ID: 959874189

View in Genome Browser
Species Human (GRCh38)
Location 3:111362474-111362496
Sequence TAATTTGACCAGAATGGGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 149}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959874189 Original CRISPR TAATTTGACCAGAATGGGGT TGG (reversed) Intronic
904874906 1:33646859-33646881 TTATTTGACCTTAGTGGGGTGGG - Intronic
906555373 1:46707377-46707399 TAAATTGACCAGAGTTGAGTAGG - Intronic
907048346 1:51313580-51313602 GAATGTGACCAGATGGGGGTGGG - Intronic
907720750 1:56969827-56969849 TATATTGGTCAGAATGGGGTAGG - Intergenic
915553606 1:156648926-156648948 TAAACTGATCAGACTGGGGTAGG - Intronic
917168881 1:172146641-172146663 TACTTTGAAAAGAATGGAGTTGG - Intronic
922071774 1:222202091-222202113 TAATTTTACTATAATGGGCTCGG - Intergenic
923259405 1:232252945-232252967 TAAATTGCCCAGTCTGGGGTAGG + Intergenic
924627478 1:245707775-245707797 GAATTTGATGAGAATGGGCTTGG + Intronic
1062937699 10:1400522-1400544 TAATTTTACCAGGCTGGAGTGGG - Intronic
1064404241 10:15046958-15046980 TAATTGGATATGAATGGGGTGGG + Intronic
1066605177 10:37159313-37159335 TAATTTGACCAGGCTGGTCTGGG - Intronic
1066607448 10:37193991-37194013 TAATTTGACCAGGCTGGTCTGGG - Intronic
1067915833 10:50397095-50397117 TCATTTGAAGAGAATGGGTTGGG - Intronic
1068089809 10:52419610-52419632 AAATTTGACCAGAATAGTCTTGG + Intergenic
1070358448 10:75663381-75663403 TAATTTAACCAGTCTGAGGTGGG + Intronic
1070653342 10:78253838-78253860 CAATTTGACAAGGCTGGGGTGGG - Intergenic
1071449094 10:85777458-85777480 TGATTTAAGTAGAATGGGGTAGG + Intronic
1079683999 11:23332813-23332835 TCATTTGGCCAGAATCGGCTTGG - Intergenic
1081187810 11:40066375-40066397 TAATTTGATCAAAATGAGGCAGG + Intergenic
1081321724 11:41699879-41699901 TAATTTGGCAAGAAGGGGCTAGG + Intergenic
1083767143 11:64847088-64847110 TAAATCAACCAGAATGGGATGGG + Intergenic
1084989930 11:72913196-72913218 TAATTTGATGAGATTTGGGTGGG + Intronic
1085231501 11:74975153-74975175 TAATGTGAACAGAATGAAGTGGG - Intronic
1085922935 11:80980680-80980702 TACTTGGAGTAGAATGGGGTTGG - Intergenic
1087218823 11:95523813-95523835 TATTTGGGCTAGAATGGGGTAGG + Intergenic
1088147993 11:106706904-106706926 TAATATGCCCAGAATTGTGTTGG + Intronic
1088460293 11:110075480-110075502 TAATTTGGCGAGTATGGGCTCGG + Intergenic
1089161338 11:116439858-116439880 TAAATTGCCCAGACTTGGGTAGG - Intergenic
1092897718 12:13029310-13029332 TAAATTCACCAGCATGTGGTTGG + Intergenic
1093529916 12:20148439-20148461 TTATTTGACCACATGGGGGTTGG - Intergenic
1093828444 12:23724973-23724995 GAATTAGACCAGAATGGTGTTGG + Intronic
1095559184 12:43545276-43545298 GAATTTGAACAGTATGTGGTAGG - Intronic
1100737124 12:97548191-97548213 TAAATTGACCATAAATGGGTGGG + Intergenic
1106233336 13:27839853-27839875 AAATTTGACCAAAATGGTCTAGG - Intergenic
1108408870 13:50128220-50128242 TAAGCTGACCAGATTGGGGTTGG - Intronic
1108587102 13:51879791-51879813 TAATTTCAACAGAATGTGGCAGG + Intergenic
1111375874 13:87378861-87378883 CACATTGATCAGAATGGGGTAGG + Intergenic
