ID: 959863920

View in Genome Browser
Species Human (GRCh38)
Location 3:111244468-111244490
Sequence CCTCATCTAAAGCCTCATTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 151}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959863920_959863928 21 Left 959863920 3:111244468-111244490 CCCAAATGAGGCTTTAGATGAGG 0: 1
1: 0
2: 1
3: 19
4: 151
Right 959863928 3:111244512-111244534 GATGGAACCAAACAGCAAATAGG 0: 1
1: 0
2: 0
3: 18
4: 163
959863920_959863927 3 Left 959863920 3:111244468-111244490 CCCAAATGAGGCTTTAGATGAGG 0: 1
1: 0
2: 1
3: 19
4: 151
Right 959863927 3:111244494-111244516 TTATGAGGGAAAGGGCTTGATGG 0: 1
1: 0
2: 1
3: 19
4: 215
959863920_959863926 -5 Left 959863920 3:111244468-111244490 CCCAAATGAGGCTTTAGATGAGG 0: 1
1: 0
2: 1
3: 19
4: 151
Right 959863926 3:111244486-111244508 TGAGGAGTTTATGAGGGAAAGGG 0: 1
1: 0
2: 1
3: 36
4: 370
959863920_959863925 -6 Left 959863920 3:111244468-111244490 CCCAAATGAGGCTTTAGATGAGG 0: 1
1: 0
2: 1
3: 19
4: 151
Right 959863925 3:111244485-111244507 ATGAGGAGTTTATGAGGGAAAGG 0: 1
1: 0
2: 0
3: 22
4: 295

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959863920 Original CRISPR CCTCATCTAAAGCCTCATTT GGG (reversed) Intronic
904390457 1:30181956-30181978 CCTCAACTAGAACCTCAGTTGGG - Intergenic
904843594 1:33390920-33390942 CATCAGCTAAAGTTTCATTTGGG + Intronic
907091651 1:51730242-51730264 CCTCCTCCAAAGTCTCATTTGGG - Intronic
910780997 1:90933266-90933288 ACTCCTCTAAAGTCTAATTTAGG + Intronic
913053654 1:115138456-115138478 CCTCATCTTGATCCTAATTTTGG + Intergenic
916072667 1:161179793-161179815 GCTCCTCTAAGGCCTCTTTTTGG + Intergenic
918965130 1:191334806-191334828 CTTTCTCTAAAGTCTCATTTGGG + Intergenic
918995618 1:191755282-191755304 CCTAACCTACAGCCTCTTTTTGG - Intergenic
919171830 1:193964240-193964262 CCTCACCTAAATGATCATTTAGG + Intergenic
922276373 1:224082697-224082719 CCTCATCTGAAGGCTCAGCTGGG - Intergenic
1069409380 10:68137001-68137023 ACTCACATAAAACCTCATTTGGG - Intronic
1070569862 10:77632663-77632685 CAGGATCTAAAGCCTCCTTTTGG + Intronic
1070742352 10:78911380-78911402 GCCCACCTAAACCCTCATTTAGG + Intergenic
1074224094 10:111466723-111466745 TCTCATCTGAAGGCTCATCTGGG - Intergenic
1076004219 10:126935162-126935184 CCACATAAAAAGCCTCAATTAGG + Intronic
1076672989 10:132133401-132133423 GCTCATCTAGAGCCTCTTTTTGG - Exonic
1076944192 10:133633085-133633107 CCTCTTCTAAGGCCTCATCCAGG + Intergenic
1081383829 11:42447552-42447574 CATTTTCTAGAGCCTCATTTGGG + Intergenic
1084108742 11:66998971-66998993 CCTCATTTAAAACCTTTTTTTGG - Intergenic
1086399769 11:86450972-86450994 CCACATCTAAGGCCTCACTGGGG + Intronic
1087091553 11:94278657-94278679 CCCCATCAAAAGTCTCACTTCGG + Intergenic
