAAGAAGTGAGGAGG - Intronic
1135091564 16:19522019-19522041 CAGTAGAACGAGAAGCGAGGGGG + Exonic
1140394492 16:74615081-74615103 CAGTTGTAGGAAAAATGAGGTGG + Intergenic
1141382369 16:83588021-83588043 CAGGTGTACGGGATGGAAGGAGG - Intronic
1148775740 17:50095002-50095024 CAGGTGAAGGAGATGCGAGGGGG + Intronic
1150917044 17:69447805-69447827 AAGGTGTACTAGGAGTGAGCAGG + Intronic
1150921266 17:69486111-69486133 CATGTGAAGGAGAAGTGGGGTGG + Intronic
1151385459 17:73752690-73752712 CAGGCTGGCGAGAAGTGAGGTGG - Intergenic
1151445413 17:74160492-74160514 TATGTGGACGACAAGTGAGGAGG + Intergenic
1151463269 17:74268460-74268482 CTGGTGTACGGGAAGCGATGAGG + Intergenic
1153961857 18:10147030-10147052 CAGGTGTGTGGGAATTGAGGAGG - Intergenic
1157706165 18:49808650-49808672 CAGGTGTACGAACAGGGAGTAGG + Intronic
1159098336 18:63931029-63931051 TAGGTTAACGAGAAGTGAGCTGG + Intronic
1161455928 19:4369714-4369736 CAGGGGTGCGAGGAGTCAGGCGG - Intronic
1162013369 19:7830840-7830862 TAGGAGGACGTGAAGTGAGGGGG - Intronic
1162089542 19:8269966-8269988 CAGGTGAAGGAAAAGGGAGGGGG + Intronic
925348783 2:3187629-3187651 CAGGTGGATGAGGAGTGGGGAGG - Intergenic
925530632 2:4857625-4857647 CAGGAGTACTAGAAATGGGGAGG - Intergenic
927400890 2:22708390-22708412 CAGGAGAAGGAGAAGTGAGTGGG + Intergenic
927834332 2:26380457-26380479 CAGCTGTAAGAGGACTGAGGAGG - Intronic
927920932 2:26971159-26971181 CAGGCCTAGGAGGAGTGAGGAGG - Intronic
928229281 2:29482400-29482422 AAGGTGAAGGAGAACTGAGGGGG + Intronic
936925096 2:117728869-117728891 CAGATGTATGAGATGTGAGTTGG - Intergenic
937664030 2:124463797-124463819 CAGGTGTAGAAGAAGCTAGGGGG + Intronic
939671359 2:145016510-145016532 AAGGTATACCAGAAGTGGGGGGG - Intergenic
947481632 2:230505956-230505978 CAGGTCTCAGAGAAGGGAGGAGG + Intronic
948494363 2:238337330-238337352 CAGGTGTGTGAGTGGTGAGGTGG + Intronic
1169275301 20:4229778-4229800 CAGGGGCACAAGCAGTGAGGGGG - Intronic
1169759678 20:9077730-9077752 CTGTTGTTAGAGAAGTGAGGTGG + Intronic
1172099535 20:32476870-32476892 GAGGCCTGCGAGAAGTGAGGAGG + Intronic
1174084312 20:47994582-47994604 CAGGTGTATGGGAAGAGAGCTGG + Intergenic
1182192539 22:28477782-28477804 CAGTTGTACGAGAGGGCAGGTGG - Intronic
1183377993 22:37476225-37476247 CAGGTGTTCTAGAAGTGGCGAGG - Intronic
949533681 3:4979423-4979445 CAAGTGAATGAGAAGTGGGGCGG - Exonic
950211611 3:11127329-11127351 CAGGAGTGAGAGGAGTGAGGTGG + Intergenic
950658395 3:14451581-14451603 AAGGTATATGAGAAGGGAGGTGG + Intronic
954714720 3:52521332-52521354 ATGGGGTAGGAGAAGTGAGGTGG - Intronic
958728806 3:97938003-97938025 CATGTGTAGGAGTAGTGGGGAGG + Intronic
959492022 3:107001587-107001609 GAGGTGAAAGAGAAGTGAGGAGG - Intergenic
959860282 3:111208210-111208232 CAGGTGTACGAGAAGTGAGGGGG - Intronic
