ID: 959868576 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 3:111300352-111300374 |
Sequence | AAGGAGAGCACAGTGATTGT GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 737 | |||
Summary | {0: 4, 1: 34, 2: 84, 3: 158, 4: 457} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
959868576_959868582 | 14 | Left | 959868576 | 3:111300352-111300374 | CCCACAATCACTGTGCTCTCCTT | 0: 4 1: 34 2: 84 3: 158 4: 457 |
||
Right | 959868582 | 3:111300389-111300411 | AATTCTATCTAAGCATCACATGG | 0: 1 1: 0 2: 0 3: 6 4: 141 |
||||
959868576_959868583 | 26 | Left | 959868576 | 3:111300352-111300374 | CCCACAATCACTGTGCTCTCCTT | 0: 4 1: 34 2: 84 3: 158 4: 457 |
||
Right | 959868583 | 3:111300401-111300423 | GCATCACATGGCTGCTACCAAGG | 0: 1 1: 0 2: 5 3: 45 4: 354 |
||||
959868576_959868584 | 27 | Left | 959868576 | 3:111300352-111300374 | CCCACAATCACTGTGCTCTCCTT | 0: 4 1: 34 2: 84 3: 158 4: 457 |
||
Right | 959868584 | 3:111300402-111300424 | CATCACATGGCTGCTACCAAGGG | 0: 1 1: 0 2: 0 3: 10 4: 140 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
959868576 | Original CRISPR | AAGGAGAGCACAGTGATTGT GGG (reversed) | Intronic | ||