ID: 959868576

View in Genome Browser
Species Human (GRCh38)
Location 3:111300352-111300374
Sequence AAGGAGAGCACAGTGATTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 737
Summary {0: 4, 1: 34, 2: 84, 3: 158, 4: 457}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959868576_959868583 26 Left 959868576 3:111300352-111300374 CCCACAATCACTGTGCTCTCCTT 0: 4
1: 34
2: 84
3: 158
4: 457
Right 959868583 3:111300401-111300423 GCATCACATGGCTGCTACCAAGG 0: 1
1: 0
2: 5
3: 45
4: 354
959868576_959868582 14 Left 959868576 3:111300352-111300374 CCCACAATCACTGTGCTCTCCTT 0: 4
1: 34
2: 84
3: 158
4: 457
Right 959868582 3:111300389-111300411 AATTCTATCTAAGCATCACATGG 0: 1
1: 0
2: 0
3: 6
4: 141
959868576_959868584 27 Left 959868576 3:111300352-111300374 CCCACAATCACTGTGCTCTCCTT 0: 4
1: 34
2: 84
3: 158
4: 457
Right 959868584 3:111300402-111300424 CATCACATGGCTGCTACCAAGGG 0: 1
1: 0
2: 0
3: 10
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959868576 Original CRISPR AAGGAGAGCACAGTGATTGT GGG (reversed) Intronic