ID: 959868463

View in Genome Browser
Species Human (GRCh38)
Location 3:111299660-111299682
Sequence CTCTGGACCCAGCTGGGGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 810
Summary {0: 1, 1: 4, 2: 40, 3: 160, 4: 605}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959868463_959868469 -3 Left 959868463 3:111299660-111299682 CCTAGCCCCAGCTGGGTCCAGAG 0: 1
1: 4
2: 40
3: 160
4: 605
Right 959868469 3:111299680-111299702 GAGATGCCATTCAGAAAGCAGGG 0: 1
1: 1
2: 3
3: 33
4: 302
959868463_959868468 -4 Left 959868463 3:111299660-111299682 CCTAGCCCCAGCTGGGTCCAGAG 0: 1
1: 4
2: 40
3: 160
4: 605
Right 959868468 3:111299679-111299701 AGAGATGCCATTCAGAAAGCAGG 0: 1
1: 0
2: 3
3: 30
4: 301

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959868463 Original CRISPR CTCTGGACCCAGCTGGGGCT AGG (reversed) Intronic
900562003 1:3311856-3311878 CTCTGGACCCAGGGTGGGGTGGG - Intronic
900601986 1:3506629-3506651 CTCTGGGGCCACCTGCGGCTTGG - Intronic
901136469 1:7000061-7000083 CCCTGGTACCAGCTGGTGCTGGG + Intronic
901462215 1:9398511-9398533 CCCTGAACTCAGCTGGGGATGGG - Intergenic
901757773 1:11451725-11451747 CTCTGGAGCCAGGTGGGCCTGGG + Intergenic
901910437 1:12453105-12453127 CCCAGGACCCAGTTGGTGCTGGG + Intronic
901921739 1:12541750-12541772 CTCTGACCTCAGCTGCGGCTTGG - Intergenic
902246157 1:15122185-15122207 CTTTGGACACAGCTGGCGCCAGG + Intergenic
902470035 1:16642900-16642922 CTCTGGGGCCAGCAGGGGCCAGG - Intergenic
902612897 1:17607705-17607727 TTCTGAACCCAGGTGGGGCGAGG - Intronic
902615657 1:17622238-17622260 CTCTGGAAGCCCCTGGGGCTTGG + Intronic
902628070 1:17688424-17688446 CTCTGAAGCCAGCTGGGGTGAGG - Intronic
902749458 1:18497321-18497343 CTCTAGGCTCAGCTGCGGCTGGG + Intergenic
903141881 1:21344202-21344224 CTCTGGGCACAGCAGGGGCTGGG + Intronic
903343655 1:22670916-22670938 CCCGGAAACCAGCTGGGGCTGGG - Intergenic
903676614 1:25068445-25068467 CTCAGCACCCACCTGTGGCTGGG + Intergenic
903755727 1:25659114-25659136 AGCTGTACCCAGCTGGGACTTGG + Intronic
904011944 1:27394885-27394907 CTCCAGAACCAGCTGGGTCTGGG - Exonic
904336357 1:29800723-29800745 CTCTGGGCCCAGCTGTGGCCTGG + Intergenic
905216878 1:36414961-36414983 CTCAGGTCCCACCTGGGGCAGGG + Intergenic
905866587 1:41380300-41380322 CTATGGAAACAGCAGGGGCTTGG - Intronic
906200753 1:43958691-43958713 CTGGGGACCAAACTGGGGCTGGG + Intronic
906688849 1:47779598-47779620 CTCTGGACACAGGAGGTGCTGGG + Intronic
906878019 1:49558983-49559005 CTCTGGACCCTCCTGGGGCCTGG + Intronic
906906087 1:49893766-49893788 CTCAGGACCCACCTGGGTCCTGG + Intronic
907023841 1:51095419-51095441 CTCTGGGCCCACCTGGGGTCAGG + Intergenic
908958836 1:69670608-69670630 CTCTGGACCTCCCTGGGGCCAGG - Intronic
910229943 1:84975083-84975105 CTCTGGACCCAGGAGGGTCCTGG + Intronic
910546701 1:88426245-88426267 CCCTGGGCCCAACTGGGGCCTGG + Intergenic
910589971 1:88919692-88919714 CTCTTGACCCAGTAGGGCCTTGG - Intergenic
910733200 1:90421305-90421327 CTTTGGACCCACCTGGGGCCTGG + Intergenic
910923921 1:92378772-92378794 CTCTATACCCAGCTTGGGCTTGG + Intronic
911154289 1:94623634-94623656 CCCTGGACTCAACAGGGGCTTGG + Intergenic
911343922 1:96673944-96673966 CTCTGGACCTGCCTGGGGCCTGG - Intergenic
911496567 1:98638260-98638282 TTCTGGACCCACCTGGTTCTTGG + Intergenic
911536490 1:99106331-99106353 CACTGAACCCACCTGGGGCTTGG + Intergenic
911669670 1:100593529-100593551 CTCTGGACACACCTGGGGCCTGG - Intergenic
912127393 1:106555711-106555733 CTCTGGAACCAGCCAGGTCTGGG + Intergenic
912242730 1:107927824-107927846 CTCTGGACCCACCTGGGGCCTGG + Intronic
912458851 1:109818076-109818098 ACCTGGACTCAGATGGGGCTGGG + Intergenic
912490581 1:110060635-110060657 CTCCAGAACCATCTGGGGCTTGG + Exonic
912516525 1:110219893-110219915 CTCAGGACCCACCTGGAGCAAGG + Intronic
913416788 1:118618191-118618213 CTCTGGACCCACCTGGGGCCTGG - Intergenic
913706988 1:121434904-121434926 CTCTGGACCCATCTGGGATCTGG + Intergenic
914675734 1:149906028-149906050 CGCTGGAGCCAGCTGGAGCCAGG + Exonic
914720628 1:150285851-150285873 CTGTAGTCCCAGCTGAGGCTGGG + Intronic
915123567 1:153648052-153648074 CCATGGACCCAGCAGGGGTTAGG + Intergenic
915476161 1:156153993-156154015 CCCTGAACCCAGCTGGGGCTGGG + Intronic
915589476 1:156862457-156862479 TGCTGGACCCACTTGGGGCTTGG - Intronic
915948938 1:160174783-160174805 CCCTGGACTCAGGTGGGGGTTGG + Intronic
916854749 1:168738089-168738111 CTCTGGTTCCTGCTTGGGCTTGG + Intergenic
917003290 1:170385041-170385063 CTCTGGACCCACCTGAGGCCTGG - Intergenic
917226342 1:172788077-172788099 CTCTGGACCTACCTGGGGCCTGG - Intergenic
917986546 1:180326123-180326145 CTCTGGACCCACCCAGGGCCTGG - Intronic
918358078 1:183724712-183724734 CTCTGGACCTGCCTGGGGCCTGG + Intronic
919067835 1:192715081-192715103 CTCTGGACCCACCTGAAGCTTGG + Intergenic
919252499 1:195075164-195075186 CTGTGGCCCCAGCTGGCTCTAGG + Intergenic
919287662 1:195585246-195585268 CTATGGACCCACCTGGGGCCAGG + Intergenic
919748107 1:201021210-201021232 CTTAGGACTGAGCTGGGGCTGGG - Intronic
920089623 1:203442936-203442958 ATCTGGACGCAGCTGGGCCCGGG + Intergenic
920185190 1:204155093-204155115 CACTGGACCCACCTGGGCCCTGG - Exonic
920513779 1:206569215-206569237 TTCTGTACCCCACTGGGGCTTGG - Intronic
920744989 1:208617697-208617719 CTCTGGACCCACCTGGGGCCTGG + Intergenic
921218723 1:212958305-212958327 CCCTGCCCCCAGCTGGGACTTGG + Intronic
921634677 1:217477799-217477821 CTCTGGACCTACCTGGGGTCAGG + Intronic
921929295 1:220742117-220742139 CTCTGAACCCACATGGGGCCTGG - Intergenic
922537502 1:226391924-226391946 TTTTGGACCCAGCAGTGGCTGGG - Intronic
922642335 1:227246356-227246378 CTCTGGACACACCCGGGGCCTGG + Intronic
924490743 1:244535357-244535379 CTCTGGACCCACATGGGGCCTGG - Intronic
924537883 1:244953034-244953056 ATCTGCATCCAACTGGGGCTGGG - Intergenic
924648972 1:245905610-245905632 TTCTGGACCCACCTGGGGCCTGG + Intronic
924926836 1:248691941-248691963 CTCTGGAGGCACCTGGGACTCGG - Intergenic
924944648 1:248838238-248838260 CTCCGGCCCCAGCTGGAGCCGGG - Intronic
1064193118 10:13224765-13224787 CCCTGCACCCAGCTGGGCCGAGG - Intronic
1064521650 10:16209321-16209343 CTCTGAACCCACCTGGGGCCTGG - Intergenic
1064987433 10:21225484-21225506 CTCTGGACCTGCCTGGGGTTGGG - Intergenic
1065549974 10:26860590-26860612 CTCTGTCCCCGGTTGGGGCTGGG + Intronic
1067111692 10:43405955-43405977 CTTGGGACCCAGTTGGGACTGGG + Intronic
1067296784 10:44979202-44979224 GTCTGGAGGCAGCTGAGGCTGGG + Intronic
1068422082 10:56807731-56807753 CTCTAGAACCACCTGGGGCATGG - Intergenic
1068709338 10:60116237-60116259 CTCTGTCCCCAGCTGTGTCTGGG - Intronic
1069780960 10:70955050-70955072 CTCTGGACCCAGGTGGGTCCTGG - Intergenic
1070059310 10:72967176-72967198 CTCTGGACCCATCTGGGGCCTGG - Intergenic
1070477605 10:76845596-76845618 CTCTGGACCCACCCTGGGCCTGG + Intergenic
1070915109 10:80148495-80148517 CTTTGGGCCCAGCTGGGGCCTGG + Intergenic
1071358673 10:84822998-84823020 CACTGGACCCTCCTGGGCCTGGG - Intergenic
1072862768 10:99023393-99023415 TTCTGGACCTAGCTGGGACTGGG + Intronic
1072877758 10:99191172-99191194 CTCTGGACCTACCTGGGGCTGGG + Intronic
1074187613 10:111110535-111110557 CTATGGTCCCAGCTAGGGATGGG - Intergenic
1074311602 10:112327525-112327547 CCCTGGAGTCAACTGGGGCTGGG + Intergenic
1074402433 10:113153039-113153061 CTCTGGCCCCAGCAAGGGCAGGG + Intronic
1074827360 10:117224111-117224133 TTCTGGAGCCCGCTGGTGCTGGG + Intergenic
