ID: 959879403

View in Genome Browser
Species Human (GRCh38)
Location 3:111425775-111425797
Sequence CAGTATTAGATCACTGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 2, 2: 6, 3: 17, 4: 125}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959879400_959879403 15 Left 959879400 3:111425737-111425759 CCACACAATAATTCTGGGAGACT 0: 1
1: 96
2: 5063
3: 5777
4: 2560
Right 959879403 3:111425775-111425797 CAGTATTAGATCACTGAGGCAGG 0: 1
1: 2
2: 6
3: 17
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959879403 Original CRISPR CAGTATTAGATCACTGAGGC AGG Intronic
900079067 1:842155-842177 CAGTGTCAGGGCACTGAGGCTGG - Intergenic
904590850 1:31614650-31614672 CAGGATTAGATCAACAAGGCTGG + Intergenic
905751225 1:40466230-40466252 CTGTATGAGATCACTGAGGCAGG - Intergenic
907223188 1:52921900-52921922 CAGGATTAAAACACTGACGCTGG - Intronic
907762509 1:57375311-57375333 CATTATTAGATCACTTAAGCAGG + Intronic
908625239 1:66032948-66032970 AAGAATTAGATAAATGAGGCCGG - Intronic
912423301 1:109563099-109563121 CAAAATTAGAACACTGAGACTGG + Intronic
916875450 1:168963824-168963846 ATGGATTAGATCACTGAGGCTGG - Intergenic
918755617 1:188337127-188337149 CAGTTTTTGATCACTCAGACAGG + Intergenic
919016035 1:192038061-192038083 CAGAAAAAGAACACTGAGGCCGG + Intergenic
919733551 1:200929956-200929978 CAGTGTTAGATCCTGGAGGCTGG - Intergenic
923102415 1:230826999-230827021 CACTCTTTGGTCACTGAGGCTGG + Intergenic
923266691 1:232321031-232321053 CAGTTTTAGATGAGTGGGGCTGG + Intergenic
923579532 1:235194938-235194960 CATTAATATATCACTGAGGTAGG - Intronic
1067986209 10:51148982-51149004 GAGAATAAGATCACTGAGGTAGG - Intronic
1069548865 10:69348512-69348534 CAGAATTAATTCATTGAGGCTGG + Intronic
1070343406 10:75519267-75519289 CAATATTAGATCAACGAGACAGG - Intronic
1071260399 10:83914324-83914346 CTGTATTAAGCCACTGAGGCTGG - Intergenic
1071346674 10:84700180-84700202 AAAGATGAGATCACTGAGGCTGG - Intergenic
1072831856 10:98666357-98666379 CAGTGTTAGATCATTGAGGCAGG + Intronic
1075036448 10:119072749-119072771 GAGTATTAAATGACTGCGGCCGG - Intronic
1087284403 11:96249069-96249091 CTGTAATTGATCACTGAGTCAGG - Intronic
1088034460 11:105295349-105295371 CAATATTAGATCAATGAGACAGG - Intergenic
1088437795 11:109834496-109834518 GAGTTTTGGATCACAGAGGCCGG - Intergenic
1094054891 12:26258717-26258739 CAGTATTAGATCAATGAGACAGG + Intronic
1095259214 12:40079665-40079687 CAGTGTTAGATCATCGAGGCAGG - Intronic
1097391847 12:59024841-59024863 GAGTATAAGCTCCCTGAGGCAGG + Intergenic
1101695532 12:107122269-107122291 AAGTATTAGTTGACTGAGACTGG + Intergenic
1102845304 12:116174948-116174970 CAGTCTCAGATGGCTGAGGCAGG + Intronic
1102988060 12:117294560-117294582 CAATATTAGATGACTCAGGAGGG + Intronic
1104013499 12:124948027-124948049 CAGGATGGGGTCACTGAGGCAGG - Intronic