1087119013 11:94553377-94553399 CCTCATCTGAAGGCTCACCTTGG - Intronic
1090116276 11:123977535-123977557 CCTCATCTACAGCATCACTGTGG - Exonic
1093353478 12:18133185-18133207 CCTCTTCTAAAGTCTCCTTTAGG + Intronic
1095817660 12:46442107-46442129 CCTCACCTATATCCTCAGTTAGG + Intergenic
1097896806 12:64832704-64832726 TCTCATCTGAAGGCTCAATTGGG + Intronic
1098890540 12:76006068-76006090 CCATATATAAAACCTCATTTGGG + Intergenic
1100491854 12:95087552-95087574 TCTCATCTAGAGGCTCATCTGGG - Intronic
1101715230 12:107305432-107305454 CATCATCTCAAGCCTCACTTGGG - Intergenic
1102310029 12:111837394-111837416 CATCAGCTAAAGGCTCAATTTGG + Intergenic
1102894154 12:116585153-116585175 TCTCATCTGAAGGCTCATTGGGG - Intergenic
1103194536 12:119031155-119031177 TCTCATCTGAAGACTCAATTGGG + Intronic
1104197011 12:126550231-126550253 CATCTTTTAAAGCCTCCTTTGGG - Intergenic
1104806216 12:131591168-131591190 CTTCATGCAAAGCCACATTTTGG - Intergenic
1108463396 13:50690605-50690627 CCTCATCTAAAGGGGTATTTTGG + Intronic
1112824210 13:103373218-103373240 CCATATCTAAAGCATCATTCTGG + Intergenic
1114277493 14:21160307-21160329 AGTCATCTAGAGCCTCAATTGGG + Intergenic
1117148330 14:52858412-52858434 CTTCATCTAAACTCTCGTTTTGG + Exonic
1118732193 14:68676329-68676351 CCTCATAGTAAGCCACATTTGGG + Intronic
1119185574 14:72639673-72639695 TCTCATCTGAAGGCTCACTTGGG - Intronic
1120266784 14:82260896-82260918 CCTCATGTAAAATGTCATTTAGG - Intergenic
1121548914 14:94783447-94783469 CCTCAGCTAACACCTCATTATGG + Intergenic
1121676656 14:95759059-95759081 CTTCTTCTAAAGCCTAATTGTGG + Intergenic
1122336251 14:100988622-100988644 CTTCATCTAATGAGTCATTTAGG - Intergenic
1124167807 15:27343630-27343652 ACTCATGTAATGCTTCATTTTGG + Intronic
1124330197 15:28805942-28805964 CCTGATCAAAAGCCTGAATTTGG - Intergenic
1125010561 15:34868635-34868657 CATCATCTCAGGCCCCATTTTGG + Intronic
1125537752 15:40452353-40452375 CCTCCACTGAAGCCTCATTCAGG + Intronic
1127007069 15:54582564-54582586 CCTCATCTTCACCCTCATTCTGG - Intronic
1128392195 15:67189863-67189885 TCTCATCTACGGCCTTATTTTGG - Intronic
1129407583 15:75329332-75329354 CCACAACCAAGGCCTCATTTGGG - Intergenic
1130702580 15:86200193-86200215 TCATATTTAAAGCCTCATTTAGG + Intronic
1131150449 15:90044286-90044308 CCTCATCTTGAGCCCCATATTGG - Intronic
1131802154 15:96082162-96082184 CCTCATCTGAAGACTCACTTGGG + Intergenic
1132710847 16:1266521-1266543 CGTCTGCAAAAGCCTCATTTCGG - Intergenic
1133367653 16:5223717-5223739 CCTCATCAGAATCCTGATTTTGG - Intergenic
1134240235 16:12500564-12500586 GTTCATCTCAAGCCACATTTTGG - Intronic
1135055110 16:19225617-19225639 CCTCATCTGAAGGCTCAACTGGG + Intronic