1112153143 13:96786276-96786298 GAACTGGAGCAGAATGGGGTAGG - Intronic
1112496043 13:99905541-99905563 TAATTGGAACAGAATGGAGGTGG - Intergenic
1112737499 13:102437761-102437783 TAATTATAGCAGAATGGGCTGGG + Intergenic
1113366944 13:109685061-109685083 TAATTGGAGCAGGAAGGGGTGGG + Intergenic
1114458853 14:22874237-22874259 GAATTTACCCAGAAAGGGGTAGG + Intronic
1114679748 14:24474505-24474527 TAATGTGTCCAGAATTTGGTGGG - Intergenic
1115021789 14:28689968-28689990 TAATTTTACCATTATGGGGAAGG - Intergenic
1115392520 14:32869144-32869166 TAATTTGACAAGAATTTGGGGGG + Intergenic
1116270708 14:42761762-42761784 TAATATGTTCAGAATGGGCTAGG - Intergenic
1116283443 14:42940455-42940477 TAACTTGTCAAGAATGGGCTAGG - Intergenic
1122289556 14:100672912-100672934 GAATTTCATCAGAATGGGGCTGG - Intergenic
1123966882 15:25468203-25468225 TCATTGGATCAGATTGGGGTGGG + Intergenic
1125202411 15:37111493-37111515 TAATTTCCCCAGACTGGGGCAGG - Intergenic
1128047974 15:64635996-64636018 TAATTTCACCAGGATAGGGTGGG + Intronic
1133341400 16:5038736-5038758 CAATTTAACCAGATTGGGGGTGG + Intronic
1133591101 16:7244582-7244604 TAATTAGGACACAATGGGGTTGG + Intronic
1133694051 16:8243931-8243953 TAATTTGCCCAGCATGGTGGTGG - Intergenic
1135584155 16:23655329-23655351 TAGTTTGACTAGGGTGGGGTAGG + Intronic
1143187652 17:5020303-5020325 TTGGTTGACAAGAATGGGGTTGG + Intronic
1144535161 17:16081660-16081682 TTATTTGACCTGACTGGAGTGGG + Intronic
1151472067 17:74324924-74324946 TACTGTGACAAGAATCGGGTCGG - Intergenic
1153704949 18:7735955-7735977 TATTTTGGCCAGGGTGGGGTGGG - Intronic
1155848439 18:30738742-30738764 CAATTTGACCTTAATGTGGTTGG + Intergenic
1159331076 18:66994573-66994595 TAATTTGACCAGAAGGTGCTGGG - Intergenic
1159702712 18:71649822-71649844 CAATTTGACGAGATTTGGGTGGG - Intergenic
1160119172 18:76112066-76112088 TAATTTGACTAAACTGTGGTGGG - Intergenic
1160729621 19:635208-635230 CAATTTGAGCAGAGTGGGGCTGG + Intergenic
1163754746 19:19100022-19100044 TAATATGACCAGAGTGGGGCTGG - Intronic
1164023222 19:21327585-21327607 TAAGGTGAGCAGAATGGGGTGGG - Intronic
1165494073 19:36141690-36141712 TAAATGGCCCAGAATGGGCTGGG + Intronic
1166434117 19:42752650-42752672 TAATTTCAAAAGAATGGGGTGGG - Intronic
1166437263 19:42777979-42778001 TAATTTTAAAAGAATGGGGTGGG - Intronic
1166446972 19:42866425-42866447 TAATTTTAAAAGAATGGGGTGGG - Intronic
1166453904 19:42924093-42924115 CAATTTTAAAAGAATGGGGTGGG - Intronic
1166456375 19:42943375-42943397 TAATTTTAATAGAATGGGGTGGG - Intronic
1166466167 19:43032646-43032668 TAATTTTAAAAGAATGGGGTGGG - Intronic
1166472309 19:43088714-43088736 TAATTTTAAAAGAATGGGGTGGG - Intronic
1166483444 19:43192663-43192685 TAATTTTAAAAGAATGGGGTGGG - Intronic
1166485913 19:43211750-43211772 TAATTTTAAAAGAATGGGGTGGG - Intergenic
926250299 2:11151956-11151978 TAATTTGGCCAGTAGGGGCTTGG + Intergenic
929876009 2:45797195-45797217 TGATGTCACCAGAATGGGTTTGG - Intronic
930404319 2:50935532-50935554 CAATTTCACCAGACTGGTGTTGG - Intronic
934569673 2:95361298-95361320 TGACTTGACCAGGATGGGGCAGG - Intronic
