ID: 959868577 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 3:111300353-111300375 |
Sequence | GAAGGAGAGCACAGTGATTG TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 916 | |||
Summary | {0: 4, 1: 37, 2: 96, 3: 184, 4: 595} |
Found 4 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
959868577_959868582 | 13 | Left | 959868577 | 3:111300353-111300375 | CCACAATCACTGTGCTCTCCTTC | 0: 4 1: 37 2: 96 3: 184 4: 595 |
||
Right | 959868582 | 3:111300389-111300411 | AATTCTATCTAAGCATCACATGG | 0: 1 1: 0 2: 0 3: 6 4: 141 |
||||
959868577_959868585 | 30 | Left | 959868577 | 3:111300353-111300375 | CCACAATCACTGTGCTCTCCTTC | 0: 4 1: 37 2: 96 3: 184 4: 595 |
||
Right | 959868585 | 3:111300406-111300428 | ACATGGCTGCTACCAAGGGATGG | 0: 1 1: 1 2: 6 3: 37 4: 301 |
||||
959868577_959868583 | 25 | Left | 959868577 | 3:111300353-111300375 | CCACAATCACTGTGCTCTCCTTC | 0: 4 1: 37 2: 96 3: 184 4: 595 |
||
Right | 959868583 | 3:111300401-111300423 | GCATCACATGGCTGCTACCAAGG | 0: 1 1: 0 2: 5 3: 45 4: 354 |
||||
959868577_959868584 | 26 | Left | 959868577 | 3:111300353-111300375 | CCACAATCACTGTGCTCTCCTTC | 0: 4 1: 37 2: 96 3: 184 4: 595 |
||
Right | 959868584 | 3:111300402-111300424 | CATCACATGGCTGCTACCAAGGG | 0: 1 1: 0 2: 0 3: 10 4: 140 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
959868577 | Original CRISPR | GAAGGAGAGCACAGTGATTG TGG (reversed) | Intronic | ||