1075062739 10:119268015-119268037 CTCTGGAGCCCACTGGGGTTTGG + Intronic
1075090635 10:119442318-119442340 CTTTGGACACAGGTGGGGCTGGG - Intronic
1075424287 10:122329411-122329433 CTCTGGAATTAGCTCGGGCTAGG - Intronic
1075481968 10:122789734-122789756 CTCTGTCCCCAGCAGGGGCCTGG + Intergenic
1075544413 10:123343547-123343569 CTCTGGAAACAGATGGAGCTGGG + Intergenic
1075704933 10:124494842-124494864 CTGTGGAGCAGGCTGGGGCTGGG + Intronic
1076977809 11:188682-188704 CTATGGACCCAGATGGTCCTGGG - Intronic
1077080759 11:723767-723789 CTTTGGAAACAGGTGGGGCTGGG - Intronic
1077248274 11:1549479-1549501 CCCTGCAGGCAGCTGGGGCTCGG - Intergenic
1077298039 11:1835135-1835157 CTGTGGTGCCAGCTGGGGCCGGG - Exonic
1077300195 11:1843172-1843194 CTCAGGTCTCAGCTGAGGCTTGG - Intergenic
1077427505 11:2490321-2490343 CTCTGGACCCACCTTGGACTTGG + Intronic
1077488952 11:2851653-2851675 CTGAGCACCCAGCTGGGGCCAGG - Intergenic
1077522281 11:3043465-3043487 CTCTGACCCCAGCTGGTGCCTGG + Intronic
1078002804 11:7511706-7511728 CTATGGTCCCAGCCTGGGCTTGG - Intergenic
1078723445 11:13905294-13905316 CTCTAAGCCTAGCTGGGGCTTGG - Intergenic
1079038005 11:17037334-17037356 CTCTGGACCCACCCAGGGCCTGG + Intergenic
1079530483 11:21446871-21446893 CTCTGGACCAAGCTGGGACATGG - Intronic
1080428307 11:32175889-32175911 CTCTGGGCCTCTCTGGGGCTGGG - Intergenic
1081619414 11:44610265-44610287 CTGTGGTCCTAGCTGGGACTTGG + Intronic
1081775592 11:45674225-45674247 CTGGGGTCCCAGCTGGGGCAGGG - Intergenic
1082122678 11:48396298-48396320 CTCTGGACCCACCCAGGGCCTGG - Intergenic
1082251957 11:49992373-49992395 CTCTGGACCCATCCAGGGCCTGG + Intergenic
1082556382 11:54567574-54567596 CTCTGGACCCACCCAGGGCCTGG - Intergenic
1083283143 11:61639849-61639871 CTCTGGAGCCATGTGGGCCTGGG - Intergenic
1083439683 11:62667676-62667698 CGCTGGACTCAGCTGGGGGCAGG - Exonic
1083476659 11:62919807-62919829 GTAGGGATCCAGCTGGGGCTCGG - Intronic
1083881683 11:65552018-65552040 CTCCGGAAGCTGCTGGGGCTTGG + Exonic
1084088451 11:66865471-66865493 CTCTGGTCCCAGCTGTGGGCAGG - Intronic
1084343955 11:68530765-68530787 CTCTGGGCCCAGCTAGTCCTGGG + Intronic
1084529130 11:69716871-69716893 CTCTGGGCTCAGCTCTGGCTAGG + Intergenic
1084608684 11:70187119-70187141 CCCAGTCCCCAGCTGGGGCTGGG - Intronic
1084953511 11:72679412-72679434 CCCTGGACTCAGCTGGGGCTGGG - Intergenic
1085147396 11:74213379-74213401 CTCTGGACTCACCTGGGACCAGG + Intronic
1085178521 11:74511667-74511689 CTCTGGACCTGCCTGGGGCCTGG + Intronic
1085510367 11:77085058-77085080 GTCTGGTCCCAGCTGGAGCTGGG + Intronic
1088570003 11:111213625-111213647 TTCTGGACCCACCTGGGGCCTGG + Intergenic
1088914918 11:114220179-114220201 CTCTGGGCCCAGATGGTCCTTGG + Intronic
1089139110 11:116272271-116272293 CTGAGGACCCAGCTGGGCCTGGG + Intergenic
1089260473 11:117220662-117220684 TACTGGGCCCAGCTGGAGCTGGG + Intronic
1089578785 11:119468559-119468581 CTCTGGACCCCCCTGGGGCCAGG - Intergenic
1089602532 11:119624362-119624384 CTCTAAACACAGCTGGGGCCAGG + Intronic
1089737367 11:120559063-120559085 CTCTGTTCTCAGCTGGGGGTTGG + Intronic
1089946596 11:122480209-122480231 CTCTGGACCCACCAGGAGCCTGG + Intergenic
1090207071 11:124891318-124891340 CTCTGGCCCCTGCAGAGGCTTGG - Exonic
1090420559 11:126572458-126572480 CTCTGGAACCAAATGGGCCTGGG - Intronic
1090636009 11:128690991-128691013 CTCTGGGCCCAGCTTGGGGAAGG - Intronic
1090676826 11:129006827-129006849 CTCTGGACCCACCTAGGGCCTGG - Intronic
1091301227 11:134509513-134509535 ATCTGAACCCAGCTACGGCTTGG - Intergenic
1091473903 12:753373-753395 CGCTGGGCCCAGCTGCGGCGGGG - Exonic
1091967131 12:4754298-4754320 CTCTGGACCCACTTGGGACCTGG - Intronic
1092861725 12:12724837-12724859 CTGCGGGCCCAGCTGGGGGTGGG + Intergenic
1093123958 12:15306554-15306576 CTCTGGACCCACCTGGGGCCTGG - Intronic
1093617281 12:21241562-21241584 CTCTGGACCCACATGGGACCTGG + Intergenic
1095227608 12:39695648-39695670 TTCTGGATCCACCTGGGGCCTGG + Intronic
1096499154 12:52054920-52054942 CTCTGGGCCAGGCTGGGGCTGGG - Exonic
1096604104 12:52752741-52752763 CTCAGGACACAGATGGAGCTGGG - Intergenic
1096928281 12:55173489-55173511 ACCTCCACCCAGCTGGGGCTGGG + Intergenic
1097357805 12:58621245-58621267 CCCTGGGCCCAACAGGGGCTGGG - Intronic
1097563564 12:61239356-61239378 TTCTGGACCCCCCAGGGGCTTGG - Intergenic
1097568917 12:61307531-61307553 CTCTGGACCTGCCTGGGGCCTGG - Intergenic
1097899186 12:64856691-64856713 CTCTAGACACACCTGGGGCCTGG - Intronic
1098142843 12:67468824-67468846 CTCTGGACCCACCCAGGGCTTGG - Intergenic
1098395382 12:70011374-70011396 CTCTGGACCAACCTGGGGTCTGG + Intergenic
1099564848 12:84230252-84230274 CTCTGGACCCACTTGGGTCCTGG - Intergenic
1100360726 12:93877429-93877451 CTCTGGACCCACCTGGTGTCTGG - Intronic
1100875786 12:98960027-98960049 CTCTGGACCCACCCAGGGTTTGG + Intronic
1101026087 12:100608480-100608502 CTCTGGACCCAACAGGGCCTGGG - Intronic
1101467558 12:104963079-104963101 CTCTGTGCCCACCTTGGGCTGGG - Intergenic
1101724372 12:107376909-107376931 CTCTGGACTCAGACGGGCCTGGG - Intronic
1102026710 12:109717855-109717877 CTCTGGACTAAACTGGGACTGGG + Intronic
1102318022 12:111905515-111905537 CTCTGGACCCACCCAGGGCCCGG + Intergenic
1103190741 12:118999756-118999778 CTCTGGAATCAGATGGGACTGGG - Intronic
1103243405 12:119434140-119434162 ACCTGGACCCTGCTGGGGGTAGG - Intronic
1103344884 12:120242552-120242574 CTCTGTGGTCAGCTGGGGCTGGG - Intronic
1103478996 12:121238853-121238875 TTCTGGCACCAGATGGGGCTTGG - Exonic
1103703779 12:122860817-122860839 CTCTGGGCCCAGCTTGGCCTGGG + Intronic
1104214627 12:126723978-126724000 ACCTGGACACTGCTGGGGCTAGG - Intergenic
1104404810 12:128508532-128508554 CTCTGCACACAGCTGGGGACAGG - Intronic
1104588696 12:130067506-130067528 CCCAGGACCCAGCGTGGGCTTGG + Intergenic
1105951015 13:25229604-25229626 CTCTGTAGGCAACTGGGGCTCGG + Intergenic
1106074854 13:26449120-26449142 CTGTGGACCCATCTGGGGCTGGG + Intergenic
1107524133 13:41213635-41213657 CTCTGGACCTGCCTGGGGCCTGG - Intergenic
1107774338 13:43822538-43822560 CTTTGGACCCAACTGGGGCCTGG - Intergenic
1107844944 13:44502216-44502238 CTCTGGAACCAAATGGGACTGGG - Intronic
1108973311 13:56403387-56403409 TCCTGGATCCACCTGGGGCTTGG + Intergenic
1109567141 13:64132022-64132044 TGCTGGACCCATCTGGGGATGGG + Intergenic
1112131722 13:96532077-96532099 CTCTGGATCCAGCCTGGGATGGG - Intronic
1113229188 13:108194502-108194524 CTGTGGAGCCAGCAGGGGCCGGG + Intergenic
1113328087 13:109302155-109302177 CCCTGGCCTCAGCAGGGGCTTGG + Intergenic
1114220723 14:20693918-20693940 TTCTGAACCCCGCTGTGGCTCGG - Exonic
1114221247 14:20699411-20699433 CTGCTGACCCTGCTGGGGCTGGG + Exonic
1114538297 14:23436731-23436753 CTCTGGATAAAGCTGAGGCTGGG - Intergenic
1114615841 14:24067955-24067977 CTGTGGACCCAGCAGGCCCTGGG + Intronic
1114987909 14:28252705-28252727 TTCTGGACCCACTTGGGGCCTGG - Intergenic
1115282313 14:31677901-31677923 CTCTGGACCCACCTGGGGTCTGG - Intronic
1115821066 14:37212613-37212635 TTCAGGACCCACCTGGGGCCTGG + Intronic
1115918420 14:38343235-38343257 CTCTGGACCCTCCTGGGGCCTGG + Intergenic
1116121930 14:40731856-40731878 CTCTGGACTCACCTGGGGACTGG - Intergenic
1117504412 14:56388270-56388292 CTCTGGACCCTCCTAGGGCTGGG - Intergenic
1118404867 14:65412945-65412967 CCCTGGACCCAGCTCGCTCTCGG + Intronic
1118543620 14:66859053-66859075 CTCTGGACCTACCCTGGGCTGGG + Intronic