1135553296 16:23414909-23414931 CCTCATTTAGAGCTTCGTTTTGG - Intronic
1136999725 16:35217792-35217814 CCTCTACTAAGGCCTCATCTAGG - Intergenic
1137746397 16:50823353-50823375 CCTGAACAACAGCCTCATTTTGG - Intergenic
1144997633 17:19281528-19281550 CCTCATCTAAAGCCTCAGATGGG - Intronic
1147520901 17:41172373-41172395 TCTCATCTAAAGCCTCAACTAGG - Intergenic
1150305280 17:64079465-64079487 CCACATTTAAAAGCTCATTTAGG + Intronic
1153370202 18:4306716-4306738 TCTCTTCTAAAGCCTCTTTGAGG + Intronic
1153941846 18:9985437-9985459 CAGCATCTAATGCCTCAGTTTGG + Intergenic
1155798957 18:30075644-30075666 CATCATATAAAGCCTTATATAGG + Intergenic
1155860413 18:30890944-30890966 GCTCTTCAAAAGACTCATTTGGG - Intergenic
1156946154 18:42834418-42834440 ACTCAGTTAAAGCATCATTTTGG - Intronic
1157257342 18:46150997-46151019 CCTCACCTGAACCCCCATTTTGG + Intergenic
1157898716 18:51492979-51493001 CCTCATCTAAACTCTCATAACGG + Intergenic
1158316386 18:56215287-56215309 CCTCATTTTAAGCCTCATACTGG + Intergenic
1161289812 19:3487410-3487432 CCTCATCTGAAGGCTCAACTGGG - Intergenic
1162701043 19:12514817-12514839 GCTCAGATAAAGACTCATTTTGG - Intronic
1167512111 19:49900881-49900903 CCTCATCGAAACCATCATTGTGG - Intronic
926518199 2:13876306-13876328 CCACTTCTAGAGCCTTATTTGGG - Intergenic
928374980 2:30766643-30766665 CCTCTGCTTCAGCCTCATTTGGG + Intronic
928935564 2:36673876-36673898 CCTGATCTGAAGGATCATTTTGG + Intergenic
930247951 2:49003988-49004010 CCACTACTAAAGCCTCATATTGG - Intronic
931264396 2:60647562-60647584 TCTAATCTAAACCCTTATTTTGG - Intergenic
932397791 2:71460024-71460046 CCTCACCTGAAGCCTCAGGTGGG + Intronic
937171580 2:119876571-119876593 CCACATCTAGTACCTCATTTTGG + Intronic
938374893 2:130798662-130798684 CCTCCTCAAGAGCCTTATTTGGG + Intergenic
939749277 2:146021059-146021081 CATCATCTAAATTCTTATTTTGG + Intergenic
940997900 2:160170261-160170283 TTTCATCTAAAGCCTTCTTTAGG + Intronic
941588336 2:167387424-167387446 CATCATATAAAGTCTCATTGTGG + Intergenic
942211611 2:173676938-173676960 CCACAGCTAATGCCTCATTTTGG - Intergenic
942715462 2:178886463-178886485 TCTCAAAAAAAGCCTCATTTTGG - Intronic
942730186 2:179054627-179054649 CCCAATCCAAAGCCTCCTTTGGG - Intergenic
943678375 2:190740802-190740824 TCTCATCTGAAGCCTCAATTAGG + Intergenic
946049025 2:216845688-216845710 TATCATCAAAAGCCTCATTTGGG + Intergenic
1170523291 20:17210648-17210670 TCTCATTAGAAGCCTCATTTTGG - Intergenic
1172575356 20:36003925-36003947 TCTCATCTGAAGGCTCATCTGGG + Intronic
1175498525 20:59432545-59432567 CCCCATCTGAGGCCTCATTCAGG + Intergenic
1183643674 22:39109383-39109405 CAACATTTAAAACCTCATTTAGG + Intergenic
949811486 3:8011579-8011601 CCTCATCTCAAGACTCAACTGGG + Intergenic
