ID: 959868581

View in Genome Browser
Species Human (GRCh38)
Location 3:111300377-111300399
Sequence TAGATAGAATTTGTGCACTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 440
Summary {0: 1, 1: 1, 2: 5, 3: 90, 4: 343}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959868581_959868590 14 Left 959868581 3:111300377-111300399 CCTAAGTGCACAAATTCTATCTA 0: 1
1: 1
2: 5
3: 90
4: 343
Right 959868590 3:111300414-111300436 GCTACCAAGGGATGGGGGAAGGG 0: 1
1: 1
2: 11
3: 124
4: 719
959868581_959868587 8 Left 959868581 3:111300377-111300399 CCTAAGTGCACAAATTCTATCTA 0: 1
1: 1
2: 5
3: 90
4: 343
Right 959868587 3:111300408-111300430 ATGGCTGCTACCAAGGGATGGGG 0: 1
1: 0
2: 8
3: 51
4: 352
959868581_959868584 2 Left 959868581 3:111300377-111300399 CCTAAGTGCACAAATTCTATCTA 0: 1
1: 1
2: 5
3: 90
4: 343
Right 959868584 3:111300402-111300424 CATCACATGGCTGCTACCAAGGG 0: 1
1: 0
2: 0
3: 10
4: 140
959868581_959868583 1 Left 959868581 3:111300377-111300399 CCTAAGTGCACAAATTCTATCTA 0: 1
1: 1
2: 5
3: 90
4: 343
Right 959868583 3:111300401-111300423 GCATCACATGGCTGCTACCAAGG 0: 1
1: 0
2: 5
3: 45
4: 354
959868581_959868589 13 Left 959868581 3:111300377-111300399 CCTAAGTGCACAAATTCTATCTA 0: 1
1: 1
2: 5
3: 90
4: 343
Right 959868589 3:111300413-111300435 TGCTACCAAGGGATGGGGGAAGG 0: 1
1: 0
2: 17
3: 86
4: 528
959868581_959868586 7 Left 959868581 3:111300377-111300399 CCTAAGTGCACAAATTCTATCTA 0: 1
1: 1
2: 5
3: 90
4: 343
Right 959868586 3:111300407-111300429 CATGGCTGCTACCAAGGGATGGG 0: 1
1: 1
2: 6
3: 32
4: 298
959868581_959868591 17 Left 959868581 3:111300377-111300399 CCTAAGTGCACAAATTCTATCTA 0: 1
1: 1
2: 5
3: 90
4: 343
Right 959868591 3:111300417-111300439 ACCAAGGGATGGGGGAAGGGTGG 0: 1
1: 1
2: 16
3: 168
4: 1629
959868581_959868588 9 Left 959868581 3:111300377-111300399 CCTAAGTGCACAAATTCTATCTA 0: 1
1: 1
2: 5
3: 90
4: 343
Right 959868588 3:111300409-111300431 TGGCTGCTACCAAGGGATGGGGG 0: 1
1: 0
2: 8
3: 40
4: 264
959868581_959868593 23 Left 959868581 3:111300377-111300399 CCTAAGTGCACAAATTCTATCTA 0: 1
1: 1
2: 5
3: 90
4: 343
Right 959868593 3:111300423-111300445 GGATGGGGGAAGGGTGGTGAAGG 0: 1
1: 1
2: 27
3: 253
4: 1785
959868581_959868585 6 Left 959868581 3:111300377-111300399 CCTAAGTGCACAAATTCTATCTA 0: 1
1: 1
2: 5
3: 90
4: 343
Right 959868585 3:111300406-111300428 ACATGGCTGCTACCAAGGGATGG 0: 1
1: 1
2: 6
3: 37
4: 301

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959868581 Original CRISPR TAGATAGAATTTGTGCACTT AGG (reversed) Intronic