1118611861 14:67547571-67547593 CTCTCTACCCAGCTGGCCCTGGG + Intronic
1118765195 14:68904842-68904864 CTGAGGATCGAGCTGGGGCTGGG - Intronic
1119083353 14:71717766-71717788 CTCTGGGCACAGCTGTGGGTGGG - Intronic
1119190967 14:72681425-72681447 CTCTGGGGCCAGCTGAGCCTGGG - Intronic
1119288185 14:73473313-73473335 CTCTGGTCCCAGCTGAGCCCAGG - Intergenic
1119430577 14:74565682-74565704 CTGTAGACACAGTTGGGGCTGGG + Intronic
1119725228 14:76918252-76918274 CTCTGTGCCCAGCTGAGCCTTGG - Intergenic
1119953482 14:78770258-78770280 CTCTGGAACCAGCTAGACCTGGG - Intronic
1121153031 14:91654648-91654670 CTCTGGACCTAGCTGGGGCTGGG + Intronic
1121425892 14:93851819-93851841 CTTTGGACTCAGCTGTGGGTGGG + Intergenic
1121507737 14:94489554-94489576 CTCTGGCCCCGGCTGGGGGAAGG + Intronic
1121599277 14:95191122-95191144 CTCTCTCCCCAGCTGGGGCTTGG + Exonic
1121759696 14:96434691-96434713 TTCTGGACCCACCTGGAGCCTGG - Intronic
1122814061 14:104303702-104303724 CTCTGGATCCTGCTGGGCCCTGG + Intergenic
1122829360 14:104388220-104388242 CTCTGGCCCCGGCAGGGGCTGGG + Intergenic
1202840314 14_GL000009v2_random:115095-115117 CTCTGTACCCAGCTCGCCCTTGG + Intergenic
1202909697 14_GL000194v1_random:105292-105314 CTCTGTACCCAGCTCGCCCTTGG + Intergenic
1123508564 15:20971952-20971974 CTCTAGACCTACCTGGGGCCTGG - Intergenic
1123565786 15:21545701-21545723 CTCTAGACCTACCTGGGGCCTGG - Intergenic
1123602048 15:21982988-21983010 CTCTAGACCTACCTGGGGCCTGG - Intergenic
1124221596 15:27854286-27854308 GTCTGGACTCCGCTGGGGCTGGG - Intronic
1124340988 15:28889001-28889023 CTGTGTGCCCAGCGGGGGCTGGG + Intronic
1125760658 15:42093691-42093713 GTCTGGATCCAGCTTGGGCCTGG + Intronic
1126503822 15:49379989-49380011 CTCTGGACCCACCCAGGGCCTGG - Intronic
1126709377 15:51440728-51440750 TTCTGGACCCACCTAGGGCTTGG - Intergenic
1127155670 15:56122633-56122655 CTCTGGACCCATCTGGGGTCTGG - Intronic
1127177949 15:56381956-56381978 CTCTGGACCCACCCAGGGCCTGG - Intronic
1127383005 15:58445510-58445532 CTGAGGACAGAGCTGGGGCTAGG + Intronic
1127477053 15:59344598-59344620 CTCTGGACCTACCTGGGCCCAGG - Intronic
1127945196 15:63744445-63744467 CTCTAGACCCACCTGAGGCTTGG - Intronic
1128084690 15:64877734-64877756 CGCTGGCCACAGCTGGGGCAGGG - Intronic
1128103878 15:65029127-65029149 CGCTGTGCCGAGCTGGGGCTGGG - Intronic
1128352212 15:66898721-66898743 CTAAGAACCCAGCTGGGTCTTGG - Intergenic
1129330512 15:74824665-74824687 AGCAGGACCCAGATGGGGCTGGG - Intronic
1129436792 15:75547959-75547981 CTCTGTACCCAGTAGGGGCCAGG - Intronic
1129642475 15:77394173-77394195 CTCTGGACCTACCCAGGGCTAGG + Intronic
1129908270 15:79205210-79205232 CCCTGAACACAGCTGGGGCCAGG + Intergenic
1130584992 15:85173876-85173898 CTCTGGCCCCAGCTGGGAGCAGG + Intergenic
1130674244 15:85938253-85938275 CTCTTCCCCCAGCTGGGCCTAGG - Intergenic
1131944985 15:97609602-97609624 CCCTGGATGCACCTGGGGCTGGG + Intergenic
1132070875 15:98775652-98775674 CTGTGGCCCCTGCTGGTGCTGGG + Intronic
1132302825 15:100787109-100787131 CTCTAGACCCAGGTGAGGATCGG + Intergenic
1202974155 15_KI270727v1_random:272794-272816 CTCTAGACCTACCTGGGGCCTGG - Intergenic
1132795926 16:1722567-1722589 TTCAGAACCCAGCTGAGGCTGGG + Intronic
1133287348 16:4696790-4696812 CTCTGGCCCCCACTGGGCCTGGG + Exonic
1134039483 16:11057440-11057462 CTGTGGCTCAAGCTGGGGCTTGG - Intronic
1134244060 16:12526779-12526801 CTGTGGACCCCGCAGGGGGTGGG - Intronic
1135392241 16:22103673-22103695 ACCTGGATCCAGCTGTGGCTGGG - Intronic
1136617662 16:31408541-31408563 CTCTGCACCCACCCTGGGCTGGG + Intronic
1137038923 16:35591854-35591876 CTGTGGGCCGAGCTGGGACTTGG + Intergenic
1137253566 16:46757680-46757702 CTCTGGATGCCGCTGGGGCCTGG - Intronic
1137849473 16:51724674-51724696 CTCTGGAATCAGATGGGCCTGGG - Intergenic
1138023787 16:53506372-53506394 GTCTGCAGCCACCTGGGGCTGGG - Intergenic
1138127905 16:54454014-54454036 CTCTGGAACCAGAAAGGGCTGGG - Intergenic
1138184311 16:54964492-54964514 CTCTGGAGCCAGATAGGCCTTGG - Intergenic
1138498772 16:57425541-57425563 ATGTGGACCGAGATGGGGCTGGG - Intergenic
1138530005 16:57629786-57629808 CCCTGGTCCCCGCGGGGGCTGGG + Intronic
1139015375 16:62683832-62683854 CTGTGGAGCCAGCAGGGGCTGGG + Intergenic
1139968091 16:70756618-70756640 CTCAGGACTCAGCAGAGGCTGGG + Intronic
1141377323 16:83543704-83543726 CGCTGGTCCCAGCTGGGGAATGG - Intronic
1141464243 16:84195966-84195988 CGCTGGGCCGTGCTGGGGCTGGG + Exonic
1141830658 16:86508510-86508532 CTCTCGCCCCAGCTCGCGCTGGG + Intergenic
1141859718 16:86708361-86708383 GTCTGGACACACCTGGGCCTTGG - Intergenic
1141951888 16:87344912-87344934 CTCTGCCCCCAGGTGGGGTTTGG - Intronic
1141951903 16:87344947-87344969 CTCTGCCCCCAGGTGGGGTTTGG - Intronic
1141951918 16:87344982-87345004 CTCTGCCCCCAGGTGGGGTTCGG - Intronic
1142118664 16:88375031-88375053 CTGTGCACACAGCTGGGGCAGGG + Intergenic
1142189347 16:88710645-88710667 CTCTGGACCCAGCTTCTGATTGG - Intronic
1142231548 16:88902464-88902486 CTCCGGACACAGCTGGCCCTGGG - Intronic
1142358502 16:89615318-89615340 CTCTGTACCCAGTGGGAGCTGGG - Intronic
1142442523 16:90108647-90108669 CTATGGACCCAGATGGTCCTGGG + Intergenic
1142465230 17:133147-133169 CTATGGACCCAGATGGTCCTGGG - Intergenic
1142708081 17:1709048-1709070 CTCTGCCCCCAGCTGGTGCTTGG - Intronic
1143323163 17:6080947-6080969 CTCCGGAGCCAGCGGGGGCCGGG - Exonic
1143726231 17:8848726-8848748 ATCTGTAACCAGCTGGGGTTTGG - Intronic
1144033140 17:11340346-11340368 CTGTGGGGACAGCTGGGGCTGGG + Intronic
1144793249 17:17873659-17873681 CCCAGCACCCAGCTGGGGCTAGG - Intronic
1145776107 17:27530163-27530185 CTAAAGACCCAGCAGGGGCTGGG + Intronic
1145956019 17:28855190-28855212 CTCTGGTCCCCGCTTGGCCTCGG + Exonic
1146267964 17:31465533-31465555 CACTGCGCCCAGCAGGGGCTGGG - Intronic
1146941094 17:36845082-36845104 GTCTGGACTCAGCTGTAGCTGGG + Intergenic
1147191769 17:38742087-38742109 CTCTGGACCCTGCCCGGGCCTGG - Intronic
1147324076 17:39662144-39662166 TTCTTGGCCCAGCTGGGACTGGG - Intronic
1147589050 17:41669525-41669547 CTCTAGGCCCAGCTGGGGGCTGG + Intergenic
1148161542 17:45453170-45453192 CACTGGCCCCAGCCGGGGCTGGG + Intronic
1148698405 17:49574728-49574750 CACGGGACCAAGCTGGGCCTTGG + Intergenic
1148756003 17:49973259-49973281 CACTGGCCCCACCTGGGTCTGGG - Exonic
1148777645 17:50104717-50104739 CTCTGTCCCCAGGTGGGGCTGGG - Intronic
1149108580 17:52998113-52998135 TTCTGTACCCATCTGGAGCTTGG + Intergenic
1149180579 17:53931796-53931818 CTCTGGACTCACCTGGGGCCTGG - Intergenic
1149234968 17:54578715-54578737 TTCTAGACCCATCTGGGGCATGG + Intergenic
1149432923 17:56608845-56608867 CTCTGTCCCCTGTTGGGGCTGGG + Intergenic
1149537109 17:57441495-57441517 CTCTGCACTCAGCTGGAACTGGG + Intronic
1150280735 17:63928526-63928548 CTCTGGGTCCAGCTAGGGCCTGG + Intergenic
1150392778 17:64799815-64799837 CACTGGCCCCAGCCGGGGCTGGG + Intergenic
1151225985 17:72648747-72648769 CTGGGGTCCCAGCTGGGACTGGG + Intronic
1151756858 17:76080156-76080178 CTCTGAAAGCAGCTGGGGTTGGG + Intronic
1152458789 17:80430725-80430747 CTCTGTGCCCGGCGGGGGCTAGG + Intronic
1152539719 17:80968823-80968845 TTCCGGCCCCGGCTGGGGCTTGG - Intergenic
1152592401 17:81220146-81220168 CAGTGGACCCAGCTGAGGCTGGG - Intronic
1152884214 17:82839774-82839796 CTCAGGACCCAGCAGGTGCATGG - Intronic
1153099680 18:1452155-1452177 TTCTGGACCCACCTGGGGCTTGG + Intergenic