950340010 3:12234771-12234793 CCACATCTACTGCCTCAGTTGGG + Intergenic
952895949 3:38079147-38079169 CCCAATCCAAAGCCTCCTTTGGG - Intronic
953466371 3:43123749-43123771 CATAAGCTAAAGGCTCATTTAGG + Intergenic
955097821 3:55817194-55817216 CCTGATCAAGAGCCTCACTTGGG - Intronic
955147827 3:56337610-56337632 CCTCATCTAATCCCCAATTTTGG - Intronic
957202381 3:77153470-77153492 ACACTTCTAAAGGCTCATTTTGG - Intronic
958450595 3:94268007-94268029 CCTGTTCTAAAGCCTGATGTAGG - Intergenic
958526000 3:95260177-95260199 CCTCATCGAAACCTTCACTTTGG + Intergenic
959863920 3:111244468-111244490 CCTCATCTAAAGCCTCATTTGGG - Intronic
962041466 3:131711780-131711802 CCTCATTTCAAGCTTTATTTGGG - Intronic
965356759 3:167684676-167684698 CCACATCTGAATCCTCCTTTTGG - Intronic
966244077 3:177786467-177786489 TTTCATCTGAAGGCTCATTTGGG - Intergenic
969106192 4:4808808-4808830 CCTCAGCTACAGCCCCATTTGGG + Intergenic
972302629 4:37799338-37799360 CTTCCTTTAGAGCCTCATTTTGG + Intergenic
972925452 4:44000406-44000428 CCTTATCTGAAGCCACATTAAGG + Intergenic
974428299 4:61767171-61767193 CCCAATCCAAAGCCTCCTTTGGG - Intronic
974691578 4:65304220-65304242 ACTCATCTAAAGCATCAGATAGG + Intergenic
975979443 4:80140007-80140029 CCTCTTTCATAGCCTCATTTTGG + Intergenic
976365153 4:84224946-84224968 TCTGTTCTAAAGCCTCATTTTGG + Intergenic
977278591 4:95010441-95010463 CATCATCTAGAGCCTGATTTTGG + Intronic
977888607 4:102280623-102280645 TCTCATGTGAAGCTTCATTTTGG - Intronic
978720449 4:111901822-111901844 CTTCATCTAAAGCTTCCTTCTGG + Intergenic
978973991 4:114846175-114846197 CCTCTTCTAATGACCCATTTTGG + Intronic
979049954 4:115917976-115917998 CCTCATATAAAGTGTCAATTTGG + Intergenic
981688064 4:147477058-147477080 GCTCATCTATAGACTAATTTTGG + Intergenic
982645418 4:158018557-158018579 CCTTCTTTAAAGACTCATTTCGG + Intergenic
982811294 4:159828940-159828962 CTTCCTCTAAAGCTTCATTAGGG + Intergenic
983897506 4:173097789-173097811 CCTCATCTGAAGGCTCAGCTAGG - Intergenic
985447560 4:190033628-190033650 CCTCTTCTAAGGCCTCATCCAGG + Intergenic
985890249 5:2709876-2709898 CCTCCTCTCCAGCCTCTTTTGGG + Intergenic
985953922 5:3247158-3247180 CCTAATCTAAACCCTCTTTCAGG + Intergenic
991105255 5:62835689-62835711 CCCTCTCTAAAGCCTCTTTTGGG - Intergenic
991610679 5:68446670-68446692 CCTGATCAGAAGACTCATTTGGG - Intergenic
992612281 5:78517921-78517943 CCTCATCTAAAAGCTCTTTAGGG + Intronic
995655041 5:114416803-114416825 CTTCATATAAAACCTCATGTAGG + Intronic
997757149 5:136409982-136410004 CCTCTTTTTGAGCCTCATTTTGG - Intergenic
1005398704 6:25409591-25409613 CCTCATCTATAGCCTCATGGTGG + Intronic
1007058431 6:38912601-38912623 ACTGATCTAAAGCATCATATAGG - Intronic
