ID: 959879658

View in Genome Browser
Species Human (GRCh38)
Location 3:111429079-111429101
Sequence GCACCCTCTGTAGCCAAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 950
Summary {0: 1, 1: 0, 2: 9, 3: 42, 4: 898}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959879658_959879663 21 Left 959879658 3:111429079-111429101 CCAGCTTTGGCTACAGAGGGTGC 0: 1
1: 0
2: 9
3: 42
4: 898
Right 959879663 3:111429123-111429145 TCTACATGTTTTTAAGTCTGAGG 0: 1
1: 0
2: 0
3: 42
4: 386
959879658_959879660 -4 Left 959879658 3:111429079-111429101 CCAGCTTTGGCTACAGAGGGTGC 0: 1
1: 0
2: 9
3: 42
4: 898
Right 959879660 3:111429098-111429120 GTGCAAGCCAAAAGCCTTGGTGG 0: 2
1: 57
2: 320
3: 523
4: 623
959879658_959879664 22 Left 959879658 3:111429079-111429101 CCAGCTTTGGCTACAGAGGGTGC 0: 1
1: 0
2: 9
3: 42
4: 898
Right 959879664 3:111429124-111429146 CTACATGTTTTTAAGTCTGAGGG 0: 1
1: 0
2: 3
3: 21
4: 296
959879658_959879659 -7 Left 959879658 3:111429079-111429101 CCAGCTTTGGCTACAGAGGGTGC 0: 1
1: 0
2: 9
3: 42
4: 898
Right 959879659 3:111429095-111429117 AGGGTGCAAGCCAAAAGCCTTGG 0: 5
1: 130
2: 1066
3: 2010
4: 2025

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959879658 Original CRISPR GCACCCTCTGTAGCCAAAGC TGG (reversed) Intronic
900261537 1:1732925-1732947 TCTCACTCTGTAGCCCAAGCTGG + Intronic
900691890 1:3985800-3985822 TCTCCCTCTGTTGCCCAAGCTGG - Intergenic
901053294 1:6436751-6436773 GCACCTTCGGAGGCCAAAGCAGG - Intronic
901071605 1:6522518-6522540 GGACTCTCTGTCGCCAAGGCTGG - Exonic
901091565 1:6645123-6645145 GCACCCTCTGTCTCCCCAGCTGG - Exonic
901217234 1:7561607-7561629 GCACCCTCTGCAGGCAGAGCTGG + Intronic
901290326 1:8118970-8118992 GCTCGCTCTGTTGCCCAAGCTGG - Intergenic
901368577 1:8776325-8776347 GCTCCCTCTGTAGCCCAGGCTGG + Intronic
901522781 1:9798062-9798084 GCTCCCTCTGTTGCCCAGGCTGG - Intronic
902705790 1:18203336-18203358 TCTCCCTCTGTCGCCAAGGCTGG + Intronic
902805874 1:18861064-18861086 TCTCACTCTGTAGCCCAAGCTGG - Intronic
903095856 1:20972603-20972625 TCTCACTCTGTAGCCCAAGCTGG - Intronic
903739184 1:25548593-25548615 GCACTCTGGGTGGCCAAAGCAGG - Intronic
903826041 1:26146406-26146428 TCTCCCTCTGTTGCCCAAGCTGG + Intergenic
904057413 1:27680546-27680568 GCACCCTCTGAAGCCACAGCTGG + Intergenic
904145951 1:28391367-28391389 TCTCCCTCTGTAGCCCAGGCTGG - Intronic
904326225 1:29728345-29728367 GGAACATCTGCAGCCAAAGCTGG - Intergenic
905117947 1:35658823-35658845 TCTCCCTCTGTAGCCCAGGCCGG - Intergenic
905146333 1:35889694-35889716 TCTCCCTCTGTCGCCCAAGCTGG + Intronic
905218933 1:36430682-36430704 TCTCCCTCTGTCGCCCAAGCTGG + Intronic
905444207 1:38014665-38014687 TCTCCCTCTGTTGCCAAGGCTGG + Intronic
906337094 1:44942883-44942905 TCTCCCTCTGTTGCCCAAGCTGG + Intronic
906980196 1:50621427-50621449 TCTCACTCTGTAGCCCAAGCTGG + Intronic
907179143 1:52553823-52553845 GGACCCTCGGAAGCCCAAGCGGG + Intergenic
907443968 1:54495838-54495860 TCTCCCTCTGTCGCCCAAGCTGG - Intergenic
908524772 1:64977177-64977199 TCTCCCTCTGTCGCCCAAGCTGG + Intergenic
