ID: 959868579

View in Genome Browser
Species Human (GRCh38)
Location 3:111300375-111300397
Sequence GATAGAATTTGTGCACTTAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 312
Summary {0: 1, 1: 1, 2: 10, 3: 62, 4: 238}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959868579_959868583 3 Left 959868579 3:111300375-111300397 CCCCTAAGTGCACAAATTCTATC 0: 1
1: 1
2: 10
3: 62
4: 238
Right 959868583 3:111300401-111300423 GCATCACATGGCTGCTACCAAGG 0: 1
1: 0
2: 5
3: 45
4: 354
959868579_959868584 4 Left 959868579 3:111300375-111300397 CCCCTAAGTGCACAAATTCTATC 0: 1
1: 1
2: 10
3: 62
4: 238
Right 959868584 3:111300402-111300424 CATCACATGGCTGCTACCAAGGG 0: 1
1: 0
2: 0
3: 10
4: 140
959868579_959868589 15 Left 959868579 3:111300375-111300397 CCCCTAAGTGCACAAATTCTATC 0: 1
1: 1
2: 10
3: 62
4: 238
Right 959868589 3:111300413-111300435 TGCTACCAAGGGATGGGGGAAGG 0: 1
1: 0
2: 17
3: 86
4: 528
959868579_959868593 25 Left 959868579 3:111300375-111300397 CCCCTAAGTGCACAAATTCTATC 0: 1
1: 1
2: 10
3: 62
4: 238
Right 959868593 3:111300423-111300445 GGATGGGGGAAGGGTGGTGAAGG 0: 1
1: 1
2: 27
3: 253
4: 1785
959868579_959868586 9 Left 959868579 3:111300375-111300397 CCCCTAAGTGCACAAATTCTATC 0: 1
1: 1
2: 10
3: 62
4: 238
Right 959868586 3:111300407-111300429 CATGGCTGCTACCAAGGGATGGG 0: 1
1: 1
2: 6
3: 32
4: 298
959868579_959868590 16 Left 959868579 3:111300375-111300397 CCCCTAAGTGCACAAATTCTATC 0: 1
1: 1
2: 10
3: 62
4: 238
Right 959868590 3:111300414-111300436 GCTACCAAGGGATGGGGGAAGGG 0: 1
1: 1
2: 11
3: 124
4: 719
959868579_959868591 19 Left 959868579 3:111300375-111300397 CCCCTAAGTGCACAAATTCTATC 0: 1
1: 1
2: 10
3: 62
4: 238
Right 959868591 3:111300417-111300439 ACCAAGGGATGGGGGAAGGGTGG 0: 1
1: 1
2: 16
3: 168
4: 1629
959868579_959868582 -9 Left 959868579 3:111300375-111300397 CCCCTAAGTGCACAAATTCTATC 0: 1
1: 1
2: 10
3: 62
4: 238
Right 959868582 3:111300389-111300411 AATTCTATCTAAGCATCACATGG 0: 1
1: 0
2: 0
3: 6
4: 141
959868579_959868585 8 Left 959868579 3:111300375-111300397 CCCCTAAGTGCACAAATTCTATC 0: 1
1: 1
2: 10
3: 62
4: 238
Right 959868585 3:111300406-111300428 ACATGGCTGCTACCAAGGGATGG 0: 1
1: 1
2: 6
3: 37
4: 301
959868579_959868587 10 Left 959868579 3:111300375-111300397 CCCCTAAGTGCACAAATTCTATC 0: 1
1: 1
2: 10
3: 62
4: 238
Right 959868587 3:111300408-111300430 ATGGCTGCTACCAAGGGATGGGG 0: 1
1: 0
2: 8
3: 51
4: 352
959868579_959868588 11 Left 959868579 3:111300375-111300397 CCCCTAAGTGCACAAATTCTATC 0: 1
1: 1
2: 10
3: 62
4: 238
Right 959868588 3:111300409-111300431 TGGCTGCTACCAAGGGATGGGGG 0: 1
1: 0
2: 8
3: 40
4: 264

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959868579 Original CRISPR GATAGAATTTGTGCACTTAG GGG (reversed) Intronic