ID: 959861267

View in Genome Browser
Species Human (GRCh38)
Location 3:111217500-111217522
Sequence GATTTATATTTTTAAATGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1083
Summary {0: 1, 1: 0, 2: 11, 3: 119, 4: 952}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959861267_959861268 15 Left 959861267 3:111217500-111217522 CCAAGCATTTAAAAATATAAATC 0: 1
1: 0
2: 11
3: 119
4: 952
Right 959861268 3:111217538-111217560 AGTTTTATTAAATGATAGATAGG 0: 1
1: 0
2: 1
3: 36
4: 444

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959861267 Original CRISPR GATTTATATTTTTAAATGCT TGG (reversed) Intronic
901179101 1:7327966-7327988 GACTAATATTTTCAAGTGCTGGG - Intronic
901185265 1:7368776-7368798 AATTTAAATTGTTAAATGATTGG + Intronic
901553812 1:10016053-10016075 CAAATATTTTTTTAAATGCTGGG - Intergenic
901722464 1:11210473-11210495 TTTTTATACTTTTAAATGGTTGG + Intronic
902314550 1:15608294-15608316 GATATATATTTTTATTTTCTTGG + Intergenic
902727680 1:18348038-18348060 AATTTATATATTTAAGTGCCTGG - Intronic
903298288 1:22360074-22360096 GAGTTATGTTTTTAAAAGATTGG + Intergenic
904548146 1:31293149-31293171 GATTTTTTTTTTTAAATCTTGGG - Intronic
904735224 1:32626852-32626874 TTTTTACATTTTTAAATGGTTGG + Intronic
905467394 1:38165766-38165788 GATTTACATTTTAGAAAGCTTGG + Intergenic
905756688 1:40516114-40516136 TATGTATATATTTAAAGGCTTGG - Intronic
906866210 1:49423463-49423485 GATTTCTATTGTGAAATTCTGGG - Intronic
907555724 1:55342867-55342889 GATTAATTTTTATAAATGGTAGG + Intergenic
907709622 1:56867087-56867109 GATTTTCATTATTACATGCTGGG - Intronic
908074470 1:60499442-60499464 AATTGATTTTTTTAAATGATTGG + Intergenic
908284540 1:62580836-62580858 TTTTTACATTTTTAAATGATTGG + Intronic
908412628 1:63882325-63882347 GATTAATATTTTTCAAGGATCGG - Intronic
908508652 1:64831741-64831763 TGTTTACATTTTTAAATGGTTGG + Exonic
908640829 1:66221433-66221455 GATTTATTTTTTTGGTTGCTGGG - Intronic
908714534 1:67055107-67055129 GAATTATTTTTCTAAGTGCTTGG + Intergenic
909075239 1:71045228-71045250 CATTTCTATTTTCAAATGCAAGG + Intronic
909284317 1:73795720-73795742 GAAATATTTTTTAAAATGCTCGG - Intergenic
909429054 1:75564928-75564950 TATTTTTATTTTTAAGTCCTGGG + Intronic
909747820 1:79121073-79121095 CATATATATTTTTAAGTTCTAGG + Intergenic
911272044 1:95813830-95813852 TATTTGTATTTTTAAATGCTGGG + Intergenic
911387924 1:97200688-97200710 GATTTATAGTTTTCAAAGCATGG + Intronic
911560324 1:99397566-99397588 AATGTTTATTTTTAAATGATAGG - Intergenic
911727440 1:101257029-101257051 GAATTATATTTTTTAATGTCTGG + Intergenic
911861575 1:102956678-102956700 AGTTAATATTTTTAAATACTGGG - Intronic
912415235 1:109503802-109503824 TTTATATATTTTTTAATGCTTGG + Intergenic
912601830 1:110943540-110943562 TAGTTATATTTATAAATACTTGG - Intergenic
912743876 1:112228488-112228510 GATATTTATTTTTATGTGCTTGG - Intergenic
912875527 1:113354832-113354854 TTTTTATATTTTTAGAGGCTGGG - Intergenic
913043175 1:115049828-115049850 CTTTTTTATTTTTAAATTCTAGG + Exonic
913052973 1:115133120-115133142 GCTGTTTATTTTTAAATGCAGGG - Intergenic
913181673 1:116328541-116328563 GTTTTGTTTTTTTAAATTCTGGG - Intergenic
913313312 1:117526033-117526055 GATTAATATTTCAAACTGCTTGG - Exonic
913685021 1:121223322-121223344 TATTATTATTTTTTAATGCTGGG + Intronic
914036866 1:144010944-144010966 TATTATTATTTTTTAATGCTGGG + Intergenic
914152588 1:145057003-145057025 TATTATTATTTTTTAATGCTGGG - Intronic
914383362 1:147141461-147141483 GGGTTATATTTTTAACTTCTTGG + Intergenic
915705543 1:157840108-157840130 GGTTTGTATTTTTAAATGGTAGG - Intronic
915810107 1:158900065-158900087 TATTTTTATTTTTAAATTTTAGG + Intergenic
915834531 1:159164872-159164894 TCTATATATTTTTAAAAGCTAGG + Intergenic
916149895 1:161776806-161776828 GATGTATATTTGGAAATCCTTGG + Intronic
916276040 1:162994471-162994493 GATATATATTTTTAAAAAATAGG - Intergenic
916656630 1:166882527-166882549 GATTTTTTTTTTTAAAGGCAAGG + Intergenic
916862378 1:168820055-168820077 GATTTTAATTTTTGAATGCTTGG - Intergenic
917020148 1:170577785-170577807 GGTATATTTTTTTAAATGCTTGG - Intergenic
917114617 1:171590042-171590064 GATTTACATTTTAAGCTGCTGGG - Intronic
917360397 1:174169201-174169223 CCTTTATATTTTCAAATGGTAGG - Intronic
917559151 1:176126907-176126929 GTTTTATAATTTTAAATTATTGG + Intronic
917939837 1:179907667-179907689 ACTTTATATATTTATATGCTTGG + Intronic
918290757 1:183105626-183105648 CATTTTTTTTTTTAAATGCAAGG - Intronic
918345824 1:183606328-183606350 TATTTAAACTTTTAAATGTTAGG - Intergenic
918375568 1:183905785-183905807 TTTTTACATTTTTAAATGATTGG + Intronic
918663286 1:187116143-187116165 GATCTAAGTCTTTAAATGCTGGG + Intergenic
918880043 1:190107180-190107202 AATTTATATTTTTATATGAAAGG - Intronic
919434102 1:197535244-197535266 GATCTGCATTTTTAAATGCCTGG - Intronic
919450180 1:197762755-197762777 AATATATATTTTTAAATGCTCGG - Intronic
920353508 1:205353217-205353239 TTTTTACATTTTTAAATGATTGG + Intronic
920472339 1:206241879-206241901 TATTATTATTTTTTAATGCTGGG + Intronic
920809181 1:209265949-209265971 ATTATATATTTTTAAATACTAGG - Intergenic
920935975 1:210434959-210434981 TATTTACCTTTTTAAATACTAGG + Intronic
920975414 1:210781141-210781163 GAGTTATATTTTGTAATCCTTGG + Intronic
921279161 1:213548869-213548891 GCTTTGTATTTTTAAAAGTTAGG - Intergenic
921491893 1:215787405-215787427 CATTTATATTTTTAAAAACTTGG - Intronic
921499414 1:215882449-215882471 GATTAATATTTTTAAAGGAAAGG - Intronic
921853626 1:219957025-219957047 AATATATATTTTTTATTGCTAGG - Intronic
923012295 1:230097826-230097848 ACATTATATTTTTAATTGCTTGG + Intronic
923401594 1:233620034-233620056 GCTTTATATTTTCAAATGGTTGG + Intronic
923824517 1:237485105-237485127 AATTTATATTTCTTAGTGCTAGG - Intronic
924000379 1:239544022-239544044 TTTTTACATTTTTAAATGTTTGG - Intronic
924012267 1:239678037-239678059 GAAGTATATTTGGAAATGCTGGG + Intronic
924318006 1:242818624-242818646 GATGTATATTTGCAAATGCAAGG - Intergenic
924656993 1:245981577-245981599 CATTTGTATTTATAAATGTTTGG - Intronic
1063047535 10:2407957-2407979 AATTTTTTTTATTAAATGCTAGG - Intergenic
1063272017 10:4520757-4520779 GTTTTCTATTTTCAAATGCTAGG + Intergenic
1063330085 10:5149067-5149089 GTTATATATATTTAAATGTTTGG + Intergenic
1063732606 10:8716047-8716069 TAGTTCTTTTTTTAAATGCTTGG + Intergenic
1064476671 10:15697753-15697775 TTTTTATATTTTTAAATGGCTGG - Intronic
1064529600 10:16294540-16294562 GATTTGTCTTTTTAAGTGTTTGG + Intergenic
1064703742 10:18048699-18048721 GAATTATATTTTTAAAACCTAGG + Intergenic
1064723697 10:18256052-18256074 GATATATGTTTTTAAATCCAAGG - Intronic
1064743885 10:18460577-18460599 TATTTATTTTTTTAAATGGGAGG - Intronic
1065267982 10:23997348-23997370 GCTTTAATTTTTTAATTGCTTGG + Intronic
1065781931 10:29177073-29177095 AATATATATATTTAAAAGCTTGG + Intergenic
1065890507 10:30117283-30117305 GATTTTTATTTTTAAATGGGTGG + Intergenic
1065980494 10:30890395-30890417 AATTTATATTTTTAATTCCCAGG + Intronic
1066038921 10:31525047-31525069 TTTTTACATTTTTAAATGATTGG + Intronic
1066288836 10:33995475-33995497 GATTTCTATTTTTCTTTGCTTGG - Intergenic
1066324753 10:34346737-34346759 CATTTTTCTTTTTACATGCTTGG - Intronic
1066346665 10:34593548-34593570 GATTTATAGGTTTGAATGCTGGG - Intronic
1066353468 10:34659279-34659301 AATTAACATTTTTAAATGTTGGG - Intronic
1066483519 10:35821746-35821768 GTTTTATATGTCTAAATGATAGG - Intergenic
1066506160 10:36046476-36046498 GATTTAAGTTTTAAGATGCTGGG + Intergenic
1067355361 10:45519670-45519692 TTTTTACATTTTTAAATGGTTGG - Intronic
1067737440 10:48869068-48869090 GACTTAAATATTTAAATACTTGG - Intronic
1067881702 10:50051428-50051450 AATTTTTATTTGTAAATGTTTGG + Intergenic
1068037120 10:51774653-51774675 GAATAATATTTTTAAATTCAAGG - Intronic
1068185401 10:53578681-53578703 AAGTTTTATTTTTAAATTCTTGG - Intergenic
1068305919 10:55208006-55208028 GATATATATTTTTAACTCATGGG + Intronic
1068471061 10:57464307-57464329 GATACAAATTTTTAAATGCTGGG - Intergenic
1068502054 10:57852343-57852365 TTTTTATATTGTTGAATGCTAGG + Intergenic
1068534690 10:58229207-58229229 GAATTTTTTTTTTAAATACTAGG + Intronic
1069200683 10:65611536-65611558 TATTAATATTTTCAAATGCAAGG - Intergenic
1069292721 10:66802639-66802661 GATATATATTTTAATATTCTTGG - Intronic
1069301722 10:66916052-66916074 GACATATATTTTTAAATGTTGGG + Intronic
1069352784 10:67549692-67549714 TTTTTATATTTTTAAAGGTTGGG + Intronic
1069646314 10:70000917-70000939 TATTTATACTTTTATCTGCTTGG - Intergenic
1070705302 10:78633227-78633249 TATTTATATATGTAAATACTAGG + Intergenic
1070857973 10:79623231-79623253 GATTTGTATTTTTTAATAATTGG - Intergenic
1070981028 10:80647473-80647495 TTTTTACATTTTTAAATGGTTGG + Intergenic
1071043629 10:81345231-81345253 GATTAATAATTTTTAAAGCTAGG - Intergenic
1071069288 10:81672649-81672671 GGTTTTTTTTTTTAATTGCTAGG + Intergenic
1071382243 10:85078749-85078771 TTTTTATATTTTTAAATGATTGG - Intergenic
1071967006 10:90861759-90861781 CAGTAATTTTTTTAAATGCTAGG - Intergenic
1072039303 10:91591895-91591917 GATTTATGTTTTTAAAAGCCTGG - Intergenic
1072150954 10:92683234-92683256 AATATATATATTAAAATGCTAGG - Intergenic
1073883456 10:108009396-108009418 GATTTTTATTTTTAACTTTTTGG + Intergenic
1074345505 10:112681478-112681500 GGTTTACATGTTTAAATGATTGG + Intronic
1074369886 10:112891726-112891748 AACTTAAATTTTTATATGCTGGG + Intergenic
1074409151 10:113210842-113210864 GATTTCTATTTTAAGAAGCTAGG - Intergenic
1074503998 10:114051145-114051167 TATTTAAATTTTTATCTGCTTGG - Intergenic
1075007566 10:118841876-118841898 AAAATATATTTTTAAATGGTGGG - Intergenic
1075355050 10:121764339-121764361 GATTTATTTTTACAAAGGCTGGG + Intronic
1075808489 10:125207209-125207231 TATTTATATTTTTCCAGGCTTGG - Intergenic
1076068361 10:127466590-127466612 GATTTTTTTTTTTTAATCCTTGG + Intergenic