1153363386 18:4224743-4224765 CTCTGGACCCACCTGGGGCCAGG + Intronic
1153425807 18:4961600-4961622 CTCTGGAACCACCTAGGGCCTGG + Intergenic
1153988159 18:10371591-10371613 CTCGGGACCCTGCTGGGGCAGGG - Intergenic
1155282215 18:24251154-24251176 CTCTGGACCTATTTGGGGCCTGG + Intronic
1155500202 18:26479997-26480019 GTCTGGAGCCAGCTTGGTCTTGG - Intronic
1156388794 18:36631021-36631043 TCCTGGAACCAGCTGAGGCTAGG - Intronic
1157287101 18:46384412-46384434 ATCTGCCCCTAGCTGGGGCTTGG + Intronic
1158538103 18:58326539-58326561 ATTTGGACCCACCTTGGGCTTGG + Intronic
1159394480 18:67838400-67838422 CTCTGGACCCACTTGTGGCCTGG - Intergenic
1159640065 18:70853772-70853794 CGTTGGACCCAGCGGAGGCTGGG - Intergenic
1159648138 18:70943680-70943702 CTCTGGACCCACCTGGGACCAGG + Intergenic
1159802506 18:72919192-72919214 CTCTGGACCTGCCTGAGGCTGGG - Intergenic
1159896420 18:74001249-74001271 CTCTGGACCCACCTGGGGCCTGG - Intergenic
1160522540 18:79516190-79516212 ATCTGGACGCAGCTGGTGGTGGG - Intronic
1160810813 19:1012242-1012264 CAATGGAGCCAGCTGGGGCAGGG - Intronic
1160811699 19:1015607-1015629 CTGAGGACCCAGCTGGGCCAAGG + Intronic
1160856688 19:1221005-1221027 CTCTGGACCCACCCGGGGAAGGG - Intronic
1161358085 19:3830587-3830609 CCCCTGACCCAGCTGGGGATGGG - Intronic
1161378126 19:3950471-3950493 CTGTGGGCCCAGCTAGGGCCTGG + Intergenic
1161594695 19:5145039-5145061 CGCAGGACCCAGCTGAGCCTTGG + Intronic
1161719488 19:5895129-5895151 TGCTGCCCCCAGCTGGGGCTGGG + Intronic
1161798896 19:6404394-6404416 CTGGGGTCCCAGATGGGGCTAGG - Intergenic
1163110909 19:15160698-15160720 CTGGGGCCCCAGCTGGGTCTGGG + Exonic
1163475754 19:17525208-17525230 CTCTGGATCCAGCGTTGGCTGGG - Intronic
1164491147 19:28715220-28715242 CTCTGGATCCACCTGGAGCCTGG + Intergenic
1165417790 19:35705407-35705429 CTTTGGAGCCAGCCTGGGCTGGG + Intronic
1165744888 19:38224662-38224684 CTCTGGAGCCAGGAGGGACTTGG - Intronic
1165983540 19:39747209-39747231 TTCTGGACCCACCTGGGGCCTGG + Intergenic
1165984128 19:39752424-39752446 TTCTGGACCCACCTAGGGCCTGG + Intergenic
1166536366 19:43577240-43577262 CTCTGCACCCTCCTGGGTCTTGG + Intronic
1166818288 19:45560391-45560413 CTCTGTGCCTATCTGGGGCTGGG - Intronic
1167083213 19:47291311-47291333 CTCTGGACCCACCCAGGGCCGGG + Intronic
1167271420 19:48508680-48508702 CTCTGGACCGAGCTAAGGGTGGG - Intronic
1167311930 19:48741865-48741887 CTCTGGACCCACCATGGGCTTGG + Exonic
1167667958 19:50833609-50833631 CCCCAGACCCAGCTGGGACTGGG - Intronic
1168164038 19:54534300-54534322 CCCTGGATCCAGCTGGGGTCAGG - Intronic
1168165409 19:54543674-54543696 CTCTGGCCTCAGCCTGGGCTTGG - Exonic
1168219769 19:54952302-54952324 CTCTGCACCCGGCCGGGGCTAGG - Intronic
1168288827 19:55347308-55347330 CTGGGGTCCCAGCAGGGGCTGGG - Exonic
1168378773 19:55902489-55902511 CTCTGGAGCCAGTTGGGCGTGGG + Intronic
925409399 2:3631467-3631489 CACTGGGCACAGCTGGGCCTGGG - Intronic
925568450 2:5282951-5282973 CTCTGGCCTCAGATGGGGCATGG + Intergenic
927702186 2:25275720-25275742 CTGAGGACCCAGCAGGGCCTAGG + Intronic
928293620 2:30061675-30061697 CTCTGGACCCACCTGGGCCCTGG + Intergenic
928472291 2:31586300-31586322 CTCTGGACCCACCTGGGGCTTGG + Intergenic
928668810 2:33579427-33579449 CTCTGGAGCCAGATGGCCCTAGG + Intergenic
929441324 2:41967603-41967625 TTCAGGACCCAGCAGGGCCTGGG - Intergenic
930492431 2:52092801-52092823 CTCTAGATCCACCTGGGGCCTGG - Intergenic
930534562 2:52630151-52630173 CACTTGGCCCAGCTGGGGGTGGG - Intergenic
930781130 2:55225477-55225499 CTCTGGACCCGGCAGTGGTTGGG + Intronic
931012095 2:57929155-57929177 CTCTGGACCTAGCTGGGACCAGG - Intronic
931516871 2:63055272-63055294 CTCTGGAGCCAGCTGAGGAGGGG + Intronic
931736618 2:65199943-65199965 CTCCGGACCCACCTGGGGTTGGG + Intergenic
932284208 2:70518825-70518847 CTCTGGCCTCTGCTGGGGCTGGG + Intronic
932435211 2:71699330-71699352 CTCCTCCCCCAGCTGGGGCTGGG + Intergenic
932467844 2:71934956-71934978 CTGTGGGCCCAGCCTGGGCTTGG + Intergenic
932726336 2:74182893-74182915 CTGTAGTCCCAGCTGAGGCTGGG + Intergenic
934925677 2:98380381-98380403 CTCTGGTGCCTGCTGGGGCCAGG + Intronic
935311363 2:101787174-101787196 CTCTGGACCCACCTGATGGTGGG - Intronic
935478536 2:103556617-103556639 CTCTCGACCCACTTGGGGCCAGG - Intergenic
935813030 2:106818115-106818137 CTCAAGACCCACCTGGGGCCAGG + Intronic
935928175 2:108093218-108093240 TTCTGGACACACCTGGGGCCTGG - Intergenic
937223170 2:120353606-120353628 CACTGGTCCCAGGTGGGGCTGGG - Intergenic
937290728 2:120780288-120780310 CTCAGCCCCCAGCTGGAGCTCGG - Intronic
937297735 2:120819917-120819939 CTCAAGACCCAGCTCAGGCTGGG - Intronic
937702728 2:124882179-124882201 CCCTGAACTCAGCTGTGGCTAGG - Intronic
937909350 2:127068053-127068075 ATCTGAGCCCAGCTGGGGCAGGG - Intronic
938118920 2:128620298-128620320 CACTGGGCCCAGCTGGGATTAGG - Intergenic
938954257 2:136283495-136283517 CTGTGGACAAAGCAGGGGCTGGG - Intergenic
939257168 2:139759314-139759336 TTCTGGACCCACCCAGGGCTTGG - Intergenic
939582169 2:143963213-143963235 CTCTGCACCAAGCCAGGGCTAGG - Intronic
940279028 2:151970706-151970728 CACTGGAACCAGCCTGGGCTAGG + Intronic
940710039 2:157151521-157151543 CTTAGGTCCCAGATGGGGCTTGG - Intergenic
941227741 2:162869090-162869112 CTCTGGACCCATCTGGGGCCTGG + Intergenic
942391716 2:175502218-175502240 CTCTGGACCTGCCTGGGGCCTGG - Intergenic
942862864 2:180636589-180636611 CTCTGGACCCATCTGGGGCCTGG + Intergenic
943148250 2:184074096-184074118 ATCTGGACTCAGCTGGGGATTGG + Intergenic
943485392 2:188473378-188473400 CTCTGGACCTGCCTGGGGCCTGG - Intronic
944895094 2:204155876-204155898 CTCTGGACCCTGCCCTGGCTTGG + Intergenic
944941327 2:204631533-204631555 CACTGTGCCCAGCTGGGTCTTGG + Intronic
945461634 2:210116298-210116320 CTCTAGACCCACCCGGGGCTGGG + Intronic
946310704 2:218881036-218881058 CGCTGGCCGCGGCTGGGGCTGGG - Exonic
946984775 2:225258764-225258786 TTCTGGACCCACTTGGGTCTGGG + Intergenic
946999528 2:225437815-225437837 CTATGGAGTCAGATGGGGCTAGG - Intronic
947621488 2:231593920-231593942 CTCGGGGCCCAGCTTGCGCTCGG + Exonic
947707242 2:232286154-232286176 CTGTTGACCCAGCAGGGCCTTGG + Intronic
947740400 2:232482298-232482320 TCCTGAACCCAGCTGGGTCTGGG + Intronic
948284601 2:236773924-236773946 CTGGGGAACCAGCTGTGGCTGGG + Intergenic
948774746 2:240278262-240278284 CTCTGGACCAATCTGGGGCTGGG + Intergenic
948798642 2:240420179-240420201 CTCTGCCACCAGCTGGGGCTTGG - Intergenic
948940833 2:241195540-241195562 CTCTGGTCCCAGCCAGGGCTAGG - Intronic
1169213156 20:3778682-3778704 CTCTGCACACAGCTGGGGTTGGG - Intronic
1169650842 20:7865486-7865508 TGCAGGACCCAGCTGAGGCTGGG + Intergenic
1170032310 20:11956273-11956295 CTCAGGACCAGGCTGAGGCTGGG - Intergenic
1170408093 20:16060621-16060643 CACTGCACCCAGCCGGTGCTAGG - Intergenic
1171188068 20:23137505-23137527 CTCAGTACCCAGGTGGGGGTGGG + Intergenic
1171409214 20:24934824-24934846 CTCTGGTGCCATCTGGGGCTTGG - Intergenic
1171723015 20:28584301-28584323 CTCTGGAGTCAGCTGGGCCTGGG + Intergenic
1171755069 20:29099151-29099173 CTCTGGAGTCAGCTGGGCCTGGG - Intergenic
1171787618 20:29483741-29483763 CTCTGGAGTCAGCTGGGCCTGGG + Intergenic
1171860336 20:30395640-30395662 CTCTGGAGTCAGCTGGGCCTGGG - Intronic
1172520035 20:35560353-35560375 CCCTTCACCCAGCTGGGGCCGGG + Intergenic
1172694536 20:36813003-36813025 CAGTGCCCCCAGCTGGGGCTGGG - Intronic