1104171161 12:126282375-126282397 GAGTTTTAGGTCACTGTGGCAGG + Intergenic
1104614718 12:130258173-130258195 CAGTGGTAGTTCACTGAGACAGG + Intergenic
1104614726 12:130258232-130258254 CAGTGGTAGTTCACTGAGACAGG + Intergenic
1104614734 12:130258291-130258313 CAGTGGTAGTTCACTGAGACAGG + Intergenic
1105802298 13:23917583-23917605 CAGCATTAGATCATCAAGGCAGG + Intergenic
1106231813 13:27826487-27826509 CAGCATGAGATCAATGAGCCAGG + Intergenic
1107297034 13:38920599-38920621 GAGTATTAGATCATCGAGGCAGG - Intergenic
1107588324 13:41876439-41876461 CAGTATAAAAACGCTGAGGCAGG - Intronic
1108243569 13:48492549-48492571 CAGTTTTAGCGCAGTGAGGCGGG - Intronic
1108293554 13:48988226-48988248 CAGTATTAGATCAACGAGACAGG + Intronic
1113033333 13:106018687-106018709 CAGCATTCGATCACTGAGTCAGG - Intergenic
1113326521 13:109287400-109287422 CAGTATTATTTCACTCACGCTGG + Intergenic
1116444976 14:44998518-44998540 CAGCCTTAAATAACTGAGGCAGG + Intronic
1117178154 14:53166095-53166117 GAGTATTAAATCCCTGAGACTGG + Intergenic
1118242344 14:64072404-64072426 CAGCATCAGATCACACAGGCTGG + Intronic
1120810539 14:88798868-88798890 CAGTATTACCCCAGTGAGGCAGG + Intergenic
1124545430 15:30622054-30622076 TAATGTTAGATCTCTGAGGCTGG - Intergenic
1124778949 15:32611454-32611476 TAATGTTAGATCTCTGAGGCTGG - Intergenic
1126198389 15:45956732-45956754 CAGTATGAAATCCCTAAGGCAGG - Intergenic
1126239719 15:46427487-46427509 CAACATTAGATCAATGAGACAGG + Intergenic
1128207395 15:65865458-65865480 AAGAAATAGAACACTGAGGCCGG + Intronic
1134148398 16:11786015-11786037 CAGTAGTAGAAGACTGAGGCTGG + Intronic
1138844135 16:60544716-60544738 CTGTATTAGAGCACTGACACTGG - Intergenic
1139001747 16:62519216-62519238 CAATATTAGATCAACGAGACAGG + Intergenic
1140408633 16:74727520-74727542 CAGTTCTTGATCACTGAAGCAGG - Intronic
1141411009 16:83833205-83833227 CAGTATTACAGCTCTGTGGCTGG - Intergenic
1143298440 17:5889227-5889249 CTGTCTTAGATCACTCAGTCTGG - Intronic
1145212893 17:21028174-21028196 CAATATGAGGTCGCTGAGGCTGG - Intronic
1148320511 17:46747568-46747590 TTGTTTTAGATCTCTGAGGCCGG - Intronic
1149988905 17:61369474-61369496 CAGAGTCAGAGCACTGAGGCAGG + Intronic
1157066288 18:44354756-44354778 CAATATTAGATCAACGAGACAGG - Intergenic
1159549100 18:69876747-69876769 CAGTATCAGATCCCACAGGCTGG + Intronic
1160216566 18:76938090-76938112 CAGAATTAGAAAGCTGAGGCTGG + Intronic
1161989750 19:7677922-7677944 CGGTGTTAGATCGCTGAGGGTGG + Intronic
1163215972 19:15877703-15877725 CAGAAGTAGATCACTGAGAAGGG - Intergenic
1165739738 19:38198086-38198108 CAGTGCTAAATCCCTGAGGCAGG - Intronic
926693275 2:15752234-15752256 CAGGATTGGATCAGAGAGGCAGG - Intergenic
931242101 2:60462450-60462472 CAATGTTTAATCACTGAGGCGGG + Intronic
931243914 2:60477144-60477166 AAGTATTAGATACCTGAGGAAGG + Intronic
936407488 2:112219831-112219853 CAGTATTAGATCGTTGAGGTAGG - Intronic