1076644924 10:131946654-131946676 GATTTATTTGAGTAAATGCTTGG + Intronic
1076766490 10:132637367-132637389 GGGTTATAGTTTTAAATGTTAGG + Intronic
1076766497 10:132637442-132637464 GGGTTATAGTTTTAAATGTTAGG + Intronic
1078621253 11:12910673-12910695 GTTTTGTATTTTAAAATTCTTGG + Intronic
1079048929 11:17135910-17135932 CATTTATATCTTTAATTGCAAGG - Intronic
1079851791 11:25544187-25544209 AATTTTTATTTTTAAGTTCTGGG - Intergenic
1079909914 11:26297106-26297128 GATTACTATTTTTAAATTATAGG - Intergenic
1079943414 11:26711031-26711053 GGTTTTTATTTTTAAATCATTGG - Intronic
1079959833 11:26909735-26909757 GATTTCTATTTATAAAAGATTGG - Intergenic
1079971741 11:27043375-27043397 AAGTTATACTTTTAAGTGCTGGG + Intronic
1080138474 11:28886713-28886735 GATTTTTTTTTCTAAATGTTTGG + Intergenic
1080492648 11:32783039-32783061 AAGTTATATTTTTTAATTCTGGG - Intronic
1080789880 11:35512819-35512841 TTTTTATATTTTTAAAAGATGGG - Intronic
1081145452 11:39557749-39557771 GACTTATATTTCCAAATGCCTGG - Intergenic
1081227514 11:40542450-40542472 GATTTATATTTTTTGATTGTGGG + Intronic
1081322802 11:41712221-41712243 TATTTTTATTTTTTAATGATGGG - Intergenic
1081415095 11:42805008-42805030 TTTTTATACTTTTAAATGGTTGG + Intergenic
1081446567 11:43136758-43136780 GAAGTTTATTTTTAATTGCTAGG + Intergenic
1082681154 11:56172690-56172712 GAATTATCATTGTAAATGCTAGG - Intergenic
1082769505 11:57195980-57196002 GATTCATATTTTTAAATGAATGG - Intergenic
1082947260 11:58773356-58773378 CCTTGATATTTTTAAATCCTAGG - Intergenic
1083056754 11:59829022-59829044 GTTTTATATGTTGAAATGTTTGG + Intergenic
1083182639 11:60997073-60997095 CATTTATAATTTTAAATTTTTGG + Intronic
1084942717 11:72621743-72621765 GATTTTTGTTTTTTAAGGCTAGG - Intronic
1085584701 11:77690973-77690995 TTTTTATGTTTTTAAATGATTGG - Intronic
1085761923 11:79248552-79248574 GAGTTTTATTTTTGAATCCTTGG - Intronic
1085921846 11:80966815-80966837 TATTTATCTGTTTAATTGCTGGG + Intergenic
1086074443 11:82835190-82835212 AATTTTAATTTTTAAATTCTGGG - Intronic
1086291566 11:85316392-85316414 GACTTATATTTTTAAATATCTGG + Intronic
1086552706 11:88070524-88070546 CATTTATGTTTTTAATTCCTGGG - Intergenic
1086723319 11:90148525-90148547 GATTCATATATTTAAATGTTTGG - Intronic
1086729010 11:90224768-90224790 CATATATATCTATAAATGCTTGG - Intergenic
1086759460 11:90609488-90609510 GCCTTACATTTTTAAATTCTTGG + Intergenic
1086793870 11:91075633-91075655 GATTTATCTTGTTTAATGTTAGG + Intergenic
1087028082 11:93671835-93671857 CATTTATATTTTTATCTGCTTGG - Intronic
1087121489 11:94579548-94579570 GATTTAAATTTTTAGACTCTAGG + Intronic
1087353997 11:97071294-97071316 GATTTTTTTTTTTTATTGCTAGG + Intergenic
1087523130 11:99269348-99269370 GATTTTTTTTTTTAAATCGTGGG + Intronic
1087524447 11:99292068-99292090 GATTCATAAATTTAAATGATTGG + Intronic
1087769412 11:102191362-102191384 TTTTTTTTTTTTTAAATGCTGGG + Intronic
1087829253 11:102801076-102801098 GCTTCATATTTTTTTATGCTGGG + Intergenic
1088150620 11:106740400-106740422 GATTTTTATTTTTCTATGGTTGG + Intronic
1088160656 11:106865848-106865870 GAGTTTTGTTTTTAAATCCTGGG - Intronic
1088446546 11:109936231-109936253 AATTTACATATTTAAATGTTAGG + Intergenic
1088453825 11:110012648-110012670 GATCAACATTTTTAAGTGCTTGG + Intergenic
1088535589 11:110857228-110857250 GTTTTTTAGTTTTAAGTGCTAGG - Intergenic
1088671843 11:112148937-112148959 GTTTTTAACTTTTAAATGCTGGG - Intronic
1090507401 11:127332526-127332548 GATTTATTTGATTAAAAGCTAGG - Intergenic
1090525959 11:127537173-127537195 GTTTTATACTTTTATAGGCTGGG + Intergenic
1090686935 11:129131939-129131961 AATTTTTATTTTTAAGTTCTGGG + Intronic
1090949615 11:131462425-131462447 TTTTTGTATTTTTAAATGTTGGG - Intronic
1091481831 12:840433-840455 TTTTTATATTTTTTAATGTTTGG + Intronic
1091547195 12:1509354-1509376 GACTTATATTTTGAAGTGGTTGG - Intergenic
1092047221 12:5440406-5440428 GAAGGATATTTTTAAATGCTGGG - Intronic
1092199930 12:6574927-6574949 GTTTTACATTTTAAAATGGTTGG + Intronic
1093187142 12:16033549-16033571 GATTTTTTTTTTTACATGATTGG + Intronic
1093254690 12:16852707-16852729 GATTCATATTTTCAACTACTTGG - Intergenic
1094366874 12:29692650-29692672 GATATTTATTTTTATATTCTTGG - Intronic
1094782838 12:33812796-33812818 GATTTTTATTTTTAAGTTCTGGG + Intergenic
1095930607 12:47621578-47621600 GATTTATCTTTTTCATTGATTGG - Intergenic
1096603649 12:52748532-52748554 GCTGCTTATTTTTAAATGCTCGG - Intergenic
1097352619 12:58565051-58565073 CATTTACATTTTAAAATGCTGGG + Intronic
1097420883 12:59377804-59377826 TATTTTTATTTTTTAAAGCTGGG - Intergenic
1097558384 12:61168959-61168981 GCTGTATATTTTTAAGTGCTTGG - Intergenic
1097620834 12:61937527-61937549 AATTTATGTTTTTGTATGCTTGG - Intronic
1097982330 12:65747121-65747143 GTTTTAACGTTTTAAATGCTGGG - Intergenic
1098501719 12:71200208-71200230 GATGTATATTTTTAATTGGGTGG - Intronic
1099014948 12:77333190-77333212 GTTTTATATTTTTAACTCCTGGG + Intergenic
1099028009 12:77490390-77490412 GGTTCATATTTTTAAATGGGAGG + Intergenic
1099135684 12:78897130-78897152 GAATTATATATTTAAATGCCAGG - Intronic
1099139913 12:78960041-78960063 TTTATATATTTTTAAATTCTTGG + Intronic
1099208460 12:79755875-79755897 GTTTTTTGTTTTTAAATTCTTGG + Intergenic
1099510548 12:83530307-83530329 GACTTCTATTTTCAAATGTTTGG - Intergenic
1099909923 12:88817360-88817382 GAGTTATGTCTTTAAATGTTTGG - Intergenic
1100109637 12:91223911-91223933 AAATTATATTTTTAAAATCTAGG - Intergenic
1100200180 12:92289754-92289776 GATTTGTATTTTCATTTGCTTGG + Intergenic
1100621104 12:96273814-96273836 GATAAATATTTTAAAATGATAGG + Intergenic
1100661598 12:96705202-96705224 TTTTTATTTTTTTAAGTGCTAGG + Intronic
1100711605 12:97263115-97263137 GATTTTAATCTTTGAATGCTAGG + Intergenic
1100853164 12:98734671-98734693 GTTTTTTGTTTTTAAATGGTGGG + Intronic
1100917690 12:99444946-99444968 GAGTTATATTTTTATATGGTAGG - Intronic
1100922800 12:99507974-99507996 GCTTTGTGTTTTTAATTGCTTGG + Intronic
1101039565 12:100740732-100740754 TTTTTACATTTTTAAATGGTTGG + Intronic
1101047088 12:100819588-100819610 AATGTATATTTTAAAATTCTTGG + Intronic
1101174680 12:102137515-102137537 GATTTTTTTTTTTTAATTCTAGG + Intronic
1101315482 12:103625076-103625098 GATTTAAATTCTTAAATGGCAGG - Intronic
1101883206 12:108639986-108640008 TTTTTACATTTTTAAATGGTTGG - Intergenic
1101975837 12:109357904-109357926 CTTTTACATTTTTAAATGGTTGG - Intronic
1102454311 12:113062453-113062475 CTTTTACATTTTTAAATGGTTGG - Intronic
1102788852 12:115626879-115626901 GTTTTACATTTTTAAATGGTGGG + Intergenic
1103073592 12:117964751-117964773 GATTTATAGTTTTAAGTTTTTGG - Intronic
1103090254 12:118092973-118092995 TTTTTATATTTTTAAATGGTTGG - Intronic
1103091731 12:118103036-118103058 GCTTTTTATTTTGAAATACTTGG - Intronic
1103249004 12:119483814-119483836 CATTTATTTTTTTAAATGCAGGG - Intronic
1103484778 12:121275160-121275182 ACTTTTTATTTTTAAATGCTGGG + Intronic
1104234878 12:126924343-126924365 AATTTATATTTTAAAATTCAGGG + Intergenic
1104536899 12:129626329-129626351 TATTTATATTCCTAAATCCTGGG - Intronic
1104703769 12:130927316-130927338 GATTAATATTTTTCAATCCTGGG - Intergenic
1106706232 13:32282826-32282848 GTTTTAAATTTTTAAATGCAGGG - Intronic
1106828320 13:33549464-33549486 TTTTTAGATTTTAAAATGCTGGG - Intergenic
1106971182 13:35144015-35144037 GTTTTACATTTTTAAATGATGGG + Intronic
1107170672 13:37339368-37339390 CATTAATATTATTAAATGATTGG + Intergenic
1107291769 13:38862775-38862797 GTTTTATATTTTTAAATGTTTGG + Intronic
1107480570 13:40782400-40782422 TTTTTATAGTTTTAAATGGTTGG + Intergenic
1107653647 13:42570047-42570069 GAGTTATATTTATAAATATTTGG - Intronic
1107859238 13:44645300-44645322 GTTGTATATTTTTAAATCCTGGG - Intergenic
1108043484 13:46360867-46360889 TATTTTTATTTTTAAGTGGTGGG - Intronic
1108221617 13:48239886-48239908 TTTTTATATTTTTTAATGGTTGG + Intronic
1108366371 13:49719211-49719233 AATATATAGTTTTAAATGCAAGG - Intronic
1109445287 13:62429946-62429968 TATTTATTGTTTTAAATGCAAGG + Intergenic
1109590353 13:64471997-64472019 AAATTATATTTTCAAATGATTGG - Intergenic
1109769410 13:66951540-66951562 GAATGATTATTTTAAATGCTGGG + Intronic
1109835835 13:67855828-67855850 AAGTTATATTTTTTAAAGCTTGG + Intergenic
1110320067 13:74151192-74151214 GAGTAATAGTTTTGAATGCTAGG + Intergenic
1110571612 13:77010951-77010973 GTGTTATGTTTTTAAATACTTGG - Intronic
1110947142 13:81436433-81436455 GAATGAATTTTTTAAATGCTAGG - Intergenic
1110981853 13:81910688-81910710 GTATTTTATTTTTATATGCTTGG - Intergenic
1111023910 13:82493243-82493265 GATTTATAATTAAAAATTCTGGG + Intergenic
1111554178 13:89858258-89858280 GATGAAAATTTTTAAAAGCTGGG - Intergenic
1111584484 13:90267518-90267540 TATTTATATTGTTAATTGATGGG + Intergenic
1111593306 13:90378001-90378023 GATTTATTTTTTGATAAGCTAGG - Intergenic
1111761206 13:92467692-92467714 GAGTCGTATTTTTAACTGCTGGG + Intronic
1112067690 13:95812265-95812287 TTTTTACATTTTTAAATGGTTGG - Intronic
1112486857 13:99827729-99827751 TATTTATATTTATACATGCAAGG + Intronic
1112570925 13:100592315-100592337 GTTTTACATTTTTAAATATTTGG + Intergenic
1112607864 13:100925592-100925614 GCTTAATATATTTTAATGCTTGG - Intergenic
1112706212 13:102071964-102071986 CATTTACTTTTTTATATGCTGGG - Intronic
1112922361 13:104629849-104629871 TTTTTATATTCCTAAATGCTTGG + Intergenic
1113049789 13:106198317-106198339 GAATTATATGTTCAAATGCTTGG + Intergenic
1114034813 14:18613526-18613548 GATTTATACTTTAAAAAGATGGG - Intergenic
1114123829 14:19701490-19701512 GATTTATACTTTAAAAAGATGGG + Intergenic
1114157700 14:20124543-20124565 TATTTCTTTTTTTAAATGTTTGG - Intergenic
1114397085 14:22374009-22374031 AATTTATATTTTTAAATTGTTGG - Intergenic
1114545641 14:23498442-23498464 GGTTTAAAGTTTTTAATGCTAGG + Intronic
