ID: 959876847

View in Genome Browser
Species Human (GRCh38)
Location 3:111393162-111393184
Sequence GGACAGGTCAATGCACACTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 156}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959876847_959876851 4 Left 959876847 3:111393162-111393184 CCTCAGTGTGCATTGACCTGTCC 0: 1
1: 0
2: 1
3: 22
4: 156
Right 959876851 3:111393189-111393211 ATTTGCATGTAATTGAAAGTAGG 0: 26
1: 115
2: 189
3: 287
4: 465

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959876847 Original CRISPR GGACAGGTCAATGCACACTG AGG (reversed) Intronic
901459459 1:9383066-9383088 GGGCAGCTAAATGCACACTGAGG + Intergenic
901910385 1:12452653-12452675 GGCCAGTTCACTGCACTCTGAGG - Intronic
905396430 1:37669552-37669574 GGACAGGTCCATACAGGCTGTGG - Intergenic
909051988 1:70777197-70777219 GGGCAGGTTAATGCAAATTGAGG - Intergenic
920804895 1:209223703-209223725 GGTGAGGTCAATGCATACAGGGG - Intergenic
922968607 1:229715315-229715337 GGACAGGTTAATGCAAATTGAGG - Intergenic
1063966825 10:11352513-11352535 GGCCAGGTTAATGCAAACTGAGG + Intergenic
1070587508 10:77777753-77777775 GGACTGGTTACTGCAGACTGTGG - Intergenic
1074665302 10:115715546-115715568 GAACAGGTCAATGCCCTTTGGGG - Intronic
1076696624 10:132250297-132250319 GGACAGGTCACTGCAGAGAGAGG + Intronic
1076696673 10:132250582-132250604 GGACAGGTCACTGCAGAGAGGGG + Intronic
1076696690 10:132250639-132250661 GGACAGGTCACTGCAGAGAGGGG + Intronic
1080463195 11:32473562-32473584 GGGCAGGTCAATGCAAACTGAGG - Intergenic
1083089024 11:60180667-60180689 GAACAGAACAATGCACACTGAGG - Intronic
1085453839 11:76654893-76654915 GGACAGGGGAATGCAGACTGTGG - Intergenic
1085512705 11:77096355-77096377 GGAAAGGTCAATTTACACTGAGG - Intronic
1090998469 11:131888353-131888375 GGAGAGGGCATTTCACACTGCGG + Intronic
1091094975 11:132811748-132811770 GGAAAGGTCACTGCTCACTAAGG + Intronic
1091304569 11:134529446-134529468 GGACAGGGCTCTGCACAGTGGGG - Intergenic
1094475959 12:30840744-30840766 GGATGGGTCAATGCAAATTGAGG + Intergenic
1094573939 12:31666506-31666528 AGACAGGTCAATACTCACTTGGG - Intronic
1095083933 12:38039090-38039112 GGACACTTCAAAGCCCACTGAGG + Intergenic
1095307693 12:40657560-40657582 GGGCAGGACAAAGGACACTGGGG + Intergenic
1095694214 12:45125953-45125975 GGAGAGCTGAATGCAGACTGGGG + Intergenic
1097786090 12:63760953-63760975 GCACAGGACCTTGCACACTGTGG + Intergenic
1103879006 12:124151693-124151715 GGGCAGGTTAATGCAAATTGAGG + Intronic
1108072452 13:46642077-46642099 GGAAAGGACAATGCCCATTGTGG + Intronic
1112582487 13:100688435-100688457 GGGCAGATTAATGCACATTGGGG + Intergenic
1114850634 14:26378839-26378861 GAACAGGTCAGTGCAAATTGAGG + Intergenic
