ID: 959868588 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 3:111300409-111300431 |
Sequence | TGGCTGCTACCAAGGGATGG GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 313 | |||
Summary | {0: 1, 1: 0, 2: 8, 3: 40, 4: 264} |
Found 4 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
959868581_959868588 | 9 | Left | 959868581 | 3:111300377-111300399 | CCTAAGTGCACAAATTCTATCTA | 0: 1 1: 1 2: 5 3: 90 4: 343 |
||
Right | 959868588 | 3:111300409-111300431 | TGGCTGCTACCAAGGGATGGGGG | 0: 1 1: 0 2: 8 3: 40 4: 264 |
||||
959868578_959868588 | 15 | Left | 959868578 | 3:111300371-111300393 | CCTTCCCCTAAGTGCACAAATTC | 0: 1 1: 2 2: 41 3: 134 4: 364 |
||
Right | 959868588 | 3:111300409-111300431 | TGGCTGCTACCAAGGGATGGGGG | 0: 1 1: 0 2: 8 3: 40 4: 264 |
||||
959868579_959868588 | 11 | Left | 959868579 | 3:111300375-111300397 | CCCCTAAGTGCACAAATTCTATC | 0: 1 1: 1 2: 10 3: 62 4: 238 |
||
Right | 959868588 | 3:111300409-111300431 | TGGCTGCTACCAAGGGATGGGGG | 0: 1 1: 0 2: 8 3: 40 4: 264 |
||||
959868580_959868588 | 10 | Left | 959868580 | 3:111300376-111300398 | CCCTAAGTGCACAAATTCTATCT | 0: 1 1: 0 2: 11 3: 82 4: 391 |
||
Right | 959868588 | 3:111300409-111300431 | TGGCTGCTACCAAGGGATGGGGG | 0: 1 1: 0 2: 8 3: 40 4: 264 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
959868588 | Original CRISPR | TGGCTGCTACCAAGGGATGG GGG | Intronic | ||