1008851159 6:56023856-56023878 ACTAATCTAAAGCCTACTTTAGG + Intergenic
1009311589 6:62160370-62160392 CCTCATGTAAAGCCACTCTTTGG - Intronic
1011078911 6:83467784-83467806 TCTCATCTGAAGCCTGACTTGGG + Intergenic
1011184839 6:84662615-84662637 CCTCATTTAAAGCCTAAATGAGG + Intergenic
1011680097 6:89774788-89774810 CCTCATCCAGAGGCTTATTTTGG + Intronic
1013275384 6:108579890-108579912 CCTCCTCTATAGCCTCCTTAAGG - Intronic
1014121357 6:117729012-117729034 CCTCATCTAGAGAATCATTTGGG + Intergenic
1016724994 6:147353352-147353374 ACTGACCTAAAGCCTGATTTAGG + Exonic
1022287640 7:28969460-28969482 CCTGATCTAAATCCTGATTTGGG - Intergenic
1022556193 7:31299638-31299660 CCTCATCTGAAGACTCAGCTAGG - Intergenic
1024623598 7:51185325-51185347 CCTCAGCTTAAGCCTCCTTAGGG - Intronic
1028808485 7:95057082-95057104 CTTCATCAGAAGCCTCATTAGGG + Intronic
1029501677 7:100934542-100934564 TCTAAACTAAAGCATCATTTGGG - Intergenic
1029546872 7:101215083-101215105 CCTCACCTAAAGCCCCGTTGAGG + Exonic
1030798854 7:113824519-113824541 ACTCCTCTAAATCCTCATTCTGG + Intergenic
1032003988 7:128285518-128285540 CCTGACCTAAAGCCTCATGGTGG - Intergenic
1032125710 7:129191033-129191055 CCTAAACTCAAGTCTCATTTTGG - Intronic
1034241213 7:149612513-149612535 GCACATCTCAAGCCTCATTTGGG - Intergenic
1034971974 7:155424845-155424867 CCTCATCTGCAGCCTCAGCTGGG - Intergenic
1039175462 8:34799262-34799284 CCTCCTCTCTAGCCTCACTTTGG + Intergenic
1040645223 8:49389335-49389357 TCTCATCTGAAGCCTCAACTAGG - Intergenic
1047511205 8:125517138-125517160 ACTCATCTGAAGCCTCAGTTGGG - Intergenic
1051641090 9:19225530-19225552 GCTCATCTCAAGGCTCAGTTTGG + Intergenic
1056939211 9:90940882-90940904 GCTCATCTGAAGACTCATCTGGG - Intergenic
1057555602 9:96085383-96085405 CCTCATCTAAACCCACCTCTAGG - Intergenic
1058120672 9:101135275-101135297 CCTTATCTAAATCCCCATTTGGG + Intronic
1058358558 9:104112700-104112722 CCCCATCTAAAACCCCATCTAGG + Intronic
1058963518 9:110015263-110015285 CCTCATATTGAGACTCATTTGGG - Intronic
1059131843 9:111760143-111760165 CCCTATCTACAGCCTCATTCTGG + Intronic
1059538969 9:115111892-115111914 TCTCATCTAAAGGCTGAATTGGG - Intronic
1060294914 9:122336861-122336883 CCTCACCTAAGGCCTCTTCTGGG - Intergenic
1185827836 X:3269813-3269835 CCTCATCTTCATCATCATTTCGG - Intergenic
1186039847 X:5463752-5463774 CCTCGTATAAAGGCTCACTTGGG - Intergenic
1190148651 X:47921792-47921814 CCTCATCTAAAGGCTAAACTGGG - Exonic
1194273342 X:91848135-91848157 CACAATCTAAAACCTCATTTTGG - Intronic
1195411912 X:104576889-104576911 CATGGTCTAAAACCTCATTTGGG + Intronic
1196696290 X:118616351-118616373 CTTTAACTAAAGCCTCATTTTGG - Intronic
1197898280 X:131341003-131341025 CATGATCTAAAGCCGCATGTAGG + Intronic