1115789791 14:36865988-36866010 GGATAGGCCAATGCATACTTTGG - Intronic
1116259350 14:42602982-42603004 GGGCAGGTTAATGCAAATTGAGG + Intergenic
1118009120 14:61591771-61591793 GGTCAGGTAAATGCTCTCTGAGG + Intronic
1118700033 14:68424064-68424086 GCACAGGTCCATCCCCACTGTGG - Intronic
1119627743 14:76195876-76195898 AGACAGGCAAATGTACACTGGGG + Exonic
1122017240 14:98806599-98806621 GGACAAGTTAATGAACTCTGAGG - Intergenic
1122797302 14:104212476-104212498 GCGCAGGTCCATGCACCCTGGGG + Intergenic
1123854901 15:24398888-24398910 GGGCAGGTCAATGCAAATTGAGG + Intergenic
1123870931 15:24571872-24571894 GGGCAGATCAATGCAAATTGAGG + Intergenic
1128070066 15:64789964-64789986 TGGCAGCTCAGTGCACACTGAGG - Intergenic
1129981172 15:79872616-79872638 GGGCAGGTCAATGCAAATTGAGG + Intronic
1131371613 15:91886484-91886506 GTCCAAGTCAATGCTCACTGGGG - Intronic
1131514828 15:93070388-93070410 GGAGAGGCCAAGGCACACAGGGG + Intronic
1132577310 16:670010-670032 GGGGAGGTCAAGGCCCACTGAGG - Intronic
1133139189 16:3731812-3731834 GGACAGGTCATTGGACACGTTGG + Exonic
1133475235 16:6114968-6114990 GGACAAGTTAATGCAAACTGAGG + Intronic
1138335938 16:56252847-56252869 GGACAGGCCAATGCACTCAAGGG - Intronic
1140215012 16:73000202-73000224 GGACAGGTCGAGGGACCCTGGGG - Intronic
1140692869 16:77501104-77501126 GGAGGGGACAACGCACACTGGGG - Intergenic
1142668744 17:1477632-1477654 GGACAGGTCAGAGCGCACAGAGG + Intronic
1145363675 17:22233659-22233681 GGACATTTCAAAGCACATTGAGG - Intergenic
1145364524 17:22246519-22246541 GGACATTTCAAAGCCCACTGTGG - Intergenic
1145730560 17:27180946-27180968 GGACATTTCAAAGCCCACTGAGG + Intergenic
1146087973 17:29847876-29847898 GGGCAGGTTAATGCAAATTGAGG - Intronic
1146438489 17:32873351-32873373 GGACAGGACATTCCAGACTGGGG + Intronic
1147251104 17:39152715-39152737 GGACAGGAGAAGGTACACTGTGG + Intronic
1148475616 17:47926858-47926880 GGACAGGTGTCTGCTCACTGTGG - Intronic
1151680644 17:75620982-75621004 GGACAGGGCACTGGACACTCAGG + Intergenic
1152688683 17:81707700-81707722 GGACAGGGCCCTGCACACCGGGG - Intergenic
1155983943 18:32209875-32209897 GGAAAGGTGAACACACACTGCGG - Intronic
1156720665 18:40065913-40065935 GCACAGATCAATGCTCAGTGTGG + Intergenic
1157312791 18:46564882-46564904 GGAGAGGTGATTTCACACTGGGG + Intronic
1157545862 18:48546020-48546042 GGACAGGGCTCTGCTCACTGTGG - Intronic
1158097132 18:53785957-53785979 GTACAGATAAAGGCACACTGTGG + Intergenic
1158538346 18:58328913-58328935 TGACAGTTCAATGCTCACGGAGG - Intronic
1159374860 18:67580160-67580182 GCACAGGTCATTACACAGTGAGG - Intergenic
1162353682 19:10167054-10167076 GGACAGCTGACTGCACACAGGGG + Intronic
1165724875 19:38105773-38105795 ACACTGGTCAATTCACACTGTGG - Intronic