936848746 2:116870869-116870891 CAATATTAGAACAATGAGACAGG - Intergenic
937867239 2:126761650-126761672 CAGCATTAAATCACTTATGCAGG - Intergenic
940073509 2:149715754-149715776 CAGTAACAGATCTCTGATGCAGG + Intergenic
941724281 2:168844535-168844557 CATTATGAGAACATTGAGGCTGG + Intronic
941846609 2:170140516-170140538 CAGAGTTAGACCACTGAGGAGGG - Intergenic
945391380 2:209269178-209269200 AAGTATTAGGTCATTGAGGGTGG + Intergenic
946829675 2:223715405-223715427 CAGTTTTAGATAATTGTGGCTGG - Intergenic
947287001 2:228528160-228528182 CACTATTAGCTCACACAGGCTGG + Intergenic
1171223023 20:23418639-23418661 CATTAAAAGATCAATGAGGCTGG + Intronic
1183590808 22:38778339-38778361 CACCATTAGGTCACTGAGGTTGG - Intronic
1183979422 22:41530979-41531001 CAGGGTGAGATCACTGTGGCTGG + Intronic
951077281 3:18410705-18410727 CAGTATATGAACACTGATGCTGG + Intronic
955321353 3:57976684-57976706 CAGTCTAGGTTCACTGAGGCAGG + Intergenic
955364287 3:58298325-58298347 CAGTATTTGCTCCCTGGGGCTGG + Intergenic
956012456 3:64845937-64845959 TATTTTTAAATCACTGAGGCTGG - Intergenic
959879403 3:111425775-111425797 CAGTATTAGATCACTGAGGCAGG + Intronic
960875164 3:122288505-122288527 CAGGAATAGATCTCTGAGACAGG - Intergenic
961640967 3:128364647-128364669 CAGCAGTAGATGAATGAGGCTGG - Intronic
961949354 3:130731958-130731980 CAGTATGTGATCACCCAGGCTGG - Intronic
963615057 3:147526454-147526476 CAGTATTAGATCATTAAGGCAGG - Intergenic
963835582 3:150055209-150055231 CAGGATATGCTCACTGAGGCTGG + Intergenic
963925584 3:150947481-150947503 CAGTATTAGATCATGGAGGCAGG + Intronic
968134536 3:196211441-196211463 CAGTGTGACATCACAGAGGCTGG + Intergenic
969195676 4:5561982-5562004 CAGTAATATCTCACTGGGGCTGG - Intronic
970386907 4:15565416-15565438 CTGTATTAGAACAGTGAGGGAGG - Intronic
970644432 4:18103921-18103943 CAGTATAGAGTCACTGAGGCAGG - Intergenic
970873021 4:20837984-20838006 CAAAAATATATCACTGAGGCCGG - Intronic
973673877 4:53244165-53244187 CAGTATTAGATCATTGAGGCAGG + Intronic
977332663 4:95657267-95657289 CAGTATTAGATCATCAAGGCAGG - Intergenic
978657100 4:111077138-111077160 CAGTGTTAGATCAATGAGACAGG + Intergenic
981001901 4:139836400-139836422 CAGTATAGGATTACTGGGGCAGG + Intronic
981697240 4:147571298-147571320 AGGTATTAGATTAATGAGGCTGG - Intergenic
981763181 4:148216420-148216442 ACGTATGAGAACACTGAGGCTGG + Intronic
982519037 4:156390042-156390064 AGGTATGAGATCACAGAGGCTGG + Intergenic
982609727 4:157558293-157558315 CATAATTAGGTCACTTAGGCTGG - Intergenic
988938196 5:36112319-36112341 CAGAATTAGATCACTGTCTCTGG + Intronic
991233535 5:64365548-64365570 AAGTACTAGATCACTGAGGAGGG - Intronic
993966091 5:94362593-94362615 CAGTAGAAGATCACAGAGGAGGG - Intronic
994671109 5:102762827-102762849 CAGTAATAGCTAAGTGAGGCAGG - Intronic
998412153 5:141919565-141919587 CAGTTTAAGATCACTGTAGCTGG - Intergenic
