ID: 959868577

View in Genome Browser
Species Human (GRCh38)
Location 3:111300353-111300375
Sequence GAAGGAGAGCACAGTGATTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 916
Summary {0: 4, 1: 37, 2: 96, 3: 184, 4: 595}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959868577_959868585 30 Left 959868577 3:111300353-111300375 CCACAATCACTGTGCTCTCCTTC 0: 4
1: 37
2: 96
3: 184
4: 595
Right 959868585 3:111300406-111300428 ACATGGCTGCTACCAAGGGATGG 0: 1
1: 1
2: 6
3: 37
4: 301
959868577_959868584 26 Left 959868577 3:111300353-111300375 CCACAATCACTGTGCTCTCCTTC 0: 4
1: 37
2: 96
3: 184
4: 595
Right 959868584 3:111300402-111300424 CATCACATGGCTGCTACCAAGGG 0: 1
1: 0
2: 0
3: 10
4: 140
959868577_959868583 25 Left 959868577 3:111300353-111300375 CCACAATCACTGTGCTCTCCTTC 0: 4
1: 37
2: 96
3: 184
4: 595
Right 959868583 3:111300401-111300423 GCATCACATGGCTGCTACCAAGG 0: 1
1: 0
2: 5
3: 45
4: 354
959868577_959868582 13 Left 959868577 3:111300353-111300375 CCACAATCACTGTGCTCTCCTTC 0: 4
1: 37
2: 96
3: 184
4: 595
Right 959868582 3:111300389-111300411 AATTCTATCTAAGCATCACATGG 0: 1
1: 0
2: 0
3: 6
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959868577 Original CRISPR GAAGGAGAGCACAGTGATTG TGG (reversed) Intronic