908542040 1:65130902-65130924 TCACACTCTGTAGCCCAGGCTGG + Intergenic
908687233 1:66735243-66735265 TCTCCCTCTGTTGCCCAAGCTGG + Intronic
908781985 1:67699152-67699174 TCTCCCTCTGTCGCCCAAGCTGG - Intergenic
909161945 1:72162434-72162456 GCTTCCTCTGTAGCCTAGGCTGG - Intronic
910249105 1:85175452-85175474 TCTCACTCTGTAGCCCAAGCTGG - Intronic
910570938 1:88701986-88702008 TCTCACTCTGTAGCCCAAGCTGG + Intronic
911132159 1:94400008-94400030 TCTTGCTCTGTAGCCAAAGCTGG - Intergenic
911184956 1:94894063-94894085 TCACCCTCTGTCGCCCAGGCTGG - Intronic
911645690 1:100335111-100335133 TCTCACTCTGTTGCCAAAGCTGG - Intergenic
911911794 1:103646917-103646939 TCACCCTCTGTCGCCAACACTGG + Intergenic
911916660 1:103705031-103705053 TCACCCTCTGTCGCCAACACTGG - Intronic
911919209 1:103741055-103741077 TCACCCTCTGTCGCCAACACTGG + Intronic
912044686 1:105438715-105438737 TCTCACTCTGTAGCCAAGGCTGG - Intergenic
912783289 1:112573942-112573964 TCTCACTCTGTAGCCCAAGCTGG + Intronic
912792310 1:112664199-112664221 TCACGCTCTGTCGCCCAAGCTGG - Intronic
912928956 1:113938878-113938900 TCTCACTCTGTAGCCCAAGCTGG - Intronic
913249113 1:116897162-116897184 TCTCCCTCTGTAGCCCAGGCTGG - Intergenic
913649073 1:120892385-120892407 TCTCGCTCTGTTGCCAAAGCTGG - Intergenic
914077633 1:144371137-144371159 TCTCACTCTGTTGCCAAAGCTGG + Intergenic
914101546 1:144595368-144595390 TCTCACTCTGTTGCCAAAGCTGG - Intergenic
914172542 1:145239677-145239699 TCTCACTCTGTTGCCAAAGCTGG + Intergenic
914297421 1:146342129-146342151 TCTCGCTCTGTTGCCAAAGCTGG + Intergenic
914639209 1:149586462-149586484 TCTCACTCTGTTGCCAAAGCTGG - Intergenic
914699331 1:150117169-150117191 TCGCCCTCTGTAGCCCAGGCTGG - Intronic
914863518 1:151406225-151406247 GCTCCCTCTGTAGCCAGCGGTGG + Exonic
914988096 1:152476749-152476771 GCACCCTCTGAAGCCACAGCCGG + Intergenic
916037182 1:160932700-160932722 TCTCCCTCTGTTGCCGAAGCTGG + Intergenic
916176397 1:162042875-162042897 TCTCCCTCTGTTGCCCAAGCTGG - Intergenic
916759972 1:167806972-167806994 TCTCCCTCTGTTGCCAAGGCTGG - Intergenic
916951382 1:169783979-169784001 TCACCCTATGTTGCCCAAGCTGG + Intronic
917955973 1:180098588-180098610 GCACTCTCTGAAGCCAAGGCAGG - Intronic
918042814 1:180923558-180923580 GCACCGGCTGCAGCCATAGCTGG + Intronic
918256816 1:182756185-182756207 TCTCGCTCTGTAGCCCAAGCTGG + Intergenic
919605423 1:199676421-199676443 TCTCGCTCTGTTGCCAAAGCTGG - Intergenic
920237406 1:204517210-204517232 TCTCCCTCTGTAGCCCAAGCTGG - Intronic
920321472 1:205126727-205126749 TCTCCCTATGTAGCCCAAGCTGG + Intergenic
920749749 1:208662459-208662481 TCTCCCTCTGTTGCCTAAGCTGG + Intergenic
920842090 1:209563528-209563550 TCTCCCTCTGTCGCCCAAGCTGG + Intergenic
920910179 1:210209139-210209161 GCTCCCTCTGTCGCCCAGGCTGG - Intergenic
921247465 1:213259531-213259553 TCTCACTCTGTAGCCCAAGCTGG - Intronic
921466339 1:215492583-215492605 GCACCCTCTGAAGCCATAGCTGG - Intergenic
921700985 1:218268955-218268977 TCTCACTCTGTAGCCCAAGCTGG + Intergenic