1114552589 14:23541800-23541822 GAATGATAGTTTTAAATGCAGGG - Intronic
1114817213 14:25974388-25974410 TTTTTATATTTTTAAATTGTTGG - Intergenic
1115068676 14:29295823-29295845 GATTTATTTATTTTATTGCTGGG + Intergenic
1115091180 14:29577864-29577886 AAGCTATATTTTTAAATGCTAGG - Intronic
1115452668 14:33566141-33566163 CATTTAAATTGATAAATGCTTGG + Intronic
1115578490 14:34734708-34734730 GATTTTGATTTTTAATTTCTGGG + Intergenic
1115654990 14:35434915-35434937 TATTAATACTTTTAAATGCATGG + Intergenic
1115711962 14:36060855-36060877 GATATATTTTTTTAAATTTTAGG - Intergenic
1115757871 14:36547701-36547723 TATTTATATTTTTAGCAGCTGGG + Intergenic
1115772810 14:36683959-36683981 AATTTATTTTTTTAAATGCTGGG - Intronic
1116117834 14:40679830-40679852 AATTTATATTTTCGTATGCTTGG + Intergenic
1116304621 14:43235406-43235428 GATTAATATTTTAAAATTTTGGG - Intergenic
1116333100 14:43620170-43620192 AAATTATGTTTTTAAATACTTGG + Intergenic
1116507400 14:45701405-45701427 CTTTTACATTTTTAAATGGTTGG + Intergenic
1116731323 14:48625896-48625918 GAATTATATTTTGCAATGCAAGG - Intergenic
1116837662 14:49786756-49786778 CATTTTTATTTTTATATGTTCGG - Intronic
1117348089 14:54853737-54853759 CATTTTTTTTTTTTAATGCTAGG + Intronic
1117701022 14:58413710-58413732 GATTTGTATTTGTATAGGCTGGG + Intronic
1118226788 14:63908325-63908347 ACTTTATATTTTTATATGCTTGG + Intronic
1118418826 14:65576230-65576252 GTTTTACATTTTTAAATGGTTGG + Intronic
1118454279 14:65930577-65930599 ATTATGTATTTTTAAATGCTTGG + Intergenic
1118860698 14:69660704-69660726 TGTTTATATTTTTAAATGGTTGG + Intronic
1119238682 14:73040917-73040939 TTTTTACATTTTTAAATGGTGGG + Intergenic
1119384657 14:74250248-74250270 AATTTTTTTTTTTAAATGCTAGG + Intronic
1119903779 14:78283359-78283381 GTTTTACATTTTTAAATGGCTGG + Intronic
1119931124 14:78548548-78548570 GATTTATCCTCTTAAAAGCTAGG - Intronic
1120474032 14:84964161-84964183 GTTTTATATTTGCAACTGCTTGG - Intergenic
1120632570 14:86908805-86908827 TATTTATTATTTTAAATACTTGG - Intronic
1120704984 14:87736400-87736422 CATTTTTATTTTTAAGTTCTGGG + Intergenic
1120708328 14:87767906-87767928 GATATATATTTTTAAAAGACAGG + Intergenic
1121153187 14:91656430-91656452 GTTGTATGTTTTTAAATTCTAGG - Intronic
1121940040 14:98061766-98061788 AATTTTTATTTTTAAGTTCTGGG - Intergenic
1122595992 14:102892698-102892720 TATTTACATTTTAAATTGCTGGG - Intronic
1122756728 14:103986537-103986559 GACTGATAGTTTTAAAAGCTAGG + Intronic
1123952234 15:25291709-25291731 TATTAATTTTTTTAAATGGTTGG - Intergenic
1124467736 15:29953592-29953614 TATTTATTTTTTTTATTGCTTGG + Intronic
1124584184 15:30990548-30990570 GATGTATATGTTTAATTGCTTGG - Intronic
1125033930 15:35101879-35101901 CATTTAAAATTTTAAATGGTTGG + Intergenic
1125106000 15:35971979-35972001 AATATATATATTTAAAAGCTTGG + Intergenic
1125196423 15:37052514-37052536 AATTCATATTTTTAAAGGGTGGG + Intronic
1125419586 15:39490895-39490917 GCTTTATATTTTGAAAACCTTGG + Intergenic
1125803319 15:42469988-42470010 GTATTATATTTTTAAAGGCTGGG + Intronic
1126160474 15:45608277-45608299 TATTTATATTCTTAAATATTAGG - Exonic
1126214179 15:46135407-46135429 CATTTCCATTTTTAAATGCGGGG + Intergenic
1126274928 15:46866062-46866084 CATTTATTTTATTAAATGCATGG - Intergenic
1126608149 15:50501822-50501844 GTTTTAAATTTTTATATGGTTGG + Exonic
1126895914 15:53257250-53257272 GCTTTTCATTTTTAAAGGCTTGG + Intergenic
1126979980 15:54229489-54229511 TATTATTATTTTTAAATGATTGG + Intronic
1127108448 15:55642780-55642802 TTTTTAGATTTTTAAATGTTTGG - Intronic
1127472898 15:59306615-59306637 ATTTTATATATTTAAATCCTTGG - Intronic
1128175366 15:65550567-65550589 CAATTATTTATTTAAATGCTTGG - Intronic
1128648033 15:69391325-69391347 GTTTTTTATTTTTAAATGGAAGG + Intronic
1128777455 15:70333038-70333060 GAACTATGTATTTAAATGCTTGG - Intergenic
1128948340 15:71847736-71847758 GATTTCTGTTTTTAATTTCTGGG + Intronic
1128969278 15:72092784-72092806 TTTTTACATTTTTAAATGGTTGG - Intronic
1129044659 15:72723752-72723774 GATCTATAGTTTTATATACTTGG + Intronic
1129624570 15:77183107-77183129 TTTTTATGTTTTTAAATGGTTGG + Intronic
1129733936 15:77949197-77949219 TATTTTTATTTTTTAAGGCTGGG - Intergenic
1130006885 15:80108097-80108119 GATTGGTATTTATAAGTGCTTGG + Intronic
1130211731 15:81930037-81930059 GTTTTATATTTTTAAATGGTTGG - Intergenic
1130228033 15:82074834-82074856 GTTTTACATTTTTAAATGGTTGG - Intergenic
1130437139 15:83912373-83912395 TTTTTATGTTTTTAAATGGTTGG - Intronic
1130641847 15:85683774-85683796 GGTTGATTTTCTTAAATGCTGGG - Intronic
1130858720 15:87866391-87866413 AATGTATACTTTTTAATGCTGGG - Intronic
1130873944 15:87995937-87995959 TTTTTATGTTTTTAAATGGTTGG - Intronic
1131370945 15:91881290-91881312 CTTTTTTTTTTTTAAATGCTCGG + Intronic
1131656600 15:94467069-94467091 GATTTATATGTATAAATGTATGG + Intronic
1132547087 16:538315-538337 CTTTTACATTTTTAAATGGTTGG - Intronic
1132628907 16:907094-907116 CAGTTATATTTCTATATGCTGGG - Intronic
1133124247 16:3634809-3634831 TATTAATATTTTTAAAAGCTGGG - Intronic
1133590729 16:7240501-7240523 GATTTCTGTTTCTAAATACTGGG + Intronic
1133875925 16:9734245-9734267 GAATCTTATTTTTAAATGCCCGG - Intergenic
1133955285 16:10438079-10438101 GGTTTTTATTTTAAAATTCTAGG + Exonic
1134308157 16:13052061-13052083 TATTAAAATTTTTAAATGCTAGG - Intronic
1134431730 16:14215204-14215226 CAGTTAAATTTTTAAATGGTGGG - Intronic
1134603748 16:15553671-15553693 AATTTTCATTTTTAAATACTTGG - Intronic
1135010128 16:18868825-18868847 ATTTTTTATTTTTAAATGATGGG - Intronic
1135316971 16:21455978-21456000 ATTTTTTATTTTTAAATGATGGG - Intergenic
1135369894 16:21888219-21888241 ATTTTTTATTTTTAAATGATGGG - Intergenic
1135441920 16:22482903-22482925 ATTTTTTATTTTTAAATGATGGG + Intronic
1136313791 16:29436148-29436170 ATTTTTTATTTTTAAATGATGGG - Intergenic
1136327231 16:29537913-29537935 ATTTTTTATTTTTAAATGATGGG - Intergenic
1136441919 16:30277899-30277921 ATTTTTTATTTTTAAATGATGGG - Intergenic
1137016847 16:35385533-35385555 GATATAATTTTTCAAATGCTTGG + Intergenic
1137659396 16:50191612-50191634 TAATGATATTTTTAAAGGCTTGG - Intronic
1137804287 16:51288727-51288749 GAGTGATATTTTAAAATGTTGGG + Intergenic
1137865951 16:51896205-51896227 GATGTATATTTTTCAAGGATAGG + Intergenic
1137876468 16:52001024-52001046 GTTTTATATTTTTTAATGATGGG + Intergenic
1137887698 16:52124680-52124702 TGTTAATATTTTTTAATGCTGGG + Intergenic
1137980166 16:53062721-53062743 AATTTTTATTTTTAAATAATTGG - Intronic
1138240109 16:55420720-55420742 TTTTTACATTTTTAAATGGTTGG + Intronic
1138258452 16:55592832-55592854 GCTCTACATTTTAAAATGCTTGG - Intergenic
1138318180 16:56088270-56088292 CTTTTACATTTTTAAATGGTTGG + Intergenic
1138508351 16:57491156-57491178 GTATTATTTTTTTAAATGTTTGG + Intergenic
1138591594 16:58002034-58002056 GGCTTAGATTCTTAAATGCTAGG + Intronic
1138838184 16:60463883-60463905 AATATATATTTTTAAAACCTGGG - Intergenic
1139247900 16:65464173-65464195 GCTTTAATTTTTTAGATGCTAGG - Intergenic
1139306671 16:65992296-65992318 TTTTTCTCTTTTTAAATGCTAGG - Intergenic
1139685237 16:68598200-68598222 TTTTTACATTTTTAAATGGTTGG + Intergenic
1139888723 16:70231628-70231650 ATTTTTTATTTTTAAATGATGGG - Intergenic
1140331755 16:74064449-74064471 AATATATACTTTTAAATGGTAGG + Intergenic
1140779482 16:78281735-78281757 GCTTCACATTTTTAAATGGTTGG - Intronic
1141207454 16:81944049-81944071 AATTTATATTTTTTAATGGCTGG - Intronic
1142503455 17:347255-347277 TATTTATTTTTTTAAAATCTGGG - Intronic
1142704528 17:1686070-1686092 GAAATCTATTTTTTAATGCTGGG + Intergenic
1142897286 17:2989664-2989686 GATTTTTTTTTTTAACTGTTGGG + Intronic
1143190564 17:5036985-5037007 TTTTTACATTTTTAAATGGTTGG + Intronic
1143595900 17:7913675-7913697 TATTTATATTTTAAAAAGATTGG + Intergenic
1143603393 17:7964793-7964815 TATATATATTTTAAAAGGCTGGG + Intergenic
1144186000 17:12795525-12795547 GATTTTTTTTTTTTAATGATGGG + Intronic
1145782661 17:27573224-27573246 AATTTTTATTTTTAAATGGCTGG - Intronic
1146412845 17:32603062-32603084 GATTTTTTTTTTTTAATTCTTGG - Intronic
1146632105 17:34477734-34477756 GGTTCATATTTTTTAGTGCTAGG - Intergenic
1147033270 17:37659110-37659132 AATGTGTATTTTTAAAAGCTGGG - Intergenic
1148373120 17:47116007-47116029 ACTTTATATTTAAAAATGCTAGG + Intergenic
1148523439 17:48305079-48305101 TTTTTATATTTCTAAATGGTTGG + Intronic
1148992648 17:51679849-51679871 GTTATACATTTTTAAATGGTTGG + Intronic
1149135929 17:53364025-53364047 CATTTCTATTTTTAAAGGTTAGG - Intergenic
1149176969 17:53883740-53883762 GTAATATGTTTTTAAATGCTTGG - Intergenic
1149283557 17:55134851-55134873 CATTTATATTATATAATGCTGGG - Intronic
1149289267 17:55200089-55200111 TATTTATATTTTTATTTGCATGG + Intergenic
1149455388 17:56783825-56783847 AATTTTTATTTTTAAGTTCTGGG + Intergenic
1149711637 17:58748077-58748099 CATTTTCATTTTTAAAAGCTAGG + Intergenic
1149871208 17:60183415-60183437 GATTTCAATTTGTAAATGGTCGG - Exonic
1150257406 17:63758722-63758744 TAATTACATCTTTAAATGCTTGG + Intronic
1150520656 17:65864265-65864287 GAGTCATATTTTAAGATGCTGGG + Intronic
1150695579 17:67402267-67402289 GTTTTGCATTTTTAAATGGTTGG - Intronic
1150881679 17:69036392-69036414 CTTTTACATTTATAAATGCTTGG - Intronic
1151098205 17:71523552-71523574 GTTTTGTCTTTTTAAGTGCTTGG - Intergenic
1151142089 17:72003383-72003405 TTTTTACATTTTTAAATGGTTGG - Intergenic
1152166722 17:78713073-78713095 TATATATATTTTTTAATGTTGGG - Intronic
1152787426 17:82256104-82256126 GATTTGTATATTTCAATCCTGGG - Intronic
1153256375 18:3175759-3175781 TATTTATCTTTTTATATACTTGG - Intronic
1153530450 18:6040946-6040968 GTTTTACTTTTTTAAATTCTAGG - Intronic
1154040601 18:10851645-10851667 TTTTTACATTTTTAAATGGTTGG + Intronic
1155124243 18:22855519-22855541 GATTTTTATTTTTATGTGCCTGG + Intronic
1156210773 18:34939525-34939547 GATTTATTTTTTCAAAGGCTAGG - Intergenic