1167799096 19:51728756-51728778 GGGAAGGGAAATGCACACTGCGG + Intergenic
1167892284 19:52550158-52550180 GGTCATGTCCATGAACACTGTGG + Intronic
1168114964 19:54217318-54217340 GGACAGGCAGATGGACACTGAGG - Exonic
1168177751 19:54636631-54636653 GGACAGGCAGATGGACACTGAGG + Exonic
1168592362 19:57647850-57647872 TGACGGGTCAGTGCACTCTGTGG + Intergenic
927209768 2:20631914-20631936 GGGCAGGTTACTGCAGACTGTGG - Intronic
929542665 2:42834269-42834291 GGACAGGTCTGTGCACAAAGGGG + Intergenic
932682360 2:73836789-73836811 GCAGAGGTGCATGCACACTGGGG + Intronic
933932277 2:87165567-87165589 GTACAGGTGAATGCACAAAGAGG - Intergenic
934087953 2:88525899-88525921 GGACAGGGCCTGGCACACTGTGG - Intronic
934781562 2:96972498-96972520 GCACAGGTAAATCCCCACTGAGG - Intronic
935831513 2:107005590-107005612 GGACATGTCAAAGCACACATGGG - Intergenic
936360836 2:111799868-111799890 GTACAGGTGAATGCACAAAGAGG + Intronic
938302054 2:130222927-130222949 AGACAGGTTAATCCTCACTGAGG + Intergenic
938454628 2:131451322-131451344 AGACAGGTTAATCCTCACTGAGG - Intergenic
944492135 2:200268452-200268474 GGAGAGGTCAGTACAGACTGAGG - Intergenic
1168909418 20:1435227-1435249 GGGCAAGCCAATGCAAACTGAGG - Intergenic
1171255408 20:23686195-23686217 GGACAGGACACTGCAGGCTGGGG - Intronic
1171262750 20:23748117-23748139 GGACAGGACACTGCAGGCTGGGG - Intronic
1171271888 20:23824321-23824343 GGACAGGACACTGCAGGCTGCGG - Intronic
1173308103 20:41871170-41871192 GAACAGGTCAATGCAAATTGAGG - Intergenic
1174306242 20:49616083-49616105 GGACAGGTAAGTGCAGACAGTGG + Intergenic
1179980441 21:44892988-44893010 GGTCAGGCCACTGCAGACTGAGG - Intronic
1181147191 22:20857641-20857663 GCACAGGTCAAGGCACAGAGTGG - Intronic
1181747943 22:24968668-24968690 AGACAGCTCCATGCACACAGTGG - Intronic
951207519 3:19940044-19940066 GGACAGATCATTCCAAACTGGGG - Intronic
955326023 3:58009675-58009697 GGACAGGTCAATTAACCCTCCGG - Intronic
956777751 3:72579786-72579808 GAAAAGGTCAAAGCACACGGTGG + Intergenic
959770636 3:110090911-110090933 GGGCAAGTCAATGCAAATTGAGG + Intergenic
959866540 3:111276802-111276824 AGACAGGTCAATGTCTACTGAGG - Intergenic
959876847 3:111393162-111393184 GGACAGGTCAATGCACACTGAGG - Intronic
961779414 3:129313059-129313081 GGACAGCCCAAAGCACACTTTGG + Intergenic
966816876 3:183896678-183896700 GCCCAGGACAATACACACTGGGG + Intergenic
968940926 4:3637256-3637278 GGAAAGAACAAGGCACACTGGGG - Intergenic
971078510 4:23178960-23178982 GGTCGGGACAATACACACTGGGG + Intergenic
975650507 4:76588442-76588464 GGACAGCACAATACACAATGGGG + Intronic
978469439 4:109047137-109047159 GGACTGGTCCAAGCTCACTGGGG + Intronic
979176046 4:117665266-117665288 GGAGAGGCCACTGGACACTGAGG + Intergenic