936672973 2:114681064-114681086 TAGTTGGAGCAGAATTGGGTAGG - Intronic
939025534 2:137009447-137009469 TAATATGACATGAATGGGGGAGG - Intronic
941203787 2:162546755-162546777 AAATTTAACAAGAATGGGTTAGG + Intronic
942363144 2:175194081-175194103 TAATTTGAAGAGTATTGGGTAGG - Intergenic
944426945 2:199593729-199593751 AAATCTGACCACAATGGTGTTGG - Intergenic
945170742 2:206992146-206992168 TAATTGGCCCAGATTGGGGCAGG + Intergenic
946854814 2:223941989-223942011 TGACTGGACCAGGATGGGGTTGG - Intronic
946883705 2:224201918-224201940 TAATTAGACCAGATAGGGATTGG - Intergenic
947309162 2:228781409-228781431 TAATTTGGTCAGAATTGTGTGGG - Intergenic
948226266 2:236311466-236311488 AAATGTGACCAGAATGAGATAGG - Intergenic
1169504854 20:6198490-6198512 TAATTTGACCATAAATGTGTAGG + Intergenic
1170000274 20:11607319-11607341 ACATTGGCCCAGAATGGGGTGGG + Intergenic
1172855662 20:38000317-38000339 TAATCTCACCAGAAAGGGTTAGG + Intronic
1177953850 21:27572017-27572039 TAATTTTCTCAGACTGGGGTAGG - Intergenic
1178846413 21:36177546-36177568 CAATTTGACAATATTGGGGTTGG + Intronic
1179372061 21:40815459-40815481 TAATTTGTCCAGCAGAGGGTTGG - Intronic
1181444460 22:22958192-22958214 TCATATGACCAGAGTGAGGTTGG + Intergenic
1183364582 22:37400233-37400255 TGATTGGACCGGAGTGGGGTGGG - Intronic
949207247 3:1454931-1454953 TAATTTGACCAGAATTTAGAAGG + Intergenic
949556212 3:5155672-5155694 TGATTTGACCAGGCGGGGGTGGG - Intronic
953453226 3:43021199-43021221 GATTCTGACAAGAATGGGGTTGG - Intronic
954089456 3:48272894-48272916 AAAGCTGACGAGAATGGGGTAGG - Intronic
954621000 3:51995526-51995548 CATTCTGACCAGAATGGGGGGGG - Intronic
955572026 3:60318086-60318108 TAAGATGCCCAGAATGGGGCGGG - Intronic
955988276 3:64598107-64598129 TAATTTGACCAGCATGGGCAGGG - Intronic
957613131 3:82494666-82494688 TAAATTGAACTGAATCGGGTGGG + Intergenic
959862995 3:111236532-111236554 TAATTTGATGAGATTTGGGTAGG - Intronic
959874189 3:111362474-111362496 TAATTTGACCAGAATGGGGTTGG - Intronic
961010752 3:123434219-123434241 CAATGTAACCTGAATGGGGTCGG + Intronic
961782747 3:129330520-129330542 TAATGTGACCTCAATGGAGTAGG - Intergenic
962034085 3:131632448-131632470 TAATTTCAACAGAGTGGTGTTGG - Intronic
963835119 3:150050375-150050397 TCATTTGACCAGAATAGTTTGGG + Intronic
964922392 3:161913105-161913127 TAAGTTGAAAAAAATGGGGTCGG - Intergenic
965559031 3:170044498-170044520 CAGTTTGACAAGAATGGAGTAGG + Intronic
968811127 4:2800118-2800140 TGACGTGACCAGGATGGGGTCGG + Intronic
970549882 4:17168722-17168744 TAAACTGACCAGGATGGGGGAGG - Intergenic
972483295 4:39518548-39518570 TATATTGACCAGGATGGAGTCGG + Intronic
972987159 4:44778502-44778524 TAAATTGAATAGAATAGGGTGGG + Intergenic
975474529 4:74808075-74808097 AAACTTAACCAGACTGGGGTGGG + Intergenic
976409737 4:84699730-84699752 TAGGATGACCATAATGGGGTGGG - Intronic
979346191 4:119590331-119590353 TAGTTTGAGGAGTATGGGGTAGG - Intronic
984588089 4:181586131-181586153 AACTTTGGCCAGAGTGGGGTAGG - Intergenic
986925229 5:12739809-12739831 TAATTTCACAAAAATGGTGTGGG + Intergenic