1156256173 18:35398722-35398744 CATTTATCTTTTTAAATAGTGGG + Intergenic
1156437452 18:37147982-37148004 TATTTTTATTTTTAAGTTCTAGG + Intronic
1156664314 18:39386849-39386871 GATATATATTTCTCAATGTTGGG - Intergenic
1156726698 18:40137087-40137109 TTTTTACATTTTTAAATGATTGG - Intergenic
1156996395 18:43473288-43473310 GATCTATAGTTTTAAGTGGTAGG - Intergenic
1157079851 18:44511742-44511764 GTTTGATTTTTTTAAATGTTTGG + Intergenic
1157160142 18:45306594-45306616 TTTTTACATTTTTAAATGGTGGG - Intronic
1157216225 18:45785874-45785896 GATATTTATTTTAAAATGATAGG - Intergenic
1157311410 18:46555995-46556017 GATTCACATTTTTAAATGGCTGG + Intronic
1157328649 18:46687155-46687177 ATTTTATATTTTTAAATGGTTGG + Intronic
1157346796 18:46844691-46844713 TTTTTTTTTTTTTAAATGCTTGG + Intronic
1157970457 18:52261663-52261685 GATTTTTGTTTTTTAATGCCAGG + Intergenic
1158320290 18:56254748-56254770 CTTTTATATTTTTAAATGTTTGG + Intergenic
1158762358 18:60404823-60404845 GACTTTTATTTATAGATGCTAGG - Intergenic
1158839762 18:61372593-61372615 GATTTTCATCTTTAAATGGTTGG + Intronic
1158913416 18:62093196-62093218 CATTTATGTTTTTAAATATTAGG - Intronic
1159238212 18:65705671-65705693 GACTTATAATTTAAAATGGTTGG + Intergenic
1159248401 18:65839931-65839953 GTTTTACATTTTTAAATGATTGG + Intronic
1159361948 18:67416695-67416717 GATCTATACATTTAAATGATGGG - Intergenic
1159384097 18:67700218-67700240 CATTAATATTATTAAAAGCTAGG - Intergenic
1159698919 18:71598949-71598971 GATTCATATATTTAAGAGCTAGG + Intergenic
1159717358 18:71842176-71842198 TATTTATATTTTAAAATAATAGG - Intergenic
1159971425 18:74659177-74659199 GATTTTTATTTTTCAAAGATTGG + Intronic
1160055101 18:75471617-75471639 GACTTATATTTTTCAGAGCTAGG - Intergenic
1160158238 18:76450241-76450263 GATTTATTTTTTTAACTTTTAGG - Intronic
1160280133 18:77482059-77482081 GATGTATATTTAAAAATGCATGG - Intergenic
1161737062 19:5997806-5997828 GCTTTACATTTTGAAATGGTTGG + Intronic
1163249391 19:16117544-16117566 GGGTTATATTTTTGAAGGCTGGG + Intronic
1163280479 19:16313651-16313673 GATTTACATTTATGAATGGTTGG - Intergenic
1164689161 19:30195739-30195761 AATATCTATTTTTAAAAGCTGGG - Intergenic
1165848749 19:38836589-38836611 TTTTTTTTTTTTTAAATGCTAGG - Exonic
1166203384 19:41253141-41253163 GATTTAAATGTTTAAGTGCTAGG + Intronic
1166830810 19:45638709-45638731 TATTTATTTTTTTAAAGGCAGGG + Intronic
1168438474 19:56342423-56342445 GATCTTTATTTTTAAATTCTTGG + Intronic
1202682615 1_KI270712v1_random:21787-21809 GTTTTTTATTTTTATATGGTAGG - Intergenic
924964614 2:63857-63879 GATTTATATTTGTATTTTCTTGG + Intergenic
925044521 2:762052-762074 AATCTCTATTTTTTAATGCTAGG + Intergenic
925533487 2:4890848-4890870 TATTTATATTCTCCAATGCTGGG - Intergenic
925677476 2:6379559-6379581 GATTAAAATTTTAAAATGATGGG + Intergenic
925822307 2:7811809-7811831 AATTTAAATTTTTAAATCCTTGG - Intergenic
925839393 2:7977429-7977451 TTTTTATATTTTCAAATGGTTGG - Intergenic
926181657 2:10649936-10649958 GTTTTACATTTTTAAATGGTTGG - Intronic
926369187 2:12163237-12163259 TATTTATGTTTTTCAATGCCCGG - Intergenic
926395859 2:12441454-12441476 GATTTTTTTTTTTAAGTACTTGG - Intergenic
926523320 2:13944838-13944860 TATTTATATTTGGAAATGCGTGG + Intergenic
926539763 2:14160738-14160760 TATATATATTTTTAAATATTGGG - Intergenic
926551134 2:14302074-14302096 TATTTGTATTTTTAAATGGTAGG - Intergenic
927412431 2:22842638-22842660 GATTTATATTATTAGAACCTAGG + Intergenic
927446626 2:23167981-23168003 TTTTTATATTTTTAAATCATTGG + Intergenic
927617609 2:24614870-24614892 TATTAATATTGTTATATGCTAGG + Intronic
927876733 2:26661659-26661681 CAGTTATATTATGAAATGCTGGG - Intergenic
928181173 2:29070111-29070133 TATATATATTTTTAAGTTCTGGG + Intronic
928479768 2:31670383-31670405 AATTTATATTTCTGTATGCTTGG + Intergenic
928573668 2:32632886-32632908 GTTTTACATTTTTAAAGGGTTGG + Intronic
928664563 2:33537654-33537676 AATTTATATTTATAGAGGCTGGG - Intronic
928951340 2:36816072-36816094 GATTTATATTTTGAAGTTTTTGG - Intergenic
929130866 2:38569201-38569223 GGATTATATTCTTAGATGCTTGG + Exonic
929251653 2:39763665-39763687 AAATTATATTTTTAAATGAAAGG - Intronic
929473653 2:42222360-42222382 TTTTTATATTTTTAAATGGTTGG + Intronic
929534948 2:42775798-42775820 CATTTATCTTTTTACATTCTTGG - Intronic
930041980 2:47132281-47132303 GAGTTATATTATAAAATCCTAGG + Intronic
930197096 2:48521049-48521071 GTTTTATTTTTTTAGAGGCTGGG - Intergenic
930417712 2:51109854-51109876 GATTTTTCTCTTTAAATTCTAGG + Intergenic
930430832 2:51273948-51273970 GAATTATATTTTGAAAGACTAGG - Intergenic
930541237 2:52709561-52709583 CATTTATATCTTTAAAAGTTTGG - Intergenic
930651273 2:53967263-53967285 TTTCTATATTTTTAAATACTTGG - Intronic
930992809 2:57680576-57680598 AATTTATAGTTTTAAATATTTGG - Intergenic
931041054 2:58300967-58300989 GAATTAAATTTTTAAAAGCTGGG - Intergenic
931693715 2:64856726-64856748 GAATTATGTTTTTAAAAGATGGG - Intergenic
931894139 2:66710471-66710493 GAATTTTATTTTTAATTTCTTGG - Intergenic
932044109 2:68329828-68329850 GCCTCATATTTTTAAATGGTTGG + Intergenic
932402131 2:71488335-71488357 GTTTTTTATATTTAAATGTTTGG + Intronic
932554473 2:72808620-72808642 AATTAATTTTTTAAAATGCTAGG + Intronic
932846373 2:75139652-75139674 GATTTACATGTTTATATGTTGGG - Intronic
933171291 2:79128878-79128900 CCTTTATATTTTTATATTCTAGG + Intergenic
933667442 2:84975059-84975081 TATTTGTATTTTTGAATGGTGGG - Intronic
933668999 2:84989013-84989035 TTTTTACATTTTTAAATGATAGG - Intronic
934051693 2:88216410-88216432 TTTTTACATTTTTAAATGATTGG + Intergenic
934144657 2:89079684-89079706 GAATGATATATTTAAATGCTGGG - Intergenic
934224596 2:90120867-90120889 GAATGATATATTTAAATGCTGGG + Intergenic
934789339 2:97045228-97045250 GGATTACATATTTAAATGCTGGG + Intergenic
935071468 2:99698013-99698035 GAATTATATTTTGAACAGCTGGG - Intronic
935105218 2:100036459-100036481 AATTCATTTTTTTAAATGCAAGG - Intronic
935491640 2:103728361-103728383 TATTTTTATTTTTAAGTTCTGGG + Intergenic
935732761 2:106078111-106078133 TATTTCTATTTTTAAATGAGAGG - Exonic
936405916 2:112202438-112202460 TATATATATTTTTAAGTGCAGGG + Intergenic
936558645 2:113517602-113517624 GAGGTTTATTTTTAATTGCTAGG - Intergenic
937486397 2:122319427-122319449 GAGTTAAATTTATAAATGCTAGG + Intergenic
937564348 2:123265577-123265599 GTTTAATTTTTTTAAATGTTTGG - Intergenic
937976678 2:127586656-127586678 GTTTTATTTTTTGAAATGATAGG + Intronic
938316217 2:130330790-130330812 GATTTAAATTTATAAAAGCTTGG + Intergenic
938700072 2:133869120-133869142 AAATTATATTTCTACATGCTAGG + Intergenic
939472337 2:142639144-142639166 TATTTATATTTTTTGTTGCTGGG - Intergenic
939580375 2:143939362-143939384 GATTTATTTTTTTAAATGGGTGG + Exonic
940394796 2:153175723-153175745 GACTCATATTTTTAAATGTAAGG + Intergenic
940829196 2:158449164-158449186 CAGTTGTATTTTTATATGCTAGG - Intronic
941160222 2:162027097-162027119 GTTTTACATTTTTAAGTGGTTGG - Intronic
941266770 2:163372107-163372129 TATTTATATTTTTAATTTTTTGG - Intergenic
941378320 2:164758987-164759009 CATTTAATGTTTTAAATGCTAGG - Intronic
941714778 2:168752259-168752281 CATTTATTTTTTTAAAAGATGGG - Intronic
941774911 2:169382629-169382651 GTTTTATAGTTTTATATGTTAGG - Intergenic
941854496 2:170217016-170217038 TTTTTACATTTTTAAATGATTGG + Intronic
941936792 2:170988132-170988154 TTTTTTTTTTTTTAAATGCTGGG - Intergenic
941948390 2:171126165-171126187 GATTTACATTTGTAAATTTTGGG - Intronic
941958807 2:171232511-171232533 ACTTTATATTTTCAAATGTTAGG + Intergenic
942011278 2:171765024-171765046 AATGTACATTTTTAAATGCAAGG + Intergenic
942313497 2:174678119-174678141 GAAAGATATTTTTAAATGTTTGG + Intronic
942353973 2:175086746-175086768 GATTAAAATTCTTGAATGCTTGG - Intronic
942356202 2:175113557-175113579 CATTTACATTTTAACATGCTGGG + Intronic
942391605 2:175500908-175500930 GAGTTTGATTATTAAATGCTTGG + Intergenic
942512601 2:176718118-176718140 GCTGTATATTTTTAAAGGATTGG - Intergenic
942766984 2:179468939-179468961 GAAATATATTTTTAAAGGATTGG - Intronic
942866465 2:180681584-180681606 GTTTTACATTTTTAAATGATTGG - Intergenic
943087257 2:183327230-183327252 TTTTTATATTTTTCAATGCTGGG + Intergenic
943111748 2:183615309-183615331 TGTTTCTATTTTTAAATTCTTGG - Intergenic
943116670 2:183680984-183681006 TATACATATTTTTAAATCCTAGG - Intergenic
943268446 2:185768140-185768162 GTTTCAGATTTTTATATGCTTGG + Intronic
943444036 2:187960777-187960799 AATATATTTTTTTAAATACTTGG - Intergenic
943582699 2:189703237-189703259 GATTTATGTTTTGAAAAACTGGG + Intronic
943635228 2:190299628-190299650 CTTTTATTTTTCTAAATGCTAGG + Intronic
943715315 2:191145346-191145368 TTTTTATATTTTTAAGTGATTGG - Intronic
943777212 2:191779156-191779178 GATTTAGATTTTTCTATACTAGG + Intergenic
943959220 2:194239785-194239807 TATTTTTATTTTTAATTACTTGG - Intergenic
944001726 2:194847529-194847551 GATATACATTTTTAAACTCTAGG - Intergenic
944013740 2:195006436-195006458 CAAGAATATTTTTAAATGCTGGG - Intergenic
944340846 2:198596987-198597009 CAGTTCTATTTTTGAATGCTTGG + Intergenic
944458344 2:199918292-199918314 GAGTTATCTTTTTAAAGCCTTGG + Intronic
944630633 2:201620142-201620164 TATTTATATTTTTAACTTTTAGG - Intergenic
945286247 2:208085464-208085486 AGTTAATATTTGTAAATGCTTGG - Intergenic
945368139 2:208981631-208981653 TAAGTATTTTTTTAAATGCTAGG + Intergenic
946715817 2:222554233-222554255 CATTTCCATTTTTAAAAGCTGGG - Intronic
946883350 2:224198070-224198092 GACTTATATTTTTAATTGCCAGG - Intergenic
946896848 2:224332865-224332887 GATTAATTTTTTTAAATGACAGG + Intergenic
946902044 2:224382323-224382345 GTTTTCTATTTTTATATGGTTGG - Intronic
947042643 2:225941199-225941221 GATTTACATTTTAAAAAGTTTGG + Intergenic
947693680 2:232163842-232163864 TTTTTACATTTTTAAATGGTTGG + Intronic
947834927 2:233168658-233168680 GTTTTACATTTGTAAATGGTTGG - Intronic