1173159669 20:40643117-40643139 CTCTGGGGCCAGATGGGGCTGGG + Intergenic
1173188417 20:40858549-40858571 CTCCTCACCCAGCTGGGACTAGG + Intergenic
1173192347 20:40886256-40886278 CTCTGAACCCTGCTGAGGTTTGG + Intergenic
1173907056 20:46637132-46637154 AGCTGGACCCAGGTGGAGCTGGG - Intronic
1174852861 20:54012864-54012886 CTCTGAAATCAGCTGGGCCTGGG - Intronic
1175478826 20:59297152-59297174 ATCAGGACACTGCTGGGGCTCGG - Intergenic
1175490950 20:59381014-59381036 CTCTGGACCCAGCCAGACCTGGG - Intergenic
1175576204 20:60062644-60062666 CTCAGGAACCAGCTGCAGCTGGG + Intronic
1175971650 20:62689557-62689579 CGCTGGGCCCTGCTGGGGCTGGG - Intergenic
1176241302 20:64077062-64077084 CTCTGGACCCAGCTCTGCCTAGG + Intronic
1176375537 21:6085347-6085369 CGCTGGTCCCAGATGGGGCTGGG - Intergenic
1176629044 21:9119999-9120021 CTCTGTACCCAGCTCGCCCTTGG + Intergenic
1177133044 21:17280151-17280173 CTCTGGACCCACCTTAGGCCTGG + Intergenic
1177274763 21:18895764-18895786 CTCTGAATCCAGCTGGAGCAGGG - Intergenic
1177456394 21:21344674-21344696 CTCTGGACCCACCTGGGGCAAGG + Intronic
1178601535 21:33999040-33999062 CCCTGGCCGCAGCTGGGGATGGG - Intergenic
1178692327 21:34760334-34760356 CTATGGGCTCAGCTGGGGCATGG - Intergenic
1178707136 21:34885672-34885694 ATCAAGACCCAGCTGAGGCTTGG + Intronic
1178981440 21:37268009-37268031 CCCTAGGCCCAGCTGGCGCTGGG - Intergenic
1179064648 21:38013741-38013763 CTCTGCACACAGCTGGGGCATGG - Intronic
1179299219 21:40091382-40091404 CACTGGACCCTGCTGGGGCCGGG - Intronic
1179395988 21:41040387-41040409 TTCTGGACCCACCTGGGACCTGG + Intergenic
1179652572 21:42821156-42821178 CCCTGGACCCACTTGGGGCCTGG + Intergenic
1179684786 21:43047560-43047582 CTCTGGACCCAGTTTGATCTGGG - Intergenic
1179747937 21:43452897-43452919 CGCTGGTCCCAGATGGGGCTGGG + Intergenic
1179956280 21:44740945-44740967 CTCCCCTCCCAGCTGGGGCTGGG + Intergenic
1180296570 22:10942971-10942993 CTCTGGAGTCAGCTGAGCCTGGG + Intergenic
1180412101 22:12623024-12623046 CTCTGGAGTCAGCTGGGCCTGGG - Intergenic
1180614398 22:17118498-17118520 CACTGGCTCCAGCTGGGGTTTGG - Exonic
1180674996 22:17580913-17580935 CTCTGGACACCTGTGGGGCTGGG + Intronic
1180830576 22:18903943-18903965 ACCAGGAGCCAGCTGGGGCTGGG - Intergenic
1180867098 22:19126008-19126030 CTCAGGCCCAGGCTGGGGCTGGG + Intergenic
1181039914 22:20187159-20187181 GTCTGCACACAGCAGGGGCTGGG + Intergenic
1181069103 22:20321341-20321363 ACCAGGAGCCAGCTGGGGCTGGG + Intergenic
1181177505 22:21046072-21046094 CTCGGGACCCTGCTCGGCCTCGG - Exonic
1182019737 22:27071435-27071457 CTCTAGGCCAGGCTGGGGCTGGG + Intergenic
1182335334 22:29580309-29580331 CTCTGGGCTGAGCTAGGGCTTGG - Intronic
1182423610 22:30260415-30260437 CTCTTCCCCCAGCTGGGGCAGGG + Intergenic
1183341909 22:37286259-37286281 ATCTGGGTCCATCTGGGGCTCGG - Intronic
1183357095 22:37365397-37365419 CCCTGGTCTCTGCTGGGGCTTGG - Intergenic
1183522030 22:38301002-38301024 CTCTGGGCCAGGCAGGGGCTGGG + Intronic
1183688834 22:39376915-39376937 CTCTGGGCCCAGCAGGCCCTGGG + Intronic
1184496902 22:44847199-44847221 CTCTGAAGCCAGCAGGGGCCTGG + Intronic
1184549908 22:45198997-45199019 CTCAGGACCCAGCGGGCGCCTGG - Intronic
1184564684 22:45285023-45285045 CTCTGGGCCCTGCTGGCCCTCGG + Exonic
1184742640 22:46438000-46438022 CTTTGGACCCAGGTGGGGGCTGG + Intronic
1185029588 22:48434650-48434672 CACTGAAACCAGCTGTGGCTGGG - Intergenic
1185066543 22:48635167-48635189 CTCTGGCCCCAGCTGGTGCTAGG - Intronic
1185170203 22:49289026-49289048 CTCTGGGCTCAGCTAGTGCTTGG + Intergenic
1185242575 22:49754613-49754635 CACTGGGCACAGCTGGGGCCTGG - Intergenic
1185328447 22:50239563-50239585 CTCTGGACCCAGGTGAGCCAGGG + Intronic
1203280666 22_KI270734v1_random:129214-129236 ACCAGGAGCCAGCTGGGGCTGGG - Intergenic
949155945 3:827389-827411 CTCTGGACCCACCTCAGGCCTGG + Intergenic
949448453 3:4161400-4161422 CTCTGGACCCACCGAGGGCCTGG - Intronic
949829181 3:8196417-8196439 CTCTGGACCTGCCTGGGGTTGGG - Intergenic
950080658 3:10219802-10219824 GGCTGGACCCTGCTGGGGCCTGG + Intronic
950101127 3:10357662-10357684 ATCTGGACCCAGCCAGGGCCTGG + Intronic
950199235 3:11031079-11031101 CTCTGGAGGCTGATGGGGCTGGG - Intronic
950528824 3:13540652-13540674 CTCTGGGTTCAGCTGGGGCAGGG + Intergenic
950653779 3:14424216-14424238 TTCAGGCCCCAGCTGGGGCTAGG + Intronic
950662514 3:14475318-14475340 CACTGCACCCAGCTGGGACATGG + Intronic
951029212 3:17862936-17862958 TTCTGGGCCCACCTGGGGCCAGG - Intronic
951423193 3:22511304-22511326 CTCTGGACCTACCTGGGGCCTGG + Intergenic
951819290 3:26790736-26790758 CTCTGGATCCACCTGGGGCCTGG - Intergenic
952066375 3:29576581-29576603 CTCTGGACCCACCTGGGGCCTGG - Intronic
952195007 3:31065983-31066005 CTCTGGGACCAGCTGAGTCTAGG - Intergenic
952222034 3:31332645-31332667 CTCTGGACACAGCCAGGGCCTGG + Intergenic
952811818 3:37411152-37411174 CTCTGGACCCACCTGGGAACAGG - Exonic
953357167 3:42265391-42265413 CTCTGGCCACAGCTGGCTCTTGG + Exonic
953441798 3:42924801-42924823 CTCTCCTCCCAGTTGGGGCTGGG - Intronic
953876636 3:46670420-46670442 CACTGGAGCAAGCTGGGGCGGGG - Exonic
954299398 3:49691353-49691375 CTCTGGGGCCAGCAGGGGCCAGG + Intronic
954301003 3:49700752-49700774 CTCTGGACTCAGCAGAGGCCAGG + Intronic
954424664 3:50437080-50437102 CTCTGGGGCCAGCTGGGCCCAGG + Intronic
954796334 3:53163004-53163026 CTGTGGAGTGAGCTGGGGCTTGG + Intronic
955274288 3:57532933-57532955 CTCTGGACCCACCTGGGGCTTGG - Intronic
957095376 3:75772693-75772715 CTCTGTACCCAGCTCGCCCTTGG + Intronic
958078428 3:88713240-88713262 TTCTTGACCCACCTGGGGCCTGG + Intergenic
958631134 3:96685399-96685421 TTCTGGACCCACCTGGAGCCTGG - Intergenic
958876760 3:99625235-99625257 CTCTGGACTTACCTGGGGCCTGG + Intergenic
958976909 3:100679057-100679079 CTCTGGACCGACCTGGGGACAGG - Intronic
959189795 3:103097069-103097091 CTCTGGACCTGCCTGGGGCCTGG - Intergenic
959191223 3:103113615-103113637 CTCTGGACACACTTGGGGCCTGG + Intergenic
959547370 3:107612844-107612866 CTCTGGACCCACCCAGGGCCTGG - Intronic
959761884 3:109976113-109976135 TTCTGGACCCACCTGGGACCTGG - Intergenic
959868463 3:111299660-111299682 CTCTGGACCCAGCTGGGGCTAGG - Intronic
960207250 3:114917978-114918000 CTCTGGAACCATCTGGGGCCGGG - Intronic
961107947 3:124258143-124258165 CTCTGGCCACTGCTGGGGTTGGG + Intronic
961213417 3:125142284-125142306 CTCTTAGCCCATCTGGGGCTGGG - Intronic
962193662 3:133337099-133337121 CTCTGGACCCACCTGGGGCCTGG + Intronic
962862556 3:139418462-139418484 CTCTAGACCCATCTGGGGCCTGG - Intergenic
963448116 3:145440547-145440569 TTCTGGACCCACCTGGGGCCTGG + Intergenic
963602986 3:147393315-147393337 CTCCGGAGCAAGCTGGGGCGCGG - Intronic
964087450 3:152835132-152835154 CTCCGGACAGAGCTGGGCCTGGG + Exonic
964179477 3:153865868-153865890 CTCTGGACCCAGTCAGGGATGGG + Intergenic
964209232 3:154209850-154209872 CTCTCGACCCACCTGGGGCCTGG - Intronic
964253771 3:154750651-154750673 CTCTGGACCAGCCTGGGTCTGGG + Intergenic
964349891 3:155791875-155791897 CTCTGGACCTATCTGAGACTGGG + Intronic
964582829 3:158259676-158259698 CTCTGGACCTGCCTGGGGCTGGG - Intronic
964586790 3:158315520-158315542 CTCTGGAGCCTGCTTGGTCTAGG - Intronic
964961121 3:162427878-162427900 TTCTGGACTCACCTGGGGCCTGG + Intergenic
965045688 3:163573792-163573814 CTCTGGACCCAGCTGCAACCAGG + Intergenic
965144924 3:164889463-164889485 CTCTGGACCAGCCTGGGGTTGGG - Intergenic
965380692 3:167983727-167983749 GTCTGGACCCACTTGGGGCCTGG + Intergenic