922151811 1:223012398-223012420 TCTCACTCTGTAGCCCAAGCTGG - Intergenic
922364235 1:224849072-224849094 TCTCCCTCTGTAGCCCAGGCTGG - Intergenic
922394005 1:225177621-225177643 GCACCCTCTGAAGCCATGGCCGG - Intronic
922521674 1:226258141-226258163 TCTCCCTCTGTAGCCTAGGCTGG - Intronic
923226754 1:231944729-231944751 GCACACTCAGAAGCCTAAGCTGG + Intronic
923389517 1:233500114-233500136 TCTCCCTCTGTCGCCCAAGCTGG - Intergenic
923747082 1:236711378-236711400 GCTCACTCTGTTGCCTAAGCTGG + Intronic
924036587 1:239944133-239944155 GGACCCCCTGTAGCCATAGCTGG + Intergenic
924227858 1:241936886-241936908 TCTCCCTCTGTTGCCCAAGCTGG + Intergenic
924540293 1:244974722-244974744 GCAACCTCTGTTGCCTAAGCTGG + Intronic
1063211509 10:3885116-3885138 GCTCGCTCTGTTGCCCAAGCTGG - Intergenic
1063760493 10:9069151-9069173 TCTCACTCTGTAGCCCAAGCTGG - Intergenic
1064130049 10:12701507-12701529 GCAGCCTCTGTGGCCAGAGAGGG - Intronic
1064454016 10:15469985-15470007 TCTCCCTCTGTTGCCCAAGCTGG + Intergenic
1065010952 10:21420161-21420183 TCTCCCTCTGTTGCCCAAGCTGG - Intergenic
1065073901 10:22057014-22057036 TCTCACTCTGTTGCCAAAGCTGG - Intergenic
1065095043 10:22272106-22272128 TCTCCCTCTGTCGCCCAAGCTGG + Intergenic
1065513129 10:26499234-26499256 GCAACCTCTGTTGCCCAGGCTGG - Intronic
1065551468 10:26872248-26872270 TCTCCCTCTGTAGCCCAGGCTGG + Intergenic
1066108348 10:32175304-32175326 GCTCGCTCTGTAGCCCAGGCAGG + Intergenic
1066489581 10:35881970-35881992 TCTCACTCTGTAGCCCAAGCTGG - Intergenic
1066566503 10:36727093-36727115 GCTCCCTCTGTCGCCCAGGCTGG + Intergenic
1066669779 10:37824709-37824731 TCTCCCTCTGTAGCCCAGGCTGG + Intronic
1067276512 10:44839811-44839833 TCTCACTCTGTAGCCCAAGCTGG + Intergenic
1067416695 10:46108044-46108066 GCTCGCTCTGTAGCCCAAGCTGG - Intergenic
1067535069 10:47103054-47103076 GCTCCTTCTGGAGCCAAAGAGGG + Intergenic
1068146825 10:53082574-53082596 TCTCCCTCTGTAGCCCAGGCTGG + Intergenic
1068272538 10:54747833-54747855 TCTCGCTCTGTAGCCCAAGCTGG + Intronic
1068772691 10:60840104-60840126 GCTTGCTCTGTAGCCAAAGTTGG + Intergenic
1069367860 10:67712563-67712585 GCACCCTCTGAAGCCATGGCCGG - Intergenic
1069405617 10:68095029-68095051 TCTCCCTCTGTAGCCCAGGCTGG - Intergenic
1069550173 10:69358613-69358635 GCACCCTGGGAGGCCAAAGCGGG + Intronic
1070108349 10:73458553-73458575 GCACCCTGGGAGGCCAAAGCGGG + Intronic
1070339387 10:75482972-75482994 TCTCACTCTGTAGCCCAAGCTGG + Intronic
1070922015 10:80193780-80193802 TCTCCCTCTGTTGCCCAAGCTGG - Intronic
1071552717 10:86579487-86579509 TCTCCCTCTGTTGCCCAAGCTGG + Intergenic
1072211381 10:93249539-93249561 TCACGCTCTGTTGCCCAAGCTGG - Intergenic
1072359473 10:94646102-94646124 TCTCCCTCTGTAGCCCAGGCTGG + Intergenic
1072990749 10:100190822-100190844 GCACCCAACATAGCCAAAGCAGG + Intronic
1073158503 10:101368987-101369009 TCTCGCTCTGTCGCCAAAGCTGG - Intronic
1073240154 10:102052251-102052273 TCTCCCTCTGTTGCCCAAGCTGG + Intronic
1073326725 10:102647580-102647602 GCACTCTCTGTAGGCCAAACAGG + Intronic