947870568 2:233435404-233435426 CTTTTAAATTTTTAAATGATTGG + Intronic
948000690 2:234564461-234564483 TATTTATTTTTTCAAAAGCTAGG + Intergenic
948260345 2:236599841-236599863 AATTTTTATTTTTAAGTGCCGGG + Intergenic
948485015 2:238274994-238275016 TCTTCATATTTTTAAATGTTTGG - Intronic
948617500 2:239210369-239210391 GATTTCGATTATTAAAAGCTCGG + Intronic
948843028 2:240666689-240666711 AATTTATTTTTTTATATGGTTGG + Intergenic
948971721 2:241433486-241433508 GGTATATATTTTTAAAATCTAGG - Intronic
1168887846 20:1272634-1272656 GATGTAAAGTTTTAGATGCTGGG + Intronic
1168930626 20:1620465-1620487 CATTTATATTTATAAAAGTTCGG - Intergenic
1169032768 20:2424104-2424126 CATTTAAATTTCTAAATCCTAGG - Intronic
1169272991 20:4215122-4215144 ATTTTACATTTTTAAATGATTGG - Intergenic
1169754706 20:9031503-9031525 AATTTATCTTTTTAAATTATAGG - Intergenic
1170215578 20:13887707-13887729 GATTTATTTTTCTAATTCCTTGG + Intronic
1170272756 20:14546950-14546972 CAATTATATTTTTAAACGTTGGG + Intronic
1170332214 20:15225714-15225736 CATTTATACTATGAAATGCTAGG - Intronic
1170528727 20:17267671-17267693 GATGTTCATTTTTAAATGATGGG + Intronic
1170621559 20:18000649-18000671 TTTTTACATTTTTAAATGTTTGG + Intronic
1170748054 20:19118334-19118356 GATTTATATTTTTACAAACGAGG + Intergenic
1171780965 20:29417350-29417372 GATATAATTTCTTAAATGCTTGG + Intergenic
1173050393 20:39553875-39553897 TCTTTATCTTTTTATATGCTTGG - Intergenic
1173715635 20:45201698-45201720 GCTTTATATCTTTAGGTGCTTGG + Intergenic
1174116217 20:48228225-48228247 GAGTTATATTTTGCTATGCTTGG - Intergenic
1174228301 20:49022941-49022963 GATTTATTTTTTTAAGAGATGGG - Intronic
1174427417 20:50442011-50442033 GCTAAACATTTTTAAATGCTGGG - Intergenic
1174696282 20:52562257-52562279 TAATTACATTTTTAACTGCTTGG - Intergenic
1174746315 20:53066799-53066821 AAGCTATTTTTTTAAATGCTAGG + Intronic
1174783073 20:53407927-53407949 TTTTTACATTTTTAAATGGTTGG - Intronic
1174857647 20:54061945-54061967 GTTTTAAATTTATAAATGGTTGG + Intronic
1174943334 20:54956550-54956572 AATTTATTTTTTTAAAATCTTGG + Intergenic
1175270290 20:57729109-57729131 CCTTTACATTTTTAAATGGTTGG + Intergenic
1175514551 20:59560592-59560614 GTTTTATATTTTTAAAAACATGG + Intergenic
1176988064 21:15461167-15461189 GGTTTTTATTTTTAAATCCTTGG + Intergenic
1177038491 21:16075228-16075250 GAATTATATTTTTAAATAATTGG - Intergenic
1177091844 21:16779183-16779205 CCTTTATATCTTTAAATCCTGGG - Intergenic
1177144132 21:17389295-17389317 GATTTGTATTTTTTTATTCTTGG - Intergenic
1177425152 21:20913566-20913588 GGTTTATATTTGTCAATGCCTGG - Intergenic
1177434048 21:21027249-21027271 TATTTATATTTTCCATTGCTAGG + Intronic
1177475398 21:21614250-21614272 AAATTATTTTTTAAAATGCTTGG - Intergenic
1177655028 21:24005429-24005451 GATTTATACTTTTAAATGCATGG - Intergenic
1177828144 21:26106735-26106757 GATTTTGATTTTTAAATGGAAGG - Intronic
1178236536 21:30848636-30848658 GCATTATATATTTAACTGCTAGG + Intergenic
1178329946 21:31679770-31679792 GATTACCTTTTTTAAATGCTTGG + Intronic
1178667879 21:34564734-34564756 TATTTATATTTTAAAATCCTGGG + Intronic
1178681719 21:34677902-34677924 GACTTATGTTTTTAAATGGTTGG + Intronic
1178757011 21:35360954-35360976 TTTTTATATTTTTAAATGGTTGG + Intronic
1179048375 21:37867424-37867446 TATTTTTATTTTTAAAAGTTAGG + Intronic
1179136148 21:38681798-38681820 GTTTTACACTTTTAAATGGTTGG - Intergenic
1179312468 21:40208830-40208852 GTTTTAGATTTTTAAATGAAAGG - Intronic
1179392355 21:41005282-41005304 TTTTTACATTTTTAAATGGTTGG - Intergenic
1179669753 21:42938369-42938391 GACTTTTATTTTTAAATGTACGG + Intergenic
1179933124 21:44584903-44584925 CATTTATATTTTCAAATTTTAGG + Intronic
1180072946 21:45446568-45446590 GTTTTAATTCTTTAAATGCTTGG - Intronic
1180213961 21:46313284-46313306 GTTTTACATTTTTACATGTTTGG - Intronic
1180324006 22:11351765-11351787 CATTTTTCTTTTTAAATGATAGG + Intergenic
1180458933 22:15540574-15540596 GATTTATACTTTAAAAAGATGGG - Intergenic
1180662910 22:17484540-17484562 TTTTTATATTTTTTAATGGTGGG - Intronic
1181654094 22:24280912-24280934 GTTTTGCATTTTTAAATGGTTGG - Intronic
1181819644 22:25465694-25465716 TTTTTACATTTTTAAATGGTTGG - Intergenic
1182387014 22:29952485-29952507 GTTTTATCTTTTTCAATGCATGG + Intronic
1182406140 22:30132956-30132978 AATTTATTTATTTTAATGCTAGG - Intronic
1182561477 22:31163067-31163089 TTTTTACATTTTTAAATGATGGG + Intronic
1183008062 22:34919915-34919937 GTTTTATCTTTTTATATGGTGGG - Intergenic
1183056001 22:35306156-35306178 TCTTTATATTTTTAAATAGTTGG - Intronic
1183141429 22:35944770-35944792 GATTTGTTTTTTTCATTGCTTGG - Intronic
1184020889 22:41820725-41820747 GACTCATTTTTTCAAATGCTTGG + Intronic
1184539186 22:45108619-45108641 AATATACATTTTTAAAAGCTGGG + Intergenic
949299327 3:2565247-2565269 TATTCATATTTTCAGATGCTTGG + Intronic
949332393 3:2936774-2936796 GTTTTACATTTTTAAATGGTAGG + Intronic
949411602 3:3771409-3771431 TTTTTACATTTTTAAATGATTGG - Intronic
951074380 3:18371389-18371411 TATATATATTTTTAAATGGGTGG + Intronic
951300355 3:20989015-20989037 GATTTTTTTTTTTAAGTTCTAGG + Intergenic
951323565 3:21276271-21276293 TATTTATATTTATATATGCTGGG - Intergenic
951947103 3:28150807-28150829 GCTTTATATTTTTATAAGTTTGG + Intergenic
952010489 3:28895192-28895214 GTTTTATAATTTTAAATGGTTGG + Intergenic
952044346 3:29300052-29300074 GACATATATTTTTGAGTGCTTGG - Intronic
952187976 3:30991482-30991504 GATTTATATTGTAAAATAATAGG - Intergenic
952204330 3:31164785-31164807 GATTTTTTTTTTTTAATCCTGGG - Intergenic
952688080 3:36172532-36172554 GATTTATTTTCCCAAATGCTGGG - Intergenic
952911707 3:38194767-38194789 TATTTATATTTTTTAATTTTGGG - Intronic
952979869 3:38726094-38726116 AATATATATTTTTAAATACTTGG - Intronic
952993445 3:38854069-38854091 GTTTTACATTTTTAAATGTTTGG + Intronic
953111136 3:39939413-39939435 GCTTTATTTTTTTAACTGCATGG - Intronic
954352561 3:50057165-50057187 GATTACATTTTTTAAATGCTTGG + Intronic
954412521 3:50377049-50377071 GTTTTATGTTTTTAAATGGCTGG + Intronic
954927005 3:54244711-54244733 GATTTAAATATTAAAATGTTTGG - Intronic
955150836 3:56365620-56365642 TTTTTAAATTTTTAAATGCTTGG + Intronic
955624620 3:60904638-60904660 AATATATATTTTAAAATTCTTGG + Intronic
955636676 3:61037488-61037510 TATATATATTTTAATATGCTGGG - Intronic
955752969 3:62201353-62201375 GCTTTATATTTTTAAATGGTTGG + Intronic
955965090 3:64380861-64380883 GTTTGATTTTTTTATATGCTAGG - Intronic
955971149 3:64439818-64439840 GAGTTACATTTTTAGATGGTTGG - Intronic
956387339 3:68734225-68734247 GTTTTACATTTTTAAGTACTTGG - Intronic
956835377 3:73092175-73092197 ATTTTTTATTTTTAAATGCAGGG + Intergenic
957452282 3:80394593-80394615 CATTTAAATATTAAAATGCTAGG - Intergenic
957979089 3:87485400-87485422 GATATATTTTATTAAATTCTTGG - Intergenic
958104181 3:89051931-89051953 GATGGACATTTTTAAATGCTTGG + Intergenic
958167170 3:89890987-89891009 GGTTTACATTTTTAAAATCTTGG - Intergenic
959344121 3:105171760-105171782 GATTTTTTCTTTTAAATTCTGGG - Intergenic
959393914 3:105812020-105812042 GTTTTGTTTTTTTAAATACTTGG + Intronic
959861267 3:111217500-111217522 GATTTATATTTTTAAATGCTTGG - Intronic
959949858 3:112167483-112167505 GATTAATATCTTAAAATACTTGG + Intronic
960067515 3:113389920-113389942 GATTGGTATTCTTAAATGTTTGG - Intronic
960235206 3:115274001-115274023 AATTTTTATTTTTAAGTTCTGGG + Intergenic
960359875 3:116698095-116698117 AAATTATAATTTTACATGCTAGG - Intronic
960410999 3:117324436-117324458 AATATATTTTTTTAAATGCCTGG - Intergenic
961084408 3:124054349-124054371 TATTTTTATTTTTAAGTGATGGG - Intergenic
961130408 3:124461129-124461151 CTTTTATATTTTTAAATAATTGG + Intronic
961320830 3:126073781-126073803 GTTATTTTTTTTTAAATGCTTGG - Intronic
961401338 3:126646838-126646860 GCTTTATACTTTTGAATTCTTGG - Intronic
961778752 3:129308727-129308749 AATGTATATTTTAAAATGTTTGG - Intergenic
962057764 3:131890757-131890779 GTTTCTTATTTTTCAATGCTAGG - Intronic
963013104 3:140793833-140793855 TACTTATATTTTAAACTGCTAGG - Intergenic
963048000 3:141117511-141117533 TATTTTTATTTTTAAGTTCTAGG + Intronic
963563188 3:146893355-146893377 GATTTATAATTTTTTATACTGGG - Intergenic
963894298 3:150669087-150669109 GCTTTATTTTTATAATTGCTTGG + Intronic
963921905 3:150913856-150913878 ATTTTATATTTTTAAATAGTAGG + Intronic
964069488 3:152614406-152614428 AAGTTATATTTTTAAAAACTAGG + Intergenic
964085219 3:152809080-152809102 CATTTTTATTTTTAAATGAATGG + Intergenic
964158657 3:153618582-153618604 GCTTTATATTTTTAAATGCCTGG - Intergenic
964237586 3:154551181-154551203 CATTTTAATTTTTAATTGCTTGG - Intergenic
965264819 3:166529602-166529624 GATTTATTTTATTAACTACTGGG + Intergenic
965302890 3:167025185-167025207 AATTTGTATTTTTAAATTGTTGG + Intergenic
965357839 3:167699026-167699048 GTATTATTTTTTTAAAGGCTAGG - Intronic
965498510 3:169428604-169428626 GATTTATATATTCATTTGCTAGG - Intronic
965896862 3:173588144-173588166 ATTTGATATTTTTCAATGCTTGG - Intronic
966026648 3:175292323-175292345 GATTTATAGTTTTAGATCATGGG + Intronic
966186757 3:177234084-177234106 AATTTTTATTTTTAAATTTTTGG + Intergenic
966305246 3:178525434-178525456 GATTATTATTTTTAAAAACTTGG - Intronic
966864983 3:184253251-184253273 GATTTTTATTTTTATATCCCTGG - Intronic
967172730 3:186835876-186835898 TATTTATCTTTTTTAATGCTAGG - Intergenic
967525387 3:190486790-190486812 GATTTGAATTTACAAATGCTGGG - Intergenic
967621011 3:191633572-191633594 GATTTAAAATCTTAAATCCTGGG - Intergenic
967797940 3:193618627-193618649 GTTATATATTTTTAATTGTTAGG + Intronic
968019955 3:195376672-195376694 GATTTATTTTATTAAATGACTGG + Intronic
968148444 3:196318804-196318826 AATATATATTTTTAAAAGCGGGG - Intronic
968179132 3:196577964-196577986 GATTTTTTTTTTTTAATGTTAGG + Intronic
968857217 4:3135020-3135042 TACTTATATTTTAAAATTCTAGG - Intronic
