ID: 959868582 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 3:111300389-111300411 |
Sequence | AATTCTATCTAAGCATCACA TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 148 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 6, 4: 141} |
Found 5 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
959868580_959868582 | -10 | Left | 959868580 | 3:111300376-111300398 | CCCTAAGTGCACAAATTCTATCT | 0: 1 1: 0 2: 11 3: 82 4: 391 |
||
Right | 959868582 | 3:111300389-111300411 | AATTCTATCTAAGCATCACATGG | 0: 1 1: 0 2: 0 3: 6 4: 141 |
||||
959868576_959868582 | 14 | Left | 959868576 | 3:111300352-111300374 | CCCACAATCACTGTGCTCTCCTT | 0: 4 1: 34 2: 84 3: 158 4: 457 |
||
Right | 959868582 | 3:111300389-111300411 | AATTCTATCTAAGCATCACATGG | 0: 1 1: 0 2: 0 3: 6 4: 141 |
||||
959868577_959868582 | 13 | Left | 959868577 | 3:111300353-111300375 | CCACAATCACTGTGCTCTCCTTC | 0: 4 1: 37 2: 96 3: 184 4: 595 |
||
Right | 959868582 | 3:111300389-111300411 | AATTCTATCTAAGCATCACATGG | 0: 1 1: 0 2: 0 3: 6 4: 141 |
||||
959868579_959868582 | -9 | Left | 959868579 | 3:111300375-111300397 | CCCCTAAGTGCACAAATTCTATC | 0: 1 1: 1 2: 10 3: 62 4: 238 |
||
Right | 959868582 | 3:111300389-111300411 | AATTCTATCTAAGCATCACATGG | 0: 1 1: 0 2: 0 3: 6 4: 141 |
||||
959868578_959868582 | -5 | Left | 959868578 | 3:111300371-111300393 | CCTTCCCCTAAGTGCACAAATTC | 0: 1 1: 2 2: 41 3: 134 4: 364 |
||
Right | 959868582 | 3:111300389-111300411 | AATTCTATCTAAGCATCACATGG | 0: 1 1: 0 2: 0 3: 6 4: 141 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
959868582 | Original CRISPR | AATTCTATCTAAGCATCACA TGG | Intronic | ||