ID: 959868580

View in Genome Browser
Species Human (GRCh38)
Location 3:111300376-111300398
Sequence AGATAGAATTTGTGCACTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 485
Summary {0: 1, 1: 0, 2: 11, 3: 82, 4: 391}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959868580_959868591 18 Left 959868580 3:111300376-111300398 CCCTAAGTGCACAAATTCTATCT 0: 1
1: 0
2: 11
3: 82
4: 391
Right 959868591 3:111300417-111300439 ACCAAGGGATGGGGGAAGGGTGG 0: 1
1: 1
2: 16
3: 168
4: 1629
959868580_959868582 -10 Left 959868580 3:111300376-111300398 CCCTAAGTGCACAAATTCTATCT 0: 1
1: 0
2: 11
3: 82
4: 391
Right 959868582 3:111300389-111300411 AATTCTATCTAAGCATCACATGG 0: 1
1: 0
2: 0
3: 6
4: 141
959868580_959868584 3 Left 959868580 3:111300376-111300398 CCCTAAGTGCACAAATTCTATCT 0: 1
1: 0
2: 11
3: 82
4: 391
Right 959868584 3:111300402-111300424 CATCACATGGCTGCTACCAAGGG 0: 1
1: 0
2: 0
3: 10
4: 140
959868580_959868583 2 Left 959868580 3:111300376-111300398 CCCTAAGTGCACAAATTCTATCT 0: 1
1: 0
2: 11
3: 82
4: 391
Right 959868583 3:111300401-111300423 GCATCACATGGCTGCTACCAAGG 0: 1
1: 0
2: 5
3: 45
4: 354
959868580_959868587 9 Left 959868580 3:111300376-111300398 CCCTAAGTGCACAAATTCTATCT 0: 1
1: 0
2: 11
3: 82
4: 391
Right 959868587 3:111300408-111300430 ATGGCTGCTACCAAGGGATGGGG 0: 1
1: 0
2: 8
3: 51
4: 352
959868580_959868586 8 Left 959868580 3:111300376-111300398 CCCTAAGTGCACAAATTCTATCT 0: 1
1: 0
2: 11
3: 82
4: 391
Right 959868586 3:111300407-111300429 CATGGCTGCTACCAAGGGATGGG 0: 1
1: 1
2: 6
3: 32
4: 298
959868580_959868593 24 Left 959868580 3:111300376-111300398 CCCTAAGTGCACAAATTCTATCT 0: 1
1: 0
2: 11
3: 82
4: 391
Right 959868593 3:111300423-111300445 GGATGGGGGAAGGGTGGTGAAGG 0: 1
1: 1
2: 27
3: 253
4: 1785
959868580_959868589 14 Left 959868580 3:111300376-111300398 CCCTAAGTGCACAAATTCTATCT 0: 1
1: 0
2: 11
3: 82
4: 391
Right 959868589 3:111300413-111300435 TGCTACCAAGGGATGGGGGAAGG 0: 1
1: 0
2: 17
3: 86
4: 528
959868580_959868588 10 Left 959868580 3:111300376-111300398 CCCTAAGTGCACAAATTCTATCT 0: 1
1: 0
2: 11
3: 82
4: 391
Right 959868588 3:111300409-111300431 TGGCTGCTACCAAGGGATGGGGG 0: 1
1: 0
2: 8
3: 40
4: 264
959868580_959868585 7 Left 959868580 3:111300376-111300398 CCCTAAGTGCACAAATTCTATCT 0: 1
1: 0
2: 11
3: 82
4: 391
Right 959868585 3:111300406-111300428 ACATGGCTGCTACCAAGGGATGG 0: 1
1: 1
2: 6
3: 37
4: 301
959868580_959868590 15 Left 959868580 3:111300376-111300398 CCCTAAGTGCACAAATTCTATCT 0: 1
1: 0
2: 11
3: 82
4: 391
Right 959868590 3:111300414-111300436 GCTACCAAGGGATGGGGGAAGGG 0: 1
1: 1
2: 11
3: 124
4: 719

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959868580 Original CRISPR AGATAGAATTTGTGCACTTA GGG (reversed) Intronic