ID: 959868587

View in Genome Browser
Species Human (GRCh38)
Location 3:111300408-111300430
Sequence ATGGCTGCTACCAAGGGATG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 412
Summary {0: 1, 1: 0, 2: 8, 3: 51, 4: 352}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959868580_959868587 9 Left 959868580 3:111300376-111300398 CCCTAAGTGCACAAATTCTATCT 0: 1
1: 0
2: 11
3: 82
4: 391
Right 959868587 3:111300408-111300430 ATGGCTGCTACCAAGGGATGGGG 0: 1
1: 0
2: 8
3: 51
4: 352
959868578_959868587 14 Left 959868578 3:111300371-111300393 CCTTCCCCTAAGTGCACAAATTC 0: 1
1: 2
2: 41
3: 134
4: 364
Right 959868587 3:111300408-111300430 ATGGCTGCTACCAAGGGATGGGG 0: 1
1: 0
2: 8
3: 51
4: 352
959868579_959868587 10 Left 959868579 3:111300375-111300397 CCCCTAAGTGCACAAATTCTATC 0: 1
1: 1
2: 10
3: 62
4: 238
Right 959868587 3:111300408-111300430 ATGGCTGCTACCAAGGGATGGGG 0: 1
1: 0
2: 8
3: 51
4: 352
959868581_959868587 8 Left 959868581 3:111300377-111300399 CCTAAGTGCACAAATTCTATCTA 0: 1
1: 1
2: 5
3: 90
4: 343
Right 959868587 3:111300408-111300430 ATGGCTGCTACCAAGGGATGGGG 0: 1
1: 0
2: 8
3: 51
4: 352

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959868587 Original CRISPR ATGGCTGCTACCAAGGGATG GGG Intronic