999421658 5:151449726-151449748 CTGTATTAGAACACTGAGCACGG + Intronic
1002125190 5:177038000-177038022 CAGTATTAAGTCTGTGAGGCAGG - Intronic
1004593475 6:17076013-17076035 CAATATTAGATCAATGAGACAGG + Intergenic
1006214740 6:32430536-32430558 CAGTGTTTGCTGACTGAGGCGGG + Intergenic
1008978796 6:57459130-57459152 CAGTTTAAGTTCTCTGAGGCTGG + Intronic
1009166933 6:60352116-60352138 CAGTTTAAGTTCTCTGAGGCTGG + Intergenic
1010426693 6:75735597-75735619 CTATCTTAGATCAATGAGGCAGG - Intergenic
1014852779 6:126362009-126362031 GTGTATTAGAGCACTCAGGCTGG + Intergenic
1015385599 6:132619503-132619525 CACTCTTATATCACAGAGGCTGG - Intronic
1023226026 7:37969940-37969962 CAGGATGAGATCACTCAGGGAGG - Intronic
1025306365 7:57862292-57862314 CAGAATTACATCACTGAATCCGG - Intergenic
1025318988 7:58071212-58071234 CAGAATTACATCACTGAATCCGG + Intergenic
1025779644 7:64589103-64589125 CACTAATAGATCACTGAGGCAGG - Intergenic
1026106897 7:67428544-67428566 AAGTACTACATCATTGAGGCAGG - Intergenic
1027969202 7:85056842-85056864 CAGTATGACATCAATGAGGTGGG - Intronic
1027969471 7:85059991-85060013 CAGTATGACATCAATGAGGTGGG + Intronic
1031191534 7:118558293-118558315 CAGTATTAGACCACCCAGCCAGG - Intergenic
1033754921 7:144390397-144390419 CAGTATAAGACCACTGAGATTGG - Intergenic
1035526563 8:317528-317550 CAGTGTCAGGGCACTGAGGCTGG + Intergenic
1036095194 8:5716488-5716510 CACTATTAGATCCCGAAGGCGGG + Intergenic
1041113266 8:54507535-54507557 CAGTAGCAGAAGACTGAGGCTGG + Intergenic
1043108696 8:76150243-76150265 CAGTATTAGAAGGCTGAGGCAGG - Intergenic
1045870082 8:106916668-106916690 CATTTGTAAATCACTGAGGCTGG + Intergenic
1047939284 8:129813273-129813295 CAGCATTAGATTATTGAGGCAGG - Intergenic
1051533953 9:18136075-18136097 CAGTATTATGTGACTGAGGGAGG - Intergenic
1053903920 9:42822454-42822476 CACAATGAGATCAATGAGGCAGG + Intergenic
1054531067 9:66183060-66183082 CACAATGAGATCAATGAGGCAGG - Intergenic
1055250701 9:74301738-74301760 AAGAATTAGACCAGTGAGGCTGG + Intergenic
1056208361 9:84341389-84341411 CAGTAGGTGATCACTGAGGGCGG - Intergenic
1056969419 9:91190160-91190182 CAGAACCACATCACTGAGGCAGG + Intergenic
1059210549 9:112510918-112510940 CAGTATAAAATCCCTGAGGTGGG + Intronic
1059949898 9:119451342-119451364 CACTCTTAAATCACTGTGGCAGG - Intergenic
1186531303 X:10298557-10298579 CAGGATTAGTTCACTGTGGATGG + Intergenic
1187861529 X:23688243-23688265 CAGTATTTGATTACTGAAGCGGG + Intergenic
1188087630 X:25920505-25920527 AAGAATTACATCAGTGAGGCTGG + Intergenic
1191949528 X:66573131-66573153 CAGTATTAGATCATTGAGGCAGG - Intergenic
1194443666 X:93962035-93962057 CAGTGTTAGATCTCTGCTGCTGG - Intergenic
1196183066 X:112716171-112716193 CAGACTTAGGTCTCTGAGGCTGG - Intergenic
1196600142 X:117592050-117592072 CAATATTAGATCATTGAGACAGG + Intergenic
1201550768 Y:15214329-15214351 CAGTGTTAGGACACTGAGGGAGG + Intergenic