969094801 4:4724205-4724227 GTTTCATATTTTTTAATGGTAGG + Intergenic
969973624 4:11074123-11074145 GATTTACACTTTTAAATACAAGG - Intergenic
970017466 4:11528740-11528762 GAGATATTTTTTTAAATGCCAGG - Intergenic
970409969 4:15795597-15795619 TATTTATTTTTTTAAATCGTGGG - Intronic
971000664 4:22318463-22318485 GATTTAAATTTTTAAACACAAGG + Intergenic
971141426 4:23929121-23929143 GATTTTGATTTTTAAATTCCAGG - Intergenic
971383760 4:26124739-26124761 GTGTTATATTTTTATATGCCTGG + Intergenic
971545023 4:27875099-27875121 GATTTATAATGGTAAATGTTTGG - Intergenic
971594018 4:28505040-28505062 CATTTATCTTTTTAAATTCATGG + Intergenic
971869038 4:32212028-32212050 AACTTATATTTATAAATGATAGG + Intergenic
971983683 4:33791054-33791076 CATTTATATTTTTATTTCCTAGG - Intergenic
972009172 4:34153765-34153787 AATTTATATTATTAAAAGGTGGG - Intergenic
972038765 4:34561968-34561990 TGTTTTTTTTTTTAAATGCTAGG - Intergenic
972092132 4:35300788-35300810 GACTTTTATTTTTAGATTCTAGG + Intergenic
972159745 4:36208875-36208897 GATTTATATTTTTCCATTTTAGG - Intronic
972310873 4:37881103-37881125 ATTTTACATTTTTAAATGGTTGG + Intergenic
972592987 4:40505579-40505601 TATATATGTTTTTAAATTCTAGG - Intronic
972706695 4:41551636-41551658 TTTTTATATCTTTAAATGGTTGG + Intronic
972754673 4:42033477-42033499 TATTTTTATTTTTAAATTTTTGG - Intronic
972778023 4:42261203-42261225 GATTTATTTTTTTAAAGGGATGG + Intergenic
972782208 4:42295810-42295832 GCCATATATTTTTAAATGATGGG - Intergenic
972929773 4:44057449-44057471 GATTTATATTATTAAAATCACGG - Intergenic
973001096 4:44951695-44951717 GATTATTACTCTTAAATGCTGGG + Intergenic
974708895 4:65561659-65561681 GATTTAAATCTTTCAATGCCTGG + Intronic
974918539 4:68207490-68207512 GGTCTATTTTTTAAAATGCTTGG + Intergenic
974922414 4:68258255-68258277 AAATTAAATTTTTAAAAGCTAGG + Intergenic
975013828 4:69385971-69385993 GGTACATATTTTCAAATGCTGGG + Intronic
975015089 4:69405320-69405342 GGTACATATTTTCAAATGCTGGG + Intronic
975357052 4:73419400-73419422 GATTTATAATCTTAAATGATGGG + Intronic
975939084 4:79619022-79619044 TATGTATATTTATAAATGATTGG + Intergenic
975987180 4:80211694-80211716 GAATTAGATTTTTGAATGTTAGG - Intergenic
976108995 4:81650781-81650803 GATTTTTATTTTTTAAAACTGGG + Intronic
976244529 4:82993919-82993941 TATTTACATTTTTAAATGGTTGG + Intronic
976578705 4:86708405-86708427 AAATTACATTTTTAAATACTAGG + Intronic
976723138 4:88189505-88189527 TATTTATATTTTTAGATGCAGGG - Intronic
976899179 4:90152846-90152868 GATTTGTATTTGTCAGTGCTAGG + Intronic
977251768 4:94696320-94696342 CATGTATATTTTTAAATTATTGG + Intergenic
977422323 4:96817555-96817577 GATTTTTATTTTTAAAAGGATGG + Intergenic
977582143 4:98737055-98737077 AATTTTTATTTTTAAATTCTGGG + Intergenic
977655107 4:99512537-99512559 GATATACATTTTAAGATGCTGGG + Intronic
977809121 4:101338415-101338437 GATTTAAATTTCTAAATTATGGG - Intronic
977880090 4:102194192-102194214 GACCTATATTGTTAAATGCATGG + Intergenic
978160911 4:105546935-105546957 TATTTATATTTTTAAAATATGGG - Intergenic
978503325 4:109432598-109432620 GATTTATATCTTTGACTTCTAGG - Intergenic
978706276 4:111715665-111715687 TTTTTATATTTCTAAATGGTTGG + Intergenic
978868566 4:113546078-113546100 GATTCACATTTTTTAATACTTGG + Intronic
978972427 4:114825855-114825877 GAGTTACACTTTTAAATGCCAGG + Intergenic
978997048 4:115169722-115169744 GCTTAAAATTTTTAAATGTTTGG - Intergenic
979125181 4:116962462-116962484 AATTTATATGTTTAAAAGCTAGG + Intergenic
979155598 4:117385218-117385240 AATTTTTATATTTAAATGTTAGG + Intergenic
979383716 4:120038999-120039021 TATTTTTATTAGTAAATGCTTGG - Intergenic
979401831 4:120258384-120258406 ATTTTCTATTTTTAAATGATAGG + Intergenic
979541055 4:121882777-121882799 GATGTATTTTTCTAAATACTGGG - Intronic
979636650 4:122962628-122962650 GTTTTATATTTTTATAGTCTTGG - Intronic
979890601 4:126088229-126088251 GATTAACATTTGTTAATGCTAGG - Intergenic
979935977 4:126696478-126696500 TATTTTTATTTTTAAATGTGTGG - Intergenic
979954604 4:126936396-126936418 GTTTTATATTTTTCAAGGGTGGG - Intergenic
980057345 4:128090983-128091005 TATTTTTATTTTTAAAAGGTTGG + Exonic
980144039 4:128958567-128958589 GATGTTTATTTTTAATGGCTTGG + Intronic
980288116 4:130807206-130807228 TATTTGGATTTTTAACTGCTAGG + Intergenic
980288125 4:130807348-130807370 TATTTGGATTTTTAACTGCTAGG + Intergenic
980376813 4:131959970-131959992 TTTTTGGATTTTTAAATGCTTGG - Intergenic
980430941 4:132694032-132694054 GAATAATTTTATTAAATGCTTGG - Intergenic
980447162 4:132924059-132924081 AATTTATATTTTTTATTGCCTGG - Intergenic
980822393 4:138034908-138034930 TATTTAAATATTTAAATGCCTGG - Intergenic
980835930 4:138192729-138192751 GATTTTCATCTTTAAAAGCTAGG + Intronic
980915307 4:139027880-139027902 CTTTTATATTTTTAAATGGTAGG - Intronic
981018383 4:139999611-139999633 AACATTTATTTTTAAATGCTGGG + Intronic
981059582 4:140408051-140408073 AATTTATATTTTTGTATGCTTGG - Intronic
981416787 4:144503241-144503263 CTTTTATATTTTTAAAGGGTTGG + Intergenic
981749432 4:148079774-148079796 GTTTTAGATTTTTAAAAGGTAGG - Exonic
981778336 4:148395895-148395917 GATTAACATTTTTAAATTCCCGG - Intronic
982250977 4:153406101-153406123 GATTTATATTTCTTTATCCTTGG + Intronic
982501705 4:156165337-156165359 CATTTATATTTGTAGAGGCTGGG + Intergenic
983130171 4:164009361-164009383 GCATTACTTTTTTAAATGCTTGG - Intronic
983800032 4:171916732-171916754 CATTTTTATTTTAAAATGCAGGG + Intronic
983986224 4:174063307-174063329 GATCTGTATCTTTAAATGTTTGG + Intergenic
984336053 4:178392642-178392664 CATTTATATTTTAAAATATTTGG - Intergenic
984537338 4:180993111-180993133 GTATTATAATCTTAAATGCTAGG + Intergenic
984584257 4:181545180-181545202 GATTTATTTTGTTTAATCCTAGG + Intergenic
985828239 5:2208397-2208419 TATTTAAATTTTTACCTGCTTGG + Intergenic
986910867 5:12554601-12554623 GATTTATATTATTAAATATTTGG - Intergenic
987064221 5:14272266-14272288 GTTTTTTATTTTTAAAGTCTGGG + Intronic
987232883 5:15913089-15913111 CATTAACATTTTTAAATGCTTGG - Intronic
987411950 5:17623797-17623819 CATTTTTATTTTTACACGCTGGG + Intergenic
987421991 5:17731119-17731141 TCTTTATATTTTTAAATGGTTGG - Intergenic
987559432 5:19499994-19500016 GATTTATTTCTTTATATTCTGGG + Intronic
987997007 5:25295643-25295665 TATTTAATTTTTTAAAGGCTAGG + Intergenic
989061216 5:37413835-37413857 GATATATATTTTCAAAAGTTTGG - Intronic
989208753 5:38838206-38838228 GTTTTATATTGTTATATGTTGGG - Intergenic
989448691 5:41561827-41561849 AATTTATATTTGTAAGTGTTTGG - Intergenic
989707306 5:44351467-44351489 TATTTCTATTTTTAAATCTTTGG - Intronic
989751546 5:44900520-44900542 GATATATATATTTAAATGAATGG + Intergenic
989796136 5:45475641-45475663 GATTTGTGAGTTTAAATGCTGGG - Intronic
990038122 5:51348074-51348096 GACTTATATTTTCAACTGCTTGG + Intergenic
990109095 5:52301548-52301570 GATTTTTACTTTCAAATGATTGG - Intergenic
990174287 5:53090072-53090094 GCTTTATATTTTAAAATACAGGG + Intronic
991128583 5:63095089-63095111 TTATTATATTTTTAAATTCTAGG - Intergenic
991154659 5:63417544-63417566 TATTTATTTTTTTAAATCATTGG + Intergenic
991380023 5:66011382-66011404 GGATTGTTTTTTTAAATGCTGGG - Intronic
991685442 5:69177866-69177888 GATGTATATGTTTATATACTGGG + Exonic
991957527 5:72010482-72010504 TACTTATATTTTTAAAAGTTGGG + Intergenic
992061122 5:73048647-73048669 CATATATATTTTTAAATAGTTGG + Intronic
992427701 5:76675013-76675035 TATTTTGATTTTTAAATTCTAGG - Intronic
992689289 5:79227529-79227551 TATTTTTATTTTTATATTCTTGG - Intronic
992768627 5:80026678-80026700 TTTTTATAGTTTTAAATGATTGG - Intronic
992790389 5:80208393-80208415 TATTTATATTTTTAAAAAATAGG - Intronic
992938196 5:81733877-81733899 GTTTTGTATCTTTAAATGCATGG - Intronic
993206759 5:84891490-84891512 GTTTTAGCTTTTTAAATGTTGGG + Intergenic
993441309 5:87960289-87960311 TATATATTTTTTTAAATGGTAGG - Intergenic
993612486 5:90072269-90072291 GATTTTTATTTCTATATCCTGGG - Intergenic
993772673 5:91949852-91949874 GATTTGCATTTTTAAATACTAGG - Intergenic
993834516 5:92800957-92800979 GTTTTGTCTTTTTAAATGATTGG - Intergenic
994032628 5:95162041-95162063 GTTTTCTAATTCTAAATGCTTGG - Intronic
994253051 5:97559564-97559586 CATGTATATTTTTAAAAACTTGG - Intergenic
994332442 5:98523039-98523061 TATTTTTATTTTTAAATGGCTGG - Intergenic
994494914 5:100499606-100499628 TATTTTTATTTTTAAATTTTTGG - Intergenic
994515335 5:100764775-100764797 GATTTAAATTTTGAAATTTTTGG - Intergenic
995103598 5:108347461-108347483 CATTTATGTTTTTATATGATAGG - Intronic
995111111 5:108429249-108429271 GTTTTACATTTTAAAATGGTTGG - Intergenic
995162994 5:109003656-109003678 AATTTAAATTTTTGAATGCTTGG - Intronic
995635865 5:114189400-114189422 TATTTAGATTTTTAATTGATTGG + Intergenic
995728183 5:115204140-115204162 AATTTATATTTTAAAAAGATAGG - Intergenic
995909583 5:117169593-117169615 GATTGATATGTTTAAAATCTCGG - Intergenic
996343482 5:122464470-122464492 GAAATATATTTTTACATGATAGG - Intergenic
996855453 5:128000792-128000814 GATTTTTTTTTTTAGCTGCTAGG + Intergenic
996970695 5:129363942-129363964 TATTTAATTTTTTAAATGTTAGG + Intergenic
997318336 5:132956715-132956737 TGTTTACATTTTTAAATGGTGGG - Intronic
997704895 5:135940073-135940095 CTTTTGTATTTTTAAATGGTTGG - Intronic
997844058 5:137269906-137269928 GATTTTTTTTTTTAAAAGCCTGG - Intronic
997968503 5:138380646-138380668 AATTTATATGTATAATTGCTAGG + Intronic
998362670 5:141603047-141603069 AGTTTATATTTTTAAATTCCTGG - Intronic
998608741 5:143664611-143664633 CTTTTACATTTTTAAATGATTGG + Intergenic
998682895 5:144489862-144489884 GATATATGTTTTTAAAGCCTGGG + Intergenic
999010913 5:148039008-148039030 TATTTAAATTTTTAAATGTTAGG + Intronic
999447627 5:151652935-151652957 GTTTTATGTTTTTAAATTTTTGG + Intergenic
999452674 5:151690065-151690087 GATGTATATTTTTATAGGATTGG + Intergenic
999866822 5:155709531-155709553 CACTTATATTTTTAAAAGCCAGG - Intergenic
