ID: 959868586

View in Genome Browser
Species Human (GRCh38)
Location 3:111300407-111300429
Sequence CATGGCTGCTACCAAGGGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 338
Summary {0: 1, 1: 1, 2: 6, 3: 32, 4: 298}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959868580_959868586 8 Left 959868580 3:111300376-111300398 CCCTAAGTGCACAAATTCTATCT 0: 1
1: 0
2: 11
3: 82
4: 391
Right 959868586 3:111300407-111300429 CATGGCTGCTACCAAGGGATGGG 0: 1
1: 1
2: 6
3: 32
4: 298
959868579_959868586 9 Left 959868579 3:111300375-111300397 CCCCTAAGTGCACAAATTCTATC 0: 1
1: 1
2: 10
3: 62
4: 238
Right 959868586 3:111300407-111300429 CATGGCTGCTACCAAGGGATGGG 0: 1
1: 1
2: 6
3: 32
4: 298
959868578_959868586 13 Left 959868578 3:111300371-111300393 CCTTCCCCTAAGTGCACAAATTC 0: 1
1: 2
2: 41
3: 134
4: 364
Right 959868586 3:111300407-111300429 CATGGCTGCTACCAAGGGATGGG 0: 1
1: 1
2: 6
3: 32
4: 298
959868581_959868586 7 Left 959868581 3:111300377-111300399 CCTAAGTGCACAAATTCTATCTA 0: 1
1: 1
2: 5
3: 90
4: 343
Right 959868586 3:111300407-111300429 CATGGCTGCTACCAAGGGATGGG 0: 1
1: 1
2: 6
3: 32
4: 298

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959868586 Original CRISPR CATGGCTGCTACCAAGGGAT GGG Intronic