987062922 5:14259365-14259387 TAATTTGAGGGGAAAGGGGTAGG + Intronic
987701849 5:21409950-21409972 TAATTTTACAAGAAGGGTGTAGG - Intergenic
988598013 5:32612894-32612916 TAATTTGGCCCGGATGTGGTTGG + Intergenic
991503847 5:67304112-67304134 TAATTTGAACATAATGTAGTTGG + Intergenic
1005104044 6:22203999-22204021 TAGTTTAACCAGAATGGGCTTGG - Intergenic
1007194130 6:40045617-40045639 TAACTTGACCATAATGTGATAGG - Intergenic
1009637973 6:66290927-66290949 TAATTTGAACAGATTGGATTGGG + Intergenic
1010479039 6:76326859-76326881 TAATTTAACCATAACGGTGTAGG + Intergenic
1013703006 6:112796560-112796582 GAATTTGACCAGTAGAGGGTAGG - Intergenic
1015821852 6:137269790-137269812 TGATTTGCCCAAAATGAGGTGGG + Intergenic
1016416448 6:143839403-143839425 TAAGTTGACCCAAAAGGGGTAGG - Intronic
1017278151 6:152594036-152594058 AAAATTGAGCAGAATGGGATGGG - Intronic
1022327631 7:29346351-29346373 TAATGGGCCCAGAATGGGTTGGG - Intronic
1027425647 7:78059208-78059230 CAATTCAACCAGAACGGGGTGGG - Intronic
1028332623 7:89614438-89614460 TAAATTGAGCAGACTGGAGTAGG + Intergenic
1028885095 7:95923250-95923272 TTATTTGACCAGGATAAGGTAGG + Intronic
1031806978 7:126318291-126318313 TAATTTGATGAGATTTGGGTAGG + Intergenic
1032693363 7:134311716-134311738 TAATTTGATTAGTCTGGGGTAGG + Intronic
1037279166 8:17216825-17216847 TGGTTTGACTAGAATGAGGTTGG + Intronic
1037384410 8:18322230-18322252 CAATTTCACCAGATTTGGGTGGG + Intergenic
1041422238 8:57680677-57680699 TAATTTAACCAGTATGGGCAAGG - Intergenic
1041447729 8:57971004-57971026 TAACATGACCAGAATGGCCTGGG + Intergenic
1041537909 8:58948346-58948368 TAATGATACCAGAATGGGGAAGG + Intronic
1041656107 8:60352173-60352195 TCATTTGAAAAGAATGGGGGTGG - Intergenic
1042113151 8:65403000-65403022 TAAATTGAACAGAATGGTTTGGG - Intergenic
1042466892 8:69138464-69138486 AAATTTGCCCAGAATTAGGTAGG - Intergenic
1042804547 8:72757311-72757333 TTAGCTGACCACAATGGGGTTGG + Intronic
1047616137 8:126564019-126564041 TAGTTTGCCTAGAATGTGGTGGG - Intergenic
1047639065 8:126798774-126798796 TGATTTGAGAGGAATGGGGTAGG + Intergenic
1050220278 9:3380221-3380243 TAATTTGCCCATAATGAGGCTGG - Intronic
1051538662 9:18189542-18189564 TAATTTTACCAAATTGGGGGTGG - Intergenic
1051576157 9:18618009-18618031 TGTTTTGTCCAGAATGGGGTGGG + Intronic
1062675732 9:137742600-137742622 TGCTTTGTTCAGAATGGGGTTGG + Intronic
1187094177 X:16129046-16129068 TATTTTTACTAGAATGGGGCTGG + Intronic
1187541908 X:20205015-20205037 TAATTTGACCATAAAAAGGTGGG - Intronic
1188800391 X:34522697-34522719 TAATTTGTCCAGAATAAGGAAGG + Intergenic
1190454205 X:50610185-50610207 TGAGCTGACCAGAATGGGGGAGG - Intronic
1190481742 X:50884256-50884278 TAAGTTGAGCAGAAAGGGCTTGG - Intergenic
1190810488 X:53878743-53878765 TAATCAGTCCAGGATGGGGTTGG - Intergenic
1191025315 X:55907920-55907942 TTTTTTGACTAGAATGGGGAAGG - Intergenic
1194799084 X:98249221-98249243 TAATTTAGGCAGAATGAGGTTGG - Intergenic
1201336680 Y:12888726-12888748 AAATTTGACAAGAATGGTGAAGG - Intergenic
1202143379 Y:21752334-21752356 GTATGTGTCCAGAATGGGGTTGG + Intergenic