985136653 4:186792982-186793004 GGGCAGGTTAATGCAAATTGAGG + Intergenic
985284068 4:188316597-188316619 GGACAGTCCAATGCAAACTGAGG - Intergenic
985700465 5:1368840-1368862 GGACAGGTCAATGCAAATTAAGG - Intergenic
997578724 5:135004204-135004226 GGACAAGTCAATAACCACTGAGG - Intronic
1001415767 5:171544009-171544031 GGGCAGGTCACTGCACTCTCTGG + Intergenic
1003539283 6:7003958-7003980 GGGTAAGTCACTGCACACTGAGG - Intergenic
1003699114 6:8442555-8442577 GGACAGGACAAGGAACAGTGAGG - Intergenic
1010665429 6:78624243-78624265 GGACAGTTGAATGGACACTAAGG + Intergenic
1010865954 6:80976978-80977000 GGGCAGGTCAATGCAAATTGAGG - Intergenic
1010866606 6:80983337-80983359 GGGAAGGTCAATGCAAATTGAGG - Intergenic
1012412392 6:98973737-98973759 GGACTGATTACTGCACACTGTGG + Intergenic
1016519575 6:144931464-144931486 AGGCAGGTCAATGCAAATTGAGG + Intergenic
1017730408 6:157310875-157310897 GGCTAGGTGAGTGCACACTGGGG - Intronic
1017730413 6:157310909-157310931 GGCTAGGTGAGTGCACACTGGGG - Intronic
1017730419 6:157310943-157310965 GGCCAGGTGAGTGCACACTGGGG - Intronic
1017730428 6:157311001-157311023 GGCTAGGTGACTGCACACTGGGG - Intronic
1017730603 6:157312293-157312315 GGTCAGATCAACGCACACTGGGG - Intronic
1017730607 6:157312327-157312349 GGCTAGGTGATTGCACACTGGGG - Intronic
1017730644 6:157312593-157312615 GGCTAGGTGAGTGCACACTGCGG - Intronic
1017730675 6:157312831-157312853 GGCCAGGTGAGTGCACACTGTGG - Intronic
1017730732 6:157313205-157313227 GGCCAGGTGAGGGCACACTGAGG - Intronic
1017730750 6:157313341-157313363 GGCCAGGTGAGCGCACACTGGGG - Intronic
1017730834 6:157313884-157313906 GGCCAGGTGAGCGCACACTGGGG - Intronic
1017730889 6:157314221-157314243 GGCCAGGTGAGTGCACACTGGGG - Intronic
1018322901 6:162632467-162632489 GGACATAACAATGGACACTGGGG + Intronic
1018623260 6:165751802-165751824 GGACAGGTGCATGCAAATTGAGG - Intronic
1019129097 6:169860446-169860468 GGGCAGGGCTCTGCACACTGAGG - Intergenic
1019315697 7:384953-384975 GAAAAGGTAAATGCAGACTGAGG + Intergenic
1019954337 7:4401433-4401455 GGGTAGGTCAATGCAAGCTGAGG + Intergenic
1021327150 7:19287336-19287358 GGCCAGATCATAGCACACTGTGG + Intergenic
1021521069 7:21539523-21539545 GAAAAGGTGAATGGACACTGGGG + Intergenic
1028035407 7:85975474-85975496 GGGCAGCTCAATGCAAAGTGAGG + Intergenic
1028651464 7:93154790-93154812 CCAGAGGTCAATGCACACTGTGG - Intergenic
1030214392 7:107029216-107029238 AGACAGGGCCCTGCACACTGTGG + Intergenic
1030776765 7:113543307-113543329 GGACGAGTCAATGCAAATTGAGG - Intergenic
1031990707 7:128197205-128197227 GGGGAGGTCGAGGCACACTGGGG - Intergenic
1032844738 7:135742781-135742803 GGACAGCACAAGGCACACAGTGG - Intronic
