ID: 959868589

View in Genome Browser
Species Human (GRCh38)
Location 3:111300413-111300435
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 632
Summary {0: 1, 1: 0, 2: 17, 3: 86, 4: 528}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959868580_959868589 14 Left 959868580 3:111300376-111300398 CCCTAAGTGCACAAATTCTATCT 0: 1
1: 0
2: 11
3: 82
4: 391
Right 959868589 3:111300413-111300435 TGCTACCAAGGGATGGGGGAAGG 0: 1
1: 0
2: 17
3: 86
4: 528
959868578_959868589 19 Left 959868578 3:111300371-111300393 CCTTCCCCTAAGTGCACAAATTC 0: 1
1: 2
2: 41
3: 134
4: 364
Right 959868589 3:111300413-111300435 TGCTACCAAGGGATGGGGGAAGG 0: 1
1: 0
2: 17
3: 86
4: 528
959868581_959868589 13 Left 959868581 3:111300377-111300399 CCTAAGTGCACAAATTCTATCTA 0: 1
1: 1
2: 5
3: 90
4: 343
Right 959868589 3:111300413-111300435 TGCTACCAAGGGATGGGGGAAGG 0: 1
1: 0
2: 17
3: 86
4: 528
959868579_959868589 15 Left 959868579 3:111300375-111300397 CCCCTAAGTGCACAAATTCTATC 0: 1
1: 1
2: 10
3: 62
4: 238
Right 959868589 3:111300413-111300435 TGCTACCAAGGGATGGGGGAAGG 0: 1
1: 0
2: 17
3: 86
4: 528

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type