999943886 5:156574327-156574349 GACTTATATTTTTAAATAGGGGG - Intronic
1000372808 5:160553538-160553560 CATTTATAATTTAAAATGCAAGG + Intergenic
1000517756 5:162260421-162260443 AATTTATATATTTTAGTGCTGGG - Intergenic
1000790819 5:165604914-165604936 GAGTTATAGTTTTAAATGTTCGG + Intergenic
1000852428 5:166356869-166356891 TATATATATTTTTAAACTCTTGG - Intergenic
1000955658 5:167540392-167540414 GTTTTACATTTTTAAATCATTGG + Intronic
1001155655 5:169270401-169270423 TTTTTATATTTTTAAATGGTTGG + Intronic
1001817468 5:174682153-174682175 GTTTTATTTTTTTAAAAGCTTGG - Intergenic
1001817563 5:174682881-174682903 CATTTTTATTTTTAAATTTTTGG - Intergenic
1001892929 5:175354191-175354213 TATTTTTGTTTTAAAATGCTAGG + Intergenic
1001941800 5:175745128-175745150 TTTTTACATTTTTAAATGGTTGG + Intergenic
1002519092 5:179780959-179780981 GATTTAAATTTTTTATTACTTGG - Intronic
1002880637 6:1248822-1248844 TATTTATTTTTTTAAATTTTAGG + Intergenic
1003064149 6:2888884-2888906 AACTTATATTTTTTAATGGTTGG - Exonic
1003601873 6:7525165-7525187 CAATTAGATTTGTAAATGCTGGG - Intergenic
1003884727 6:10511413-10511435 GTTTTATATTTTAAAATGGTTGG - Intronic
1004413314 6:15401450-15401472 AACATTTATTTTTAAATGCTGGG - Intronic
1005007193 6:21299297-21299319 GATTCCTATTTTTAACTGGTGGG + Intergenic
1006714874 6:36111116-36111138 CTTTTACATTTTTAAATGGTTGG + Exonic
1006905626 6:37531390-37531412 GATTTATATTAGTACATGATTGG + Intergenic
1006988873 6:38195996-38196018 GATCTGTATTGTTAAATCCTTGG - Intronic
1007877623 6:45123936-45123958 TTTTTACATTTTTAAATGGTTGG - Intronic
1008002543 6:46375871-46375893 TTTTTATATTTTTAAGTGATTGG - Intronic
1008363856 6:50652562-50652584 GATTTATATTTTTTACAACTTGG + Intergenic
1008415149 6:51230963-51230985 CAATAATATTTTTAAATGTTGGG - Intergenic
1008495577 6:52130192-52130214 TATTTATATTTTTAATTTCTGGG - Intergenic
1008845153 6:55953853-55953875 AATTTATATTTTTAAAGTCAAGG + Intergenic
1008866231 6:56213944-56213966 GTTTTTTATTTTTAAATACTTGG - Intronic
1009546257 6:65023401-65023423 GATTTTTAATTTCAAAAGCTAGG + Intronic
1009602326 6:65817994-65818016 GATTTGCTTTTATAAATGCTGGG + Intergenic
1009803726 6:68575055-68575077 TATTTATCTTTTTAAATATTAGG - Intergenic
1009840718 6:69070267-69070289 TATTCAGATTTTTGAATGCTTGG - Intronic
1010103439 6:72138941-72138963 CTTTTATATTTTTAAATTCTAGG + Intronic
1010267202 6:73880232-73880254 TATTTTTATTTTTAATTGCCTGG - Intergenic
1010387433 6:75298125-75298147 GATGGAGATTTTGAAATGCTAGG - Intronic
1010398174 6:75416361-75416383 GGTTTATATTGTTAAAAGCTGGG - Intronic
1010417629 6:75631530-75631552 TTTTTACGTTTTTAAATGCTTGG + Intronic
1010510966 6:76719124-76719146 GAATTATATGTTAAATTGCTAGG - Intergenic
1011232422 6:85178009-85178031 GAGTTTTATTCTTAAATGCCTGG + Intergenic
1011410651 6:87062688-87062710 GTTTTTTTTTTTTAAATTCTTGG - Intergenic
1011560725 6:88611913-88611935 GACTTCTTTTTTTAAATGCCAGG - Exonic
1011935180 6:92768554-92768576 GATTTATATTTTTGGTTCCTGGG - Intergenic
1012007899 6:93738423-93738445 GAAAAATATTTTTAGATGCTGGG - Intergenic
1012352897 6:98275393-98275415 TATTTCTATTTTTAAAAGCAGGG + Intergenic
1012357314 6:98331539-98331561 TATTTATATTTTTAAAAAGTGGG - Intergenic
1012535406 6:100290937-100290959 GATTAATATTTATATATGATAGG - Intergenic
1012631557 6:101475914-101475936 GATAAATACTTTTAGATGCTAGG + Intronic
1012971872 6:105739639-105739661 GATTAATATATTAAAATGCCAGG - Intergenic
1012975316 6:105774984-105775006 GTTTTATAGTTTTAGATGCCAGG - Intergenic
1013345841 6:109259860-109259882 GATTCTCATTTTTAAGTGCTTGG + Intergenic
1013541945 6:111119472-111119494 TTTTTACATTTTTAAATGGTTGG - Intronic
1013769141 6:113607784-113607806 AACTTATATTATTAAATGCCTGG + Intergenic
1014046544 6:116894958-116894980 GAATAATATTTTTAAAAGCCAGG - Intronic
1014166918 6:118235375-118235397 GATTTATTTGTTTAAATATTTGG + Intronic
1014243557 6:119043108-119043130 CATTTATATTTCTACATTCTAGG - Intronic
1014345129 6:120260407-120260429 GATTTAAATTTTAAAATCCCAGG - Intergenic
1014491151 6:122063587-122063609 TATATATATTTTTTAATTCTTGG + Intergenic
1014527457 6:122518195-122518217 CTTTTACATTTTTAAATGGTTGG - Intronic
1014593365 6:123300850-123300872 GATATTTCTTTTAAAATGCTTGG - Intronic
1014974280 6:127859798-127859820 GAGATATATTTTTATAAGCTAGG + Intronic
1015302590 6:131670793-131670815 GTTTTACATTTTTAAATGGTTGG + Intronic
1015345540 6:132153210-132153232 CATTTCTATGTTTAAATGCTTGG - Intergenic
1015428833 6:133105797-133105819 GTTTTTTATTTTTAATTGTTTGG + Intergenic
1016043792 6:139460366-139460388 GATATAAATGTTTAAATGGTTGG - Intergenic
1016057246 6:139591575-139591597 ATTTTGTATTTTTAGATGCTAGG + Intergenic
1016221525 6:141677297-141677319 CATATATATTTTAAAATGCCAGG + Intergenic
1016488167 6:144566360-144566382 GGTTTATATTATTAAATGTAAGG + Intronic
1016601326 6:145864663-145864685 GAATTAAATTTTAAAATGTTTGG + Intronic
1016901820 6:149110377-149110399 CATTTAAATATGTAAATGCTTGG - Intergenic
1017675297 6:156806991-156807013 GTTTTACATTTTTAAATGGTTGG - Intronic
1017963415 6:159242478-159242500 AATTTTTATTTTTAAGTTCTGGG - Intronic
1018365930 6:163119856-163119878 GTTTTATAGCTTTAAATGTTAGG + Intronic
1019019442 6:168905472-168905494 CATTCATGTTTTTAAATGCCTGG - Intergenic
1019234833 6:170602832-170602854 AATATTTATTTATAAATGCTTGG + Intergenic
1019959435 7:4446669-4446691 TTTTTACATTTTTAAATGCTTGG - Intergenic
1020453832 7:8349185-8349207 TATTTACCTTTTTAAATCCTGGG + Intergenic
1020597096 7:10220620-10220642 ACTTTATATTTTTAAATTTTTGG + Intergenic
1020826073 7:13030312-13030334 AATTAATAATTTTTAATGCTGGG - Intergenic
1021127335 7:16867106-16867128 ATTTTATTTCTTTAAATGCTTGG - Intronic
1021277286 7:18667971-18667993 TATTTATATTTCTAAATCCGAGG + Intronic
1021909845 7:25374295-25374317 GAATGATTTTTTTAAATGTTTGG + Intergenic
1021911866 7:25393510-25393532 GATATATATTTGTAGATACTTGG + Intergenic
1022159220 7:27692159-27692181 CATTTAAATTTTGAAATGATAGG + Intergenic
1022205227 7:28157505-28157527 CTTTTACATTTTTAAATGGTTGG - Intronic
1022392872 7:29958749-29958771 GATTTATTTTATGAAAGGCTGGG - Intronic
1023796036 7:43793112-43793134 TACTTATATTGCTAAATGCTGGG + Intronic
1024531963 7:50400810-50400832 GATTTTTATTTTTAGAGGCAGGG + Exonic
1024571616 7:50727564-50727586 GCTTTATTTATTTAAATCCTAGG - Intronic
1024699196 7:51888695-51888717 GAATTTTATTTTAAAATGCTGGG - Intergenic
1024703745 7:51934591-51934613 GATTGGTATTTTTAAATGTTTGG + Intergenic
1024936454 7:54716740-54716762 GAATTTTATTTTCAAATTCTGGG + Intergenic
1025935223 7:66030343-66030365 AATTTATTTTTTTAAGAGCTGGG + Intergenic
1025949033 7:66129026-66129048 AATTTATTTTTTTAAGAGCTGGG - Intronic
1026272219 7:68846364-68846386 ATTTTATATTTTTAAAGACTGGG + Intergenic
1026342104 7:69443454-69443476 CATTTTTTTTTTTAAATCCTGGG + Intergenic
1027183556 7:75955988-75956010 GTTTTACATTTTTAAAAACTGGG + Intronic
1027631185 7:80608158-80608180 CATATATATTATTGAATGCTGGG - Intronic
1027781277 7:82523542-82523564 GATTTACATTTTAAAAGGTTTGG + Intergenic
1028056957 7:86257240-86257262 TATATATATTTTAAAATGTTTGG - Intergenic
1028223560 7:88223684-88223706 TATTTACATTTTTAAATGGTTGG - Intronic
1028326185 7:89527975-89527997 GACTTACAGTTTTACATGCTGGG + Intergenic
1029208027 7:98880599-98880621 GTTTTATATTTTTAAATGGCTGG + Intronic
1030247569 7:107401094-107401116 TTTTTATATTTTTAAATGGTTGG - Intronic
1030865898 7:114701435-114701457 TCTTTATATTTTTAATTGATTGG - Intergenic
1030883248 7:114907091-114907113 GATTTTTATGTTGAATTGCTTGG - Intergenic
1030948185 7:115753691-115753713 GAGTAATATTTATAAAGGCTGGG + Intergenic
1031047105 7:116903630-116903652 GAAGTATGTTTTTAAATACTTGG + Intronic
1031358536 7:120818571-120818593 GATTTATATTTTTAAATCATAGG - Intronic
1031431435 7:121675588-121675610 GGTTAATATTTTTACGTGCTTGG - Intergenic
1031759489 7:125693947-125693969 ATTTTCTATTTTTCAATGCTCGG - Intergenic
1032271621 7:130413290-130413312 ATTTTATTTTTTTAAATGGTGGG - Intronic
1032336943 7:131034109-131034131 TATTTAAATTTTTAAAAACTAGG + Intergenic
1032560263 7:132883530-132883552 GTTTTACATTTTTAAGTGGTTGG + Intronic
1032594073 7:133221885-133221907 GTTTTATTATTTTAATTGCTGGG + Intergenic
1032995984 7:137447170-137447192 GAGAAATATTTTTAAATGCATGG - Intronic
1033175659 7:139121299-139121321 GGAGTATATTTTCAAATGCTTGG + Intergenic
1033353820 7:140583577-140583599 CTTTTACATTTTTAAATGGTTGG + Intronic
1033384837 7:140863145-140863167 GTTTTATCTTTATAAATGCTGGG - Intronic
1033566421 7:142582684-142582706 TATATATAGTTTTATATGCTTGG + Intergenic
1033830478 7:145245569-145245591 GATTTGTATTTTTACTTCCTTGG - Intergenic
1033870813 7:145751648-145751670 GATTTGTATATTTAATTCCTTGG + Intergenic
1034486207 7:151364818-151364840 GATTTAATTTTTTGAAAGCTAGG + Intronic
1034564810 7:151904599-151904621 TGTTTATATTTTTAAAAACTAGG - Intergenic
1034832215 7:154319284-154319306 GATTTTTATTTTTAAAGACAAGG + Intronic
1036942092 8:13061288-13061310 GTTTTATATTTTTAAATGGTTGG + Intergenic
1036972984 8:13375764-13375786 CATTTATATTTGTCAAAGCTTGG + Intronic
1037047391 8:14324991-14325013 GATTTCTATTTTTGAATATTGGG + Intronic
1037147461 8:15590461-15590483 AATTTATTTTCTTAGATGCTGGG - Intronic
1037192994 8:16150077-16150099 TATACATATTTTTAAATTCTTGG - Intronic
1037424125 8:18736396-18736418 CATGAAAATTTTTAAATGCTGGG + Intronic
1037626489 8:20611832-20611854 GAATTATACTTTTAAGTTCTGGG + Intergenic
1037691819 8:21187234-21187256 TATTTCTATATATAAATGCTTGG - Intergenic
1038028998 8:23620414-23620436 GAGTTTCATTTTTAAAAGCTGGG + Intergenic
1038130948 8:24730976-24730998 GAGTTTTATTTTTAACTACTAGG + Intergenic
1038194481 8:25354098-25354120 GTTTTATATGTTTAAAAGTTGGG + Intronic
1038735920 8:30169443-30169465 GAATTATTTTTCTAAATGGTTGG - Intronic