1033582460 7:142750132-142750154 GGCCAGGTCTATGCAGACAGGGG + Intronic
1034930796 7:155161734-155161756 GCACAGGTCAATGCTGCCTGCGG + Intergenic
1035698992 8:1623622-1623644 TGCCAGGTCATGGCACACTGGGG - Intronic
1035911894 8:3576410-3576432 GGACAGGTAAATGCAGAAAGAGG - Intronic
1036229009 8:6983747-6983769 GGACAGCGCGATGCACTCTGAGG - Intergenic
1036231462 8:7002852-7002874 GGACAGCGCGATGCACTCTGAGG - Intronic
1036908421 8:12729268-12729290 GGAGAGGGCAAGGCACAGTGGGG + Exonic
1038320465 8:26521378-26521400 GGACAGCCCAATGACCACTGAGG - Intronic
1040126768 8:43746504-43746526 GGACAGTTGAAAGCCCACTGAGG + Intergenic
1040283338 8:46083116-46083138 GGACATTTCAGTGCTCACTGAGG + Intergenic
1040297316 8:46161997-46162019 GAACATTTCAAAGCACACTGAGG - Intergenic
1040320057 8:46288153-46288175 AGACATTTCAGTGCACACTGGGG - Intergenic
1040320088 8:46288494-46288516 AGACATTTCAAAGCACACTGAGG - Intergenic
1040321467 8:46309666-46309688 GGACATTTCAAAGCCCACTGAGG - Intergenic
1040327195 8:46355117-46355139 GGACATTTCAAAGCTCACTGAGG - Intergenic
1040327269 8:46356302-46356324 GGACATTTCATAGCACACTGAGG - Intergenic
1040327297 8:46356811-46356833 GGACATTTCAAAGCCCACTGAGG - Intergenic
1040327987 8:46368901-46368923 GGACATTTCAGTGCACACTGAGG - Intergenic
1040328109 8:46371138-46371160 GGACATTTCAAAGCACATTGAGG - Intergenic
1040344293 8:46472678-46472700 GGACATTTCAAAGCTCACTGAGG - Intergenic
1040344426 8:46474915-46474937 GGACATTTCAAAGCTCACTGAGG - Intergenic
1040347521 8:46521381-46521403 GGACATTTCAAAGCTCACTGAGG + Intergenic
1041615799 8:59905328-59905350 GGAGAAAACAATGCACACTGGGG + Intergenic
1048394672 8:134002584-134002606 GGACAAGTCAAGGAACACAGAGG - Intergenic
1049001519 8:139828261-139828283 GGACAAGCCAATACAAACTGAGG - Intronic
1060317091 9:122522011-122522033 GGACAGCCCAAAGCACACTGGGG + Intergenic
1061205933 9:129163509-129163531 GGCCAGTTCAAGGCACACTCAGG - Intergenic
1186419929 X:9417534-9417556 GGATGGGTCAAGGCAAACTGGGG - Intergenic
1187856017 X:23636869-23636891 GGACAATTAAATGCACCCTGAGG + Intergenic
1190554767 X:51623081-51623103 GGGCAGGTCAATGCAAATTGAGG + Intergenic
1191259942 X:58306682-58306704 GGACATTTCAGGGCACACTGAGG + Intergenic
1191583625 X:62794451-62794473 GGACATTTCAGTGCCCACTGAGG - Intergenic
1191882614 X:65857655-65857677 GGACTGGTCAATGCAAAGTGTGG + Intergenic
1195389221 X:104343689-104343711 GGGCAGGTTAATGCAAATTGAGG + Intergenic
1196613720 X:117743313-117743335 GGACAGGTCATGGTACAGTGGGG + Intergenic
1201779465 Y:17703121-17703143 GGACATTTCAGAGCACACTGGGG - Intergenic
1201822091 Y:18202871-18202893 GGACATTTCAGAGCACACTGGGG + Intergenic
1202133724 Y:21638530-21638552 GGACATGTCAGTGCACAAGGTGG - Intergenic