966142012 3:176767472-176767494 CTCTGGACCCACCTGAGAGTAGG + Intergenic
966312970 3:178615372-178615394 CTCTGGACCCACTTGGGGCCTGG - Intronic
966348637 3:179005395-179005417 CTCTGGACCCACCTGGGGCCTGG + Intergenic
967636677 3:191809359-191809381 CTCTGGACCCACCTGAGGCAGGG + Intergenic
968083101 3:195860412-195860434 CTGTGGACCCATCTGGGGCACGG + Intergenic
968362796 3:198159607-198159629 CTATGGACCCAGATGGTCCTGGG + Intergenic
969089844 4:4685470-4685492 ATCTGGAGCCAGCCTGGGCTAGG + Intergenic
969365879 4:6694088-6694110 TGCTGGACTCAGCGGGGGCTGGG + Intronic
970173181 4:13309166-13309188 CTCTGCAGCCACCTGGAGCTAGG + Intergenic
970599938 4:17633731-17633753 GTCCGGCCACAGCTGGGGCTTGG + Exonic
971166026 4:24184606-24184628 CTCTGGGCCCAGCCTTGGCTTGG + Intergenic
972909610 4:43797979-43798001 ATCTGGACCCACCTGGGGCCTGG + Intergenic
973227517 4:47802658-47802680 CTCTGGACCCACCTGAGGCCTGG + Intronic
974469723 4:62302816-62302838 CTCTGAACCCAGCTGGAGCCTGG + Intergenic
975081063 4:70281039-70281061 CTCTGGACCCACCTGAGGTCTGG + Intergenic
975095255 4:70450050-70450072 TTCTGGACCCATCTGGGGAATGG - Intronic
975503976 4:75117783-75117805 CTCTTGACCCATCTGGGGCCTGG + Intergenic
975592701 4:76016672-76016694 CTCTGGGCCCATCTGGTGCCTGG - Intronic
976254123 4:83083087-83083109 CTCTGGACTCACCTGGGGCCTGG - Intergenic
976451791 4:85199232-85199254 CTCTAGAACCAACTGGGCCTGGG - Intergenic
976908307 4:90267389-90267411 CTCTGGACCCACCTGGGGCCTGG + Intronic
977772847 4:100880229-100880251 GACTGGACCCTGCTGGGGATGGG + Intergenic
977923518 4:102672044-102672066 CTCCCCTCCCAGCTGGGGCTGGG - Intronic
978654441 4:111049423-111049445 CTTTGGACCCACCTGGGGCCAGG + Intergenic
978661865 4:111137011-111137033 TTCTGGACACAGCTGGGGCTTGG - Intergenic
979213213 4:118132163-118132185 CTCTGGACCTGCCTGGGGCCTGG - Intronic
979219059 4:118200149-118200171 CTCTGGACCCTCCTGGAGCTTGG - Intronic
979851165 4:125572995-125573017 ATCTGGACCTGCCTGGGGCTTGG - Intergenic
979867485 4:125775091-125775113 GTCTGGACCCAGTTGGAGCCCGG + Intergenic
980744981 4:137001242-137001264 CCCTGGACCCAGCAGAGGTTTGG + Intergenic
982731085 4:158956275-158956297 CACCGCACCCAGCTAGGGCTTGG - Intronic
982828232 4:160027095-160027117 CCCTGGACCCACCCAGGGCTTGG - Intergenic
983456350 4:167969173-167969195 CTCTGTACCCACCTGGGGCCTGG + Intergenic
985438501 4:189959462-189959484 CTCTGGAGTCAGCTGGGCCTGGG - Intronic
985583440 5:712441-712463 CACTAGACCCAGCTGGGAGTGGG - Intronic
985596955 5:796739-796761 CACTAGACCCAGCTGGGAGTGGG - Intronic
985967486 5:3348735-3348757 CTCTGAACGCAGCTGGCGCGGGG - Intergenic
986685750 5:10274070-10274092 CTCTGGACAGAGCTGGGCTTTGG - Intergenic
987823180 5:22991937-22991959 CTCTGGACCCACCTGGTGTCTGG + Intergenic
988117917 5:26920411-26920433 CTCTGGACCCACCTAGGACCAGG + Intronic
989427880 5:41316901-41316923 TTCTGGACCCACCCAGGGCTTGG + Intronic
989504764 5:42215100-42215122 CTCTGGACCCATCTGGGTCCTGG - Intergenic
989970679 5:50520994-50521016 CTCTGGACCCATCTGGGATCTGG - Intergenic
990578909 5:57150006-57150028 CTCTGGACCCACCCAGGGCCTGG - Intergenic
991039789 5:62163107-62163129 CTATGGAGCCAGCAGGGGCTAGG - Intergenic
992747282 5:79832129-79832151 CTCTGTGCCCAGCTGAGGCCAGG - Intergenic
994428665 5:99627850-99627872 TTCTGGACTCATCTGGGGCTTGG - Intergenic
995371916 5:111427783-111427805 TTCTGGACCCAGCGGGGGCCTGG + Intronic
995747299 5:115417470-115417492 CTCTGTACCCTGCTGTGGGTGGG - Intergenic
995777907 5:115745518-115745540 CTCTGGACCCACCTGGGGCATGG - Intergenic
996133329 5:119809038-119809060 TTCTGGACCCACCTGGGGCCTGG - Intergenic
996663043 5:126026954-126026976 CCCTGGAGCCATCTGGGGCCTGG - Intergenic
997434665 5:133865636-133865658 CCCTGCACTCAGCTGGGCCTGGG - Intergenic
997485136 5:134225338-134225360 CTCTGGACCTAACTAGGCCTGGG + Intronic
997637848 5:135427812-135427834 CCCGGGAACCACCTGGGGCTAGG - Intergenic
998634075 5:143932687-143932709 CTCTGGACACACTTGGGGCCTGG + Intergenic
999345717 5:150817320-150817342 TTCTGAACCCACCTGGGGCTTGG + Intergenic
999477382 5:151913000-151913022 GTCCGTGCCCAGCTGGGGCTAGG + Intronic
999868637 5:155728310-155728332 CTCCGGCTCCAGCTGGGGCTTGG - Intergenic
1000159790 5:158586452-158586474 TTCTGGACCCACCAGGGCCTAGG - Intergenic
1000399548 5:160811740-160811762 CTCTGGACCCACCAAGGGCCTGG + Intronic
1000455002 5:161437943-161437965 TTCTGGACCCACCTGGGGCCTGG + Intronic
1001252332 5:170156066-170156088 TTCTGGACTCAGCCTGGGCTGGG + Intergenic
1001277350 5:170360306-170360328 CTCTGGACCCAGAGGGACCTGGG + Intronic
1001293975 5:170485802-170485824 GTTTGAGCCCAGCTGGGGCTGGG - Intronic
1001429420 5:171647570-171647592 GACTGGACCCAGCAGAGGCTGGG + Intergenic
1001768782 5:174276718-174276740 CTGTGCACCCAACTGGGGATTGG + Intergenic
1002042787 5:176527118-176527140 CGCTGGGCCCAGCCAGGGCTGGG + Exonic
1002280786 5:178129024-178129046 CTCAGGCCTCAGCTGGGACTAGG - Intergenic
1002424948 5:179169466-179169488 CTCTGGACCCAGGTAGGTCTGGG + Intronic
1002431723 5:179207970-179207992 CTGTGGCCCCTGCTGTGGCTGGG - Intronic
1002599522 5:180346365-180346387 TCCTGGACCCATCTGGTGCTAGG - Intronic
1002678141 5:180935737-180935759 CCATGGAGCCAGGTGGGGCTGGG - Intronic
1003502286 6:6712536-6712558 CTCTGCACACAGCAGAGGCTTGG + Intergenic
1003656896 6:8020298-8020320 CTCTGCCCCTAGCTGGGGCCAGG - Intronic
1004003131 6:11614140-11614162 CTGTGGGCCCAGCATGGGCTTGG + Intergenic
1004433044 6:15563767-15563789 CACTGCGCCCAGCTGGGGCTAGG - Intronic
1004854246 6:19733265-19733287 CCCTGGGACCAGGTGGGGCTTGG - Intergenic
1004920011 6:20367493-20367515 CTCTGGTCCCAGCAGGCTCTGGG + Intergenic
1005782177 6:29203227-29203249 CCCAGGAGCCATCTGGGGCTGGG + Intergenic
1006339942 6:33441396-33441418 CTCTGGAGCCATCTGGGGATAGG - Intronic
1006401460 6:33820399-33820421 TTCTCGAGCCAGATGGGGCTGGG + Intergenic
1006794185 6:36721670-36721692 TGCTGGACCCAGCTGGGGCCTGG - Exonic
1007100223 6:39240852-39240874 CTCTGGCACCAGCTGGAGATGGG - Intergenic
1007164975 6:39822818-39822840 CTCAGGACACAGCTGGGACAGGG + Intronic
1007401690 6:41606143-41606165 CTGGGGACCAAGCTGGGGCTTGG + Intergenic
1007449624 6:41932954-41932976 CCCAGTCCCCAGCTGGGGCTTGG + Exonic
1007724279 6:43905457-43905479 CTCTGGACCAGCCAGGGGCTAGG - Intergenic
1008033133 6:46719381-46719403 CACTGGCACCAGCTGGAGCTTGG + Intronic
1008092695 6:47309204-47309226 CTCAGGGCTCAGCCGGGGCTGGG - Intronic
1008192438 6:48476033-48476055 CTCTGGACCCACCTGGGTGTGGG + Intergenic
1008541704 6:52551628-52551650 CTCTGGCACCAGCTGGGGTTTGG + Intronic
1008605596 6:53136684-53136706 CACTGCACCCAGCTGGGACTTGG - Intronic
1008858011 6:56114108-56114130 TTCTGGACCCATTTGGGGGTTGG + Intronic
1009309081 6:62126392-62126414 CTCTGGACCTGCCTAGGGCTAGG + Intronic
1009847286 6:69150205-69150227 CTCTGGACTCAACTGGGACCTGG - Intronic
1010313789 6:74420917-74420939 CTCTGGACCCATCTATGGCCTGG + Intergenic
1010343286 6:74781981-74782003 TGCTGGACCCATCTGGGGCCTGG + Intergenic
1010548075 6:77183750-77183772 CTCTGGACTCACCTAGGGCCTGG + Intergenic
1010838976 6:80624645-80624667 CTCTGGACACACTTGGGGCCTGG + Intergenic
1011333158 6:86233160-86233182 CTCTGGACCTGCCTGGGGCCTGG - Intergenic
1011411856 6:87074462-87074484 GTGGGGACCCAGCTGGGGCCTGG + Intergenic
1011590536 6:88966359-88966381 CTCCCCTCCCAGCTGGGGCTGGG + Intergenic