1039343614 8:36678879-36678901 ACTTTATGTTTTGAAATGCTAGG - Intergenic
1039532673 8:38277581-38277603 GCTTTTTATTTTTAATTGCAAGG + Intronic
1039671126 8:39600366-39600388 GATTTATATTTTAATTTGATTGG + Intronic
1039730579 8:40272115-40272137 GATTTACATTTTTAAAAAATTGG - Intergenic
1040060330 8:43098089-43098111 CTTTTATCTTTTTAAATGTTAGG + Intronic
1040605684 8:48928901-48928923 GACTTTCATTTTTAAATGCAAGG - Intergenic
1040705167 8:50116978-50117000 TACTTAGATTTTTTAATGCTAGG + Intronic
1040715310 8:50244542-50244564 CATATATATTTTTAAATTCTAGG + Intronic
1040761882 8:50856661-50856683 TATTTCTTTATTTAAATGCTTGG - Intergenic
1041308874 8:56493615-56493637 GGTTTATTTTTTTAAATGCAGGG + Intergenic
1041785302 8:61625590-61625612 TATTTATTTTTTTAAATGAGAGG - Intronic
1042053965 8:64742915-64742937 GTTTTTCATTTCTAAATGCTAGG + Intronic
1042238227 8:66636983-66637005 GACAAATATTTTTAAATGATAGG + Intronic
1042421417 8:68594291-68594313 GCTTTATATTTTTAAAGACAAGG + Intronic
1042607489 8:70560301-70560323 GATTTGTCTTTGTAAATACTGGG + Intergenic
1042822312 8:72943851-72943873 GTTTGATTTTTTTAAATCCTAGG + Intergenic
1043267993 8:78290453-78290475 AATTTGTATTTTTAGATGCTAGG - Intergenic
1043566105 8:81549781-81549803 GATTTATTTGTTTAAACACTAGG - Intergenic
1043767933 8:84161188-84161210 GATTAATATTATTAAAAACTAGG + Intergenic
1043925415 8:86030950-86030972 AATTTATCTTTCTCAATGCTGGG + Intronic
1044090934 8:88000227-88000249 GATTTATATTTAGAAATGGGAGG + Intergenic
1044107580 8:88230352-88230374 GAGTTATCTTTTAAAATGTTAGG - Intronic
1044174818 8:89106960-89106982 TATATATATTTTTAAATACCAGG + Intergenic
1044454226 8:92373761-92373783 TTTTTAAATTTTTAAATGGTTGG + Intergenic
1044534971 8:93348064-93348086 TATTTTGATATTTAAATGCTAGG - Intergenic
1045420966 8:102014546-102014568 AGTTAATGTTTTTAAATGCTAGG + Intronic
1045778846 8:105839772-105839794 GTTTTATTTCTTTAAATGGTTGG - Intergenic
1046116121 8:109785703-109785725 TATATATATTTTTTAATTCTGGG - Intergenic
1046418867 8:113952620-113952642 TATTTATTTTTTTAAATTTTTGG + Intergenic
1046820085 8:118624544-118624566 TTTTTACATTTTTAAATGGTTGG + Intergenic
1046960403 8:120106406-120106428 TTTTTATTTTTTTAAATACTAGG + Intronic
1047638161 8:126789576-126789598 AATTTTTATTTTTAAGTTCTGGG + Intergenic
1047682571 8:127269418-127269440 GATTTGTGTTTTGAAATACTTGG - Intergenic
1047791488 8:128208300-128208322 ATTTTACATTTTTAAATGATTGG - Intergenic
1047906172 8:129475607-129475629 CATTTATATTTTTATCTCCTTGG - Intergenic
1048222485 8:132554556-132554578 GTTTTACATTTTTAAATAGTTGG - Intergenic
1048657788 8:136560979-136561001 GATTTACATTTTAGAATGGTGGG + Intergenic
1049091390 8:140517086-140517108 TATTTACATTATTAAATGGTTGG - Exonic
1049894202 9:98569-98591 GAGGTTTATTTTTAATTGCTAGG + Intergenic
1050158626 9:2694444-2694466 GATTTTTCTTTTTGAAGGCTGGG + Intergenic
1050285164 9:4093784-4093806 TATATATATTTTTAAATTTTAGG + Intronic
1050341572 9:4645134-4645156 TTTTTACATTTTTAAATGGTTGG - Intronic
1050372480 9:4935679-4935701 TATTTATTTTTTTAAATTCATGG + Intergenic
1050768920 9:9172370-9172392 TAGTTATATTTATACATGCTTGG - Intronic
1050900515 9:10942297-10942319 TATATATATTTTTAAGTACTGGG + Intergenic
1050929910 9:11310026-11310048 TATGTATCTTTTTAAATACTTGG + Intergenic
1050970254 9:11861997-11862019 GATTTTTGTTTTTAGATGTTAGG + Intergenic
1050976585 9:11946393-11946415 GATTTAGATTTTTGAATTCAGGG + Intergenic
1051049821 9:12918371-12918393 ATTTAATATTTTTATATGCTTGG - Intergenic
1051618155 9:19026728-19026750 GTTTAATATTATAAAATGCTGGG + Intronic
1051780849 9:20687251-20687273 GATTTATCTTTTTACTTGCCCGG + Intronic
1052203109 9:25806318-25806340 CAGTGATATTTTTAAATGCAGGG - Intergenic
1052206378 9:25846213-25846235 GATTAATATTTATTAATGGTGGG - Intergenic
1052366375 9:27616134-27616156 AATTTATATTTTAAAATAATAGG + Intergenic
1052596938 9:30573441-30573463 GATTTTTTTTTTTAAGTTCTGGG - Intergenic
1052743404 9:32415885-32415907 TTTTTACATTTTTAAAGGCTGGG - Intronic
1052908380 9:33857485-33857507 GTTTTATATTTTTAGTTGATGGG + Intronic
1052912778 9:33898584-33898606 GATTTATATTTTTAAAAAACTGG - Intronic
1053320109 9:37090471-37090493 TATATATATTTTTAAATGTAAGG - Intergenic
1053641863 9:40090644-40090666 TTTTTGGATTTTTAAATGCTTGG - Intergenic
1053735429 9:41098658-41098680 GAGGTTTATTTTTAATTGCTAGG + Intergenic
1053764273 9:41374815-41374837 TTTTTGGATTTTTAAATGCTTGG + Intergenic
1054542887 9:66285998-66286020 TTTTTGGATTTTTAAATGCTTGG + Intergenic
1054692949 9:68332743-68332765 GAGGTTTATTTTTAATTGCTAGG - Intronic
1055145829 9:72933753-72933775 AATTTAAAGTTTTAACTGCTAGG - Intronic
1055625890 9:78177167-78177189 GATTTCCATTCTTAAATTCTTGG + Intergenic
1055832089 9:80391876-80391898 GTTGTATATTTTTTAATCCTTGG - Intergenic
1056091026 9:83206343-83206365 AATTTCTATTTTCTAATGCTGGG + Intergenic
1056418111 9:86397275-86397297 AATTTATATTTTTAGAGACTAGG + Intergenic
1056536493 9:87532229-87532251 TTTTTACATTTTTAAATGATTGG + Intronic
1056878329 9:90361448-90361470 GTTTCATATTTTCAAATGCATGG + Intergenic
1056981951 9:91321712-91321734 TTTTTACATTTTTAAATGCCTGG + Intronic
1058633779 9:107017002-107017024 GAAATATATTTTTTAAAGCTGGG - Intergenic
1058636436 9:107042854-107042876 GTTTTACATTTTTAAATGGTTGG - Intergenic
1058743475 9:107967058-107967080 GTTTTATATTTTTAAATGGTTGG + Intergenic
1058831482 9:108821516-108821538 GAATTATATTTTTAATTTCCAGG - Intergenic
1059046301 9:110871850-110871872 GTTTTACATTTTTAAATGGTTGG - Intergenic
1059143997 9:111881079-111881101 TTCTTCTATTTTTAAATGCTTGG - Intergenic
1059160271 9:112027959-112027981 GATAAATATTTTTAAATCTTGGG + Intergenic
1059584741 9:115593860-115593882 GATTTTTTTTTTTAAATTCAGGG + Intergenic
1059868177 9:118540586-118540608 GCTATATATTTTTATATACTTGG + Intergenic
1059896783 9:118875245-118875267 GAATAATGTTTTTAAATGCATGG + Intergenic
1059988406 9:119841655-119841677 CATTTATATCATTAAATTCTGGG + Intergenic
1061424505 9:130490616-130490638 TTTTTACATTTTTAAATGGTTGG + Intronic
1061440567 9:130600385-130600407 GATTTGCATTTTTAAATTTTGGG + Intronic
1061784243 9:133016149-133016171 GATTTCTTTTTTTAAATGTTGGG - Intergenic
1203491405 Un_GL000224v1:108813-108835 GTTTTACATTTTTATATACTTGG + Intergenic
1203504029 Un_KI270741v1:50683-50705 GTTTTACATTTTTATATACTTGG + Intergenic
1186203534 X:7177818-7177840 TATATATATTTTTAAAGGCAAGG + Intergenic
1186543782 X:10427591-10427613 CTTTTACATTTTTAAATGGTTGG - Intergenic
1186855521 X:13622497-13622519 GCTTTATATGTTTTAATGCTGGG - Intronic
1187539888 X:20182461-20182483 GTTTTATATTTTTACAGGGTTGG + Intronic
1187568021 X:20471976-20471998 AATTTAGATTTTAAAATCCTGGG - Intergenic
1187745924 X:22409251-22409273 TATTCATATTTATGAATGCTAGG - Intergenic
1187867201 X:23734470-23734492 AATGTATATTTTGAAGTGCTAGG - Intronic
1187915080 X:24146233-24146255 GATAAATATTTTTTAATGTTTGG + Intergenic
1188198805 X:27274479-27274501 GAATTGACTTTTTAAATGCTGGG + Intergenic
1188401013 X:29744520-29744542 GATTCATATTTATATTTGCTGGG + Intronic
1188418518 X:29968683-29968705 CATTTATAGATTTCAATGCTGGG - Intergenic
1188654330 X:32672416-32672438 GATTTATATTATTAAATCATGGG + Intronic
1188670651 X:32878067-32878089 GATTTCTATTTGAAAATACTAGG + Intronic
1189460024 X:41233285-41233307 GTTTTATATTTTAATATTCTAGG - Exonic
1190027602 X:46939852-46939874 GCTTTTCATTTTTAAATGGTTGG + Intronic
1190252048 X:48734363-48734385 GGTATATGTTTTTAGATGCTAGG - Intergenic
1190633584 X:52412356-52412378 TATTTATTTTTTTAGATGCAAGG + Intergenic
1190634245 X:52418900-52418922 TATTTATTTTTTTAGATGCGGGG - Intergenic
1190923914 X:54884229-54884251 GTGTTATATTTTTAAATTTTAGG - Intergenic
1190961975 X:55260653-55260675 GTTTTTTATTTTTAAGTGCTAGG - Exonic
1191642369 X:63441243-63441265 CATTTATATTTTGACATGATTGG - Intergenic
1192102117 X:68276009-68276031 GTTTTATATTTTTTTTTGCTGGG - Intronic
1192582565 X:72297075-72297097 AATTTTTATTTTTAAATCTTTGG + Intronic
1192729850 X:73792196-73792218 CTTTTACATTTTTAAATGGTTGG - Intergenic
1193587127 X:83338614-83338636 GCTTTATTTTTTAAAAAGCTAGG - Intergenic
1193754148 X:85385831-85385853 CATTTATAATTTAAAATGCTTGG + Intergenic
1193932132 X:87566149-87566171 GTTTATTATTTTTAAATGTTTGG - Intronic
1194072682 X:89347051-89347073 CCTTTATTTTTTTAAATGATTGG + Intergenic
1194270965 X:91815195-91815217 AATTTAAATTTTTTAATGCCAGG + Intronic
1194687771 X:96945289-96945311 GAAATATATTTTTAGATGCTTGG + Intronic
1194736431 X:97517531-97517553 CATATATTTTTTTAAAAGCTGGG - Intronic
1194797479 X:98229675-98229697 GCTTTATATTTTTAAAGCATTGG - Intergenic
1194960604 X:100231106-100231128 GTTTTATGTTTTAAAATGGTTGG - Intergenic
1195726918 X:107927347-107927369 AATTTATATTCTTAAATCATTGG - Intergenic
1195933302 X:110101429-110101451 CTTTTATAATTTTAATTGCTAGG + Intronic
1196357604 X:114811941-114811963 AATTTTTATTTTTAAGTTCTGGG + Intronic
1197089059 X:122515002-122515024 GACTTCTTTTTTTAATTGCTGGG - Intergenic
1197688119 X:129465991-129466013 GATTTATTTGCTTAAATGATAGG - Intronic
1197771230 X:130090748-130090770 GTTTTACATTTTTTAATGATTGG + Intronic
1197882681 X:131184206-131184228 GATTTTTTTCATTAAATGCTTGG + Intergenic
1198671008 X:139080963-139080985 GGTTTATATTTTTTAAAGATGGG - Intronic
1199279607 X:145985294-145985316 GTTTTAATTTTTTAAATGATGGG - Intergenic
1199338970 X:146653254-146653276 TATTTAAATATTTAAAAGCTTGG + Intergenic
1199985038 X:152944420-152944442 GATTTTCATTCTGAAATGCTGGG + Intronic
1200588207 Y:5036633-5036655 AATTTAAATTTTTTAATGCCAGG + Intronic
1200726922 Y:6682794-6682816 CCTTTATTTTTTTAAATGATTGG + Intergenic
1200728074 Y:6698569-6698591 CCTTTATTTTTTTAAATGATTGG + Intergenic
1201221479 Y:11775134-11775156 GATGTATATTTGCAAATGCAAGG - Intergenic