ID: 959873467

View in Genome Browser
Species Human (GRCh38)
Location 3:111354641-111354663
Sequence CCCGGCTGATACCTTGATTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2327
Summary {0: 1, 1: 12, 2: 157, 3: 634, 4: 1523}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959873458_959873467 29 Left 959873458 3:111354589-111354611 CCACCAGAAGCTAGAAAGAGGCA 0: 9
1: 80
2: 223
3: 1006
4: 1301
Right 959873467 3:111354641-111354663 CCCGGCTGATACCTTGATTTTGG 0: 1
1: 12
2: 157
3: 634
4: 1523
959873459_959873467 26 Left 959873459 3:111354592-111354614 CCAGAAGCTAGAAAGAGGCAAAG 0: 1
1: 25
2: 117
3: 299
4: 685
Right 959873467 3:111354641-111354663 CCCGGCTGATACCTTGATTTTGG 0: 1
1: 12
2: 157
3: 634
4: 1523

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959873467 Original CRISPR CCCGGCTGATACCTTGATTT TGG Intronic
Too many off-targets to display for this crispr