962385583 3:134929834-134929856 CAGGTGTTTGAGAAGCCAGGAGG + Intronic
965568658 3:170149217-170149239 CAGGTGTAGGAGAAGTGGAGAGG + Exonic
966969384 3:185028938-185028960 GTGGTTTATGAGAAGTGAGGGGG + Intronic
967834195 3:193947138-193947160 CAGGTGTAGGAGAGAAGAGGAGG - Intergenic
967957595 3:194889140-194889162 CAGGTGCAGGGGAAGAGAGGGGG + Intergenic
974274090 4:59692821-59692843 CAAGAGTAGGAGAAGTGAGTGGG + Intergenic
978516798 4:109577424-109577446 CAGGACTCCCAGAAGTGAGGGGG - Intronic
978848277 4:113301637-113301659 CAGGTGTTGGAGAAGGAAGGGGG - Intronic
980047595 4:128005900-128005922 TAGCTGTATGAGAAATGAGGAGG - Intronic
984596819 4:181678393-181678415 CAGAGGTAAGAGAATTGAGGAGG + Intergenic
986649952 5:9953484-9953506 CAGATGTACCAAAAGGGAGGAGG + Intergenic
988973982 5:36497094-36497116 GAGGTGTAAGAGCAGTGATGGGG - Intergenic
993196772 5:84758463-84758485 CAGGTAAAAGAGAAGTGAGCAGG - Intergenic
997360499 5:133291756-133291778 CAGGTGTAGGGGAGGTGGGGAGG + Intronic
1002353054 5:178598334-178598356 CAGGAGAAAGAGAAGTGAAGGGG - Intergenic
1003414656 6:5897181-5897203 CAGGTGTCCGAGAAATGCAGGGG - Intergenic
1005826191 6:29632923-29632945 AAGGTGGAGGAGAAGGGAGGGGG - Exonic
1007817966 6:44538181-44538203 CAGGTGTACGATATGTGATGTGG + Intergenic
1011137250 6:84114194-84114216 TTGGTGTACCTGAAGTGAGGGGG - Intergenic
1021840642 7:24719078-24719100 CAGGTCGAGGAGAAGTGTGGTGG - Exonic
1026113956 7:67480783-67480805 CAGTTGAACCAGAAGTGTGGTGG - Intergenic
1029875171 7:103742787-103742809 CTGGTGTACCTGAAGTGACGGGG + Intronic
1033932091 7:146536513-146536535 CAGGTGGAAGGGAAGTAAGGAGG + Intronic
1037206582 8:16328255-16328277 CCGGTGTATGAAATGTGAGGCGG + Intronic
1037557584 8:20040708-20040730 CAGGTGTATGAGATGTCAGTTGG + Intergenic
1037854104 8:22357754-22357776 CATCTGTCTGAGAAGTGAGGTGG - Intergenic
1041706548 8:60852495-60852517 CAGGTGGACAAGAAGAGAAGAGG + Exonic
1043577429 8:81674173-81674195 CAGGAGGAAGAGAAGTAAGGTGG - Intronic
1043769555 8:84182302-84182324 GACGTGTACCAGCAGTGAGGCGG - Intergenic
1046969250 8:120203302-120203324 CAGGTCCACCAGAAGTGGGGAGG + Intronic
1049603126 8:143517289-143517311 CAGGTGCAGGGGAAGGGAGGGGG + Intronic
1057238523 9:93387610-93387632 CAGGTGTTAGGGAGGTGAGGAGG - Intergenic
1059492947 9:114684317-114684339 CAGGTGAAAGAGAAGAGAGCGGG - Intergenic
1060894892 9:127211267-127211289 CAGGTGGAGGAGAGGAGAGGGGG + Intronic
1062146317 9:134991702-134991724 CAGGTGTCAGAGAAGAGAGACGG + Intergenic
1188236848 X:27741655-27741677 GAGGTGTATGAGGAGTGAGAAGG + Intronic
1189253398 X:39619000-39619022 CAGGTGTTTGAGAAGGGAGAAGG + Intergenic
1201932061 Y:19361078-19361100 CTGGTGTACCTGAAGTGATGGGG + Intergenic
1202133824 Y:21639589-21639611 CAGGAGTTTGAGAGGTGAGGCGG + Intergenic