1011914544 6:92487841-92487863 CTCTGGGCCCACCAGGGGCCTGG - Intergenic
1012003686 6:93685492-93685514 CTCTGGACCCACCTGGGACCTGG + Intergenic
1012028682 6:94030163-94030185 CTCTGGACCCACCTGGGGCCTGG + Intergenic
1012047839 6:94301207-94301229 CCCTGGACCCACCCGGGGCCAGG + Intergenic
1012073696 6:94657112-94657134 ATCTGGACCTACCTGGGGCCTGG - Intergenic
1014862338 6:126485060-126485082 CTCTGGACCCACCCAGGGCTGGG + Intergenic
1015030381 6:128587176-128587198 CTCTGGACCCACGTGGGGCCTGG + Intergenic
1015525285 6:134170251-134170273 CTCTGAACCCTGTTAGGGCTTGG - Exonic
1016054509 6:139565482-139565504 ACCTGGACCCACCTAGGGCTGGG - Intergenic
1018696454 6:166395289-166395311 CTGTGGATCCAGCTGGGCGTGGG - Intergenic
1018729844 6:166640494-166640516 CTCGGGAGGAAGCTGGGGCTGGG + Intronic
1018845344 6:167551814-167551836 CTCTCGCCCCAGCTGGTCCTGGG - Intergenic
1019252887 7:29104-29126 CTATGGACCCAGATGGTCCTGGG - Intergenic
1019297320 7:285055-285077 CTCTGCACCCAGCTGGCCCTGGG + Intergenic
1019415721 7:925767-925789 CCCTGCACCCAGCTCGTGCTCGG + Intronic
1019532408 7:1510476-1510498 CCCTGGACCCAGCAGGGGACTGG - Intergenic
1020481590 7:8668918-8668940 CTCTGGATCCAACTGGAGCATGG + Intronic
1020573083 7:9890659-9890681 CTCTGGACCTGCCTGGGGTTGGG + Intergenic
1021036899 7:15810278-15810300 TTCTGCAGCCAGCTTGGGCTTGG + Intergenic
1022275070 7:28847194-28847216 TCCCGGACTCAGCTGGGGCTGGG - Intergenic
1022873460 7:34503638-34503660 ATCTGGAGTCAGCTAGGGCTGGG + Intergenic
1023320885 7:38996327-38996349 CACTGCACCCAGCTGGGGCTTGG + Intronic
1024070032 7:45777152-45777174 ATCTGAACCAAGCTGGGACTGGG + Intergenic
1024399821 7:48911288-48911310 CTCTGATCCCAGCAGGAGCTTGG - Intergenic
1024908057 7:54410614-54410636 CTCTGGACCCAGCCTGGCCTAGG + Intergenic
1026741441 7:72981163-72981185 TCCTGGACCCAGCCGTGGCTGGG - Intergenic
1026801278 7:73401533-73401555 TCCTGGACCCAGCCGTGGCTGGG - Intergenic
1027102294 7:75383915-75383937 TCCTGGACCCAGCCGTGGCTGGG + Intergenic
1027187432 7:75980676-75980698 CCCTGGAGCCGACTGGGGCTGGG - Intronic
1027524146 7:79245677-79245699 CTCTGGACCCACCTGGGATCAGG + Intronic
1027808321 7:82859149-82859171 TTCTGGACCCACCTGGGGCCTGG + Intronic
1027996182 7:85427654-85427676 ATGTGGACCCACCTGGGCCTGGG + Intergenic
1028186308 7:87789924-87789946 CTCTGGACCCACCCAGGGCCTGG + Intronic
1028264390 7:88705239-88705261 CTCTGGACCCAGCTGGAGCCTGG - Intergenic
1029605838 7:101598940-101598962 CACTGGGCCCAGCTGGGGGATGG + Intergenic
1029887469 7:103888377-103888399 CTCTTCCCACAGCTGGGGCTTGG + Intronic
1030222528 7:107111302-107111324 CTCTGGATCTGCCTGGGGCTTGG + Intronic
1031361734 7:120856909-120856931 CTCTGGACCCTGCTGAGGGCGGG - Intronic
1031923569 7:127618645-127618667 CTCTGGGGACAGCTGGTGCTAGG - Intergenic
1033040981 7:137917992-137918014 CTCTGGGCTGAGCTGGGGCACGG - Intronic
1033619478 7:143049351-143049373 CTCTGGATCCAGCCCTGGCTAGG + Intergenic
1033867714 7:145713199-145713221 CTCTGGACCCACCTGGGGCCTGG - Intergenic
1034955815 7:155333977-155333999 CTCTGAACCCAGCTGGGCATTGG - Intergenic
1035333825 7:158113155-158113177 CTCTGGACCAATCTGAGGCCCGG - Intronic
1036411627 8:8506870-8506892 CACATGACCAAGCTGGGGCTGGG + Intergenic
1037161741 8:15781200-15781222 CTCTGCACCCAGCTTGGGAGAGG - Intergenic
1037730360 8:21518872-21518894 CTCTGGCCCCACCTGCTGCTAGG - Intergenic
1038592392 8:28851723-28851745 CACTGCACCCAGCCGGGGGTGGG + Intronic
1038871821 8:31503611-31503633 TTCTGGATCCACCTGGGCCTAGG - Intergenic
1039282041 8:35996824-35996846 TTCTGGACCCACCAGGGCCTGGG - Intergenic
1040095772 8:43440858-43440880 CTCTGGACCCACATGGGGCCTGG + Intergenic
1040485813 8:47870079-47870101 CTCTTGACCCACCTGGAGCCAGG + Intronic
1041023974 8:53665697-53665719 CTGTGCGCCCTGCTGGGGCTGGG - Intergenic
1042162703 8:65912928-65912950 CTCTGGACCCACCTGGGGCCTGG + Intergenic
1044192991 8:89342127-89342149 CTCTGGACCCACTTGGAGCTTGG - Intergenic
1044395153 8:91702707-91702729 TTCTGGACCCATCTGGGGCCTGG - Intergenic
1044758681 8:95493718-95493740 CTCTGCTCCAAGCTGGGCCTTGG - Intergenic
1045066953 8:98456717-98456739 CACTGCACCCAGCTCAGGCTTGG + Intronic
1045590024 8:103582833-103582855 CTCTGGACCCACCTGGGGCCTGG + Intronic
1045777381 8:105821759-105821781 CTTTGGACCCACCTGGGGCCTGG - Intergenic
1046169484 8:110486118-110486140 TTCTGGACCCAGTAGGGGCAGGG + Intergenic
1046268122 8:111858416-111858438 CTCTGGACCCACCTGGAGCCTGG - Intergenic
1047342709 8:123998659-123998681 CTCTGGACCCATCTGGGGCCAGG - Intronic
1048509874 8:135052642-135052664 CTCTGAAGCCAGCTGAGGTTGGG - Intergenic
1048980157 8:139698976-139698998 CTCGGGGCCCAGCTGAAGCTAGG - Intronic
1049447388 8:142637597-142637619 CTGTGGTCCCAGCTGGGCCATGG - Intergenic
1049607152 8:143534986-143535008 CTCTGGAAGGAGCTGGGCCTGGG - Intronic
1050176405 9:2873610-2873632 CTCTGGGCCAAGATGGGGTTTGG + Intergenic
1050248253 9:3714240-3714262 CTCTGGACACACCTGGGGCCTGG + Intergenic
1050266663 9:3897859-3897881 CTCTGGAATCAGATGGGGGTGGG + Intronic
1050355948 9:4782594-4782616 CAATGGACCCACCTGGGGCCTGG + Intergenic
1050508307 9:6369624-6369646 TTCTGGACCTGCCTGGGGCTGGG + Intergenic
1050553785 9:6771756-6771778 CCCTGCACCCAGCTGTGGCCTGG - Intronic
1052063384 9:23987516-23987538 CTCTGGACCTCCCTGGGGCCTGG + Intergenic
1052346381 9:27413878-27413900 CTCAGGAACCAGCTATGGCTTGG - Intronic
1052607509 9:30723523-30723545 CTCTGGATCCACCAGGGGCCTGG + Intergenic
1053747520 9:41214798-41214820 CTCTGGAGTCAGCTGGGCCTGGG - Intergenic
1054338863 9:63835727-63835749 CTCTGGAGTCAGCTGGGCCTGGG + Intergenic
1054479765 9:65650570-65650592 CTCTGGAGTCAGCTGGGCCTGGG + Intergenic
1054810873 9:69432930-69432952 TTCTCATCCCAGCTGGGGCTGGG + Intronic
1055339183 9:75263394-75263416 TTCTGGGCCCACCTAGGGCTTGG - Intergenic
1055387338 9:75776351-75776373 CTCTGGACCCATCTGGGGTCTGG + Intergenic
1056230501 9:84538525-84538547 CTCTAGACCCACCTGGAGCCAGG - Intergenic
1056424618 9:86464569-86464591 CTCTGGACCCAGCCAGGGTCTGG - Intergenic
1057231052 9:93321488-93321510 CCCTGCTCCCAGCTGAGGCTTGG - Intronic
1057448000 9:95132139-95132161 CTCTGGACCCAGCTGCGGGCGGG + Intronic
1057911489 9:99023377-99023399 CTCTGGCCTAGGCTGGGGCTCGG + Exonic
1058930823 9:109717121-109717143 CTCTTGACCCAGTAGGGGCCTGG + Intronic
1059029233 9:110672355-110672377 CTGAAGACCCAGCTGGGGCTAGG + Intronic
1059335843 9:113567920-113567942 CCAGGGACCCAGCTGGGGATAGG - Intronic
1059421131 9:114193135-114193157 CTCTGGGCCCAGCTGAGGCAGGG + Intronic
1059515458 9:114890023-114890045 CTCTGCACTCATCTGGGGCTTGG + Intergenic
1059565523 9:115380022-115380044 CACTGCACCCAGCTGAGGCCAGG - Intronic
1059707388 9:116837801-116837823 CCCAGGACCCAGGTGGGGCAGGG - Intronic
1060225232 9:121786351-121786373 CTCTGGCTCCAGCTAGGGATTGG + Intergenic
1060516898 9:124271634-124271656 CTCTGGGGCCAGCCGGGCCTGGG - Intronic
1060553028 9:124494692-124494714 CTCTGGCCCCAGGTGGGGAGTGG - Intronic
1060553061 9:124494794-124494816 CTCTGGCCCCAGGTGGGGAGTGG - Intronic
1060555471 9:124505273-124505295 CTGTGAACCCAGCTGGGTCGTGG + Intronic
1060765602 9:126293390-126293412 AGCTGGAGCCAGCAGGGGCTGGG + Intergenic
1061011951 9:127961151-127961173 GTCTGGACGCAGATGGGGCTGGG - Intronic
1061122301 9:128651083-128651105 CACTGCACCCAGCAGGTGCTTGG - Intronic
1061407746 9:130402161-130402183 TTCTGGTTCCATCTGGGGCTGGG + Intronic
1061431531 9:130534351-130534373 CTCTCTGCCCACCTGGGGCTCGG + Intergenic
1062012521 9:134274666-134274688 CTCAGGACCCAGGTGGACCTGGG + Intergenic
1062218057 9:135399766-135399788 ATCTGGACCCAGCTCTGGCAAGG - Intergenic
1062282119 9:135756826-135756848 CTCTGGAGCAGGCCGGGGCTGGG - Intronic
1062351531 9:136142096-136142118 CACTGGTCACAGCTGGGACTAGG - Intergenic
1062357180 9:136170517-136170539 CTGTAGACCCAGCAGGGGCAGGG + Intergenic
1062578272 9:137218453-137218475 CTCTGGACCCTGCGGGAGCGGGG + Intergenic
1062590956 9:137274463-137274485 CTGGGGACCCAGGTGAGGCTGGG + Intergenic
1062613382 9:137385149-137385171 CTCTGCAGCCACCTGGGCCTGGG + Intronic
1062635364 9:137487768-137487790 CTCGGGGGCCAGCTGGGGTTGGG - Intronic
1062747483 9:138223270-138223292 CTATGGACCCAGATGGTCCTGGG + Intergenic
1202783652 9_KI270718v1_random:25569-25591 CTCTGGAGTCAGCTGGGCCTGGG - Intergenic
1202803423 9_KI270720v1_random:23998-24020 CTCTGGAGTCAGCTGGGCCTGGG + Intergenic
1203751888 Un_GL000218v1:87681-87703 CTCTGTACCCAGCTCGCCCTTGG + Intergenic
1203448222 Un_GL000219v1:81221-81243 CTCTGGAGTCAGCTGGGCCTGGG + Intergenic
1187651987 X:21419994-21420016 CTCTGGACCCACCCAGGGCCTGG - Intronic
1187846335 X:23541502-23541524 TTCTGGACCCACCTGGGGCCTGG + Intergenic
1188046178 X:25428201-25428223 CTTTGGACCCGCCTGGGGCCTGG - Intergenic
1188363719 X:29288316-29288338 CACTGGGGCCTGCTGGGGCTGGG - Intronic
1188476402 X:30597459-30597481 CTCTGGATCATGCTGGGGTTGGG + Intergenic
1188815249 X:34705234-34705256 TTCTGGACCCACCCGAGGCTAGG - Intergenic
1188924551 X:36023556-36023578 CTCTGGACCCACCCGGGGCCTGG - Intergenic
1188930102 X:36098458-36098480 CTCTGGACCCACCTGGGGTCTGG - Intronic
1189023756 X:37370447-37370469 CCATGGAGCCAGCAGGGGCTGGG + Intronic
1189280666 X:39818462-39818484 CCCTGTACCCATCTAGGGCTAGG - Intergenic
1189657928 X:43266824-43266846 CTCTGGACCCACCTGGGACATGG - Intergenic
1189664927 X:43343795-43343817 CAGTGGACCCAGCTGGGCGTGGG - Intergenic
1190588078 X:51967393-51967415 CTCTGGACCCACCTGGGGCCTGG - Intergenic
1190614666 X:52217841-52217863 CTCTGGACCCACTTGGGGCCTGG + Intergenic
1190919488 X:54838882-54838904 CTCTAGACCCACCTAGGGCCTGG - Intergenic
1191863200 X:65682854-65682876 ATGTGGACCCAGCTGGGCCCTGG + Intronic
1191994717 X:67080466-67080488 TTCTGGACCCACCTGGGGACTGG - Intergenic
1192027211 X:67466409-67466431 TTCTGGACCCACCTGGGGCCTGG + Intergenic
1192043064 X:67643622-67643644 AGGTGGTCCCAGCTGGGGCTTGG + Intronic
1192183680 X:68931544-68931566 CTGTGGACCCAGCTTGGCCTAGG - Intergenic
1192380875 X:70614555-70614577 CTCTGGACTCACCTGGGGCCTGG + Intronic
1192406100 X:70887617-70887639 CTCTGGACCCACCCAGGGCCTGG + Intronic
1192430584 X:71108914-71108936 CTTTGGAACCAGCTGGATCTAGG - Intronic
1192521493 X:71805016-71805038 CTCTGGACCCACCTGGGATCTGG + Intergenic
1192725871 X:73751853-73751875 CTCTGGACACATCTGAGGCCTGG - Intergenic
1192812631 X:74560502-74560524 TTCTGGACCCACCCGGGGATTGG + Intergenic
1192853174 X:74979730-74979752 CTCTGCACCAAGCTGCTGCTGGG - Intergenic
1192855900 X:75011594-75011616 TTCTGGACCCACCTGGGGCTTGG - Intergenic
1192858429 X:75039507-75039529 TTCTGGACCTAGCCAGGGCTGGG - Intergenic
1192995416 X:76507354-76507376 CTCTGGGCCTAACTGGGGCCTGG - Intergenic
1193012908 X:76697476-76697498 CTCTGAACCCACCTGGAGCTTGG + Intergenic
1193260854 X:79404558-79404580 TTCTGGACCCAACTGGGGCCTGG + Intergenic
1193441114 X:81539845-81539867 CTCTGGACCCACCTGGGACTAGG + Intergenic
1193563326 X:83047258-83047280 CTCTGGACCCACCTAGGGCCTGG - Intergenic
1193670358 X:84376794-84376816 CTCTGGACCCACCTGGGGCCTGG + Intronic
1193683659 X:84552289-84552311 CTCTGGACCCACCTGGGGCCTGG - Intergenic
1193756700 X:85418179-85418201 CTCTGGACCAGCCTGGGACTGGG - Intergenic
1193877788 X:86883648-86883670 CTCTGGACTCACCTGGGGAATGG - Intergenic
1193880085 X:86910949-86910971 CTCTGGACCCACCCAGGGCCTGG - Intergenic
1193907640 X:87262108-87262130 TTCTTGACCCACCTGGGGCCTGG + Intergenic
1194023605 X:88724109-88724131 CTCTGGACCCACCCACGGCTTGG + Intergenic
1194360970 X:92950199-92950221 CTCTGGACCCAGCAAGAGCTTGG - Intergenic
1194370880 X:93070021-93070043 GTCTGGACCCACCTGGGGACTGG + Intergenic
1194568503 X:95522989-95523011 CTCTGGACTCACCTAGGGCATGG + Intergenic
1194591583 X:95805914-95805936 CTCCGGACCCACCTGGGGCCTGG + Intergenic
1194787556 X:98105908-98105930 CTCTGGACCCACCTGGGGCATGG - Intergenic
1194791867 X:98160354-98160376 CTCTGGACCCACCTGGGGCCTGG + Intergenic
1194892473 X:99397738-99397760 CTCTGGACCCACCCAAGGCTAGG - Intergenic
1195172196 X:102280793-102280815 TTCTGGACCCACCTGGGGCTTGG - Intergenic
1195186664 X:102406300-102406322 TTCTGGACCCACCTGGGGCTTGG + Intronic
1195254831 X:103081189-103081211 CACTGGCCCCAGCTGGCCCTGGG + Intronic
1195312357 X:103643808-103643830 CTCTGGACCTGCCTGGGGCCTGG + Intergenic
1195559354 X:106265903-106265925 CTCTGGACTTACCTGGGTCTAGG - Intergenic
1195675855 X:107506828-107506850 TTCTGGTCACAGCAGGGGCTGGG + Intergenic
1196096674 X:111808228-111808250 CTCTGGACCCACCTGGGGACTGG - Intronic
1196154106 X:112407548-112407570 CTCTTGACACACCTGGGGCCTGG + Intergenic
1196233433 X:113252572-113252594 CTCTGGACACACCTGGAACTGGG - Intergenic
1196467877 X:115991626-115991648 CTCTGGACCCACCTAGGGTCTGG + Intergenic
1196495428 X:116318589-116318611 CTCTAGACCTACCTGGGGCCTGG + Intergenic
1196552584 X:117046215-117046237 CTCTGGACACGCCTGGGGCCTGG + Intergenic
1196573362 X:117289177-117289199 CTCTAGACCCATCCGGGGCCTGG + Intergenic
1196865431 X:120066513-120066535 TTCTAGACCCACCTGGGGCCTGG + Intergenic
1196877663 X:120169767-120169789 TTCTAGACCCACCTGGGGCCTGG - Intergenic
1197016067 X:121627278-121627300 CTCTGGACCCACCCAAGGCTGGG + Intergenic
1197113001 X:122798167-122798189 CTCTGGACCCACCTGGGGCTGGG + Intergenic
1197376062 X:125682942-125682964 CTCTGGACACACTTGGGGCTTGG + Intergenic
1197524374 X:127544574-127544596 CTCTGGAAACAACTGGGCCTAGG - Intergenic
1197535859 X:127688935-127688957 TTCTGGATCCACCTGGGGTTTGG - Intergenic
1197623472 X:128778635-128778657 CTCAGGACCCACCTGGGGCCCGG - Intergenic
1197987071 X:132278233-132278255 TTCTGGACTCACCTGGGGCTCGG - Intergenic
1198515137 X:137399831-137399853 CTCTGGACACACCTGGGGCATGG - Intergenic
1198697157 X:139354545-139354567 TTCTGGACCTGCCTGGGGCTTGG - Intergenic
1198785392 X:140282944-140282966 CTCTGGACCCATCTGGGACCTGG - Intergenic
1198788255 X:140314278-140314300 CTCTGGACCCACCCAGGGCCTGG + Intergenic
1199191888 X:144980693-144980715 CTCTAGACCCAAGTGAGGCTTGG + Intergenic
1199217857 X:145281911-145281933 CTCTGGACCCACCCAGGGCCTGG - Intergenic
1199274705 X:145927029-145927051 CTCTGGACCCACCCGGGGACTGG + Intergenic
1199568699 X:149246051-149246073 ATCTGGACCCATCTGGGGCTGGG - Intergenic
1199617612 X:149670471-149670493 CTGTGGACCCAGCTGGGGAGAGG - Intergenic
1199625031 X:149732778-149732800 CTGTGGACCCAGCTGGGGAGAGG + Intergenic
1199853388 X:151740814-151740836 TCTTGGACCCAGCTGGGGATTGG + Exonic
1200099811 X:153684885-153684907 TTCAGGCCCCAGCTGGGGCTGGG - Intronic
1200669169 Y:6066011-6066033 CTCTGGACCCTGCAAGAGCTTGG - Intergenic
1200678675 Y:6181911-6181933 GTCTGGACCCACCTGGGGACTGG + Intergenic
1201165545 Y:11205301-11205323 CTCTGTACCCAGCTCGCCCTTGG + Intergenic
1201927758 Y:19308003-19308025 TTCTGAACCCATCTGGGGCTTGG - Intergenic