1074047882 10:109855444-109855466 GAGCCCTCAGTGGCCAAAGCTGG + Intergenic
1074107158 10:110396990-110397012 TCACCCTATGTTTCCAAAGCTGG - Intergenic
1074273244 10:111975835-111975857 GCTCCCTATGTGGCCTAAGCTGG - Intergenic
1074626018 10:115187719-115187741 TCTCCCTCTGTAGCCCAGGCTGG + Intronic
1074913365 10:117932334-117932356 TCTCCCTCTGTAGCCCAGGCTGG - Intergenic
1075046543 10:119150637-119150659 TCTCCCTCTGTTGCCAAAGCTGG - Intronic
1075613504 10:123873887-123873909 TCTCACTCTGTAGCCCAAGCTGG + Intronic
1075799394 10:125143446-125143468 GCTCACTCTGTAGCCCAGGCTGG - Intronic
1076254268 10:129008722-129008744 TCTCCCTCTTTTGCCAAAGCTGG + Intergenic
1076828936 10:132984719-132984741 GAAGCATCTGCAGCCAAAGCTGG - Intergenic
1076926824 10:133494963-133494985 GCACCCTCTGAAGCCATGGCTGG + Intergenic
1077200382 11:1304004-1304026 GCTCGCTCTGTAGCCCAGGCTGG - Intronic
1077403682 11:2372166-2372188 TCTCTCTCTGTCGCCAAAGCTGG + Intergenic
1077523528 11:3050366-3050388 GCACACTCCCTAGCCAAAACTGG + Intronic
1079120341 11:17679263-17679285 TCACACTCTGTCGCCCAAGCTGG + Intergenic
1080313604 11:30923646-30923668 TCTCACTCTGTAGCCCAAGCTGG + Intronic
1080479555 11:32632253-32632275 TCTCACTCTGTAGCCCAAGCTGG + Intronic
1081968624 11:47184244-47184266 GCGCCCTTTGTCCCCAAAGCAGG + Intronic
1082045235 11:47720534-47720556 TCTCCCTCTGTAGCCCAGGCTGG - Intronic
1082075774 11:47975177-47975199 TCTCACTCTGTAGCCAAGGCTGG + Intergenic
1082729614 11:56779591-56779613 ACTCCCTCTGTCGCCCAAGCTGG + Intergenic
1082913792 11:58408278-58408300 TCTCACTCTGTAGCCAAGGCTGG - Intergenic
1083330197 11:61894052-61894074 TCTCCCTCTGTAGCCCAGGCTGG - Intergenic
1083973490 11:66098145-66098167 TCTCACTCTGTAGCCCAAGCTGG - Intronic
1083973575 11:66099071-66099093 TCTCACTCTGTAGCCCAAGCTGG + Intronic
1084128395 11:67116381-67116403 TCTCACTCTGTAGCCCAAGCTGG + Intergenic
1084200399 11:67553450-67553472 GCTGCCTCTGTTGCCCAAGCTGG - Intergenic
1084629744 11:70340100-70340122 TCTCCCTGTGTTGCCAAAGCTGG - Intronic
1084633309 11:70371100-70371122 GCTCCCTCTGTCGCCCAGGCTGG - Intronic
1084987954 11:72893716-72893738 TCTCCCTCTGTAGCCTAGGCTGG - Intronic
1085033193 11:73285098-73285120 TCTCGCTCTGTAGCCAAGGCTGG + Intronic
1085670779 11:78463092-78463114 GCTCCCTCTGTCGCCCAGGCTGG + Intronic
1085822055 11:79804052-79804074 TCTCCCTCTGTTGCCAAGGCTGG + Intergenic
1085859838 11:80219899-80219921 TCTCACTCTGTTGCCAAAGCTGG - Intergenic
1086136767 11:83449386-83449408 TCTCCCTCTGTAGCCCAAGCTGG - Intergenic
1086362739 11:86075757-86075779 GCTCACTCTGTTGCCCAAGCTGG - Intergenic
1086863452 11:91952037-91952059 GCTCTCTCTGTTGCCCAAGCTGG + Intergenic
1086969548 11:93065907-93065929 CCACCCTCTGCAGCCATGGCCGG + Intergenic
1087215598 11:95489871-95489893 TCACACTCTGTTGCCCAAGCTGG + Intergenic
1088511139 11:110576138-110576160 TCTCACTCTGTAGCCCAAGCTGG - Intergenic
1088655961 11:112000103-112000125 TCTCCCTCTGTAGCCTAGGCTGG - Intronic
1089418910 11:118316284-118316306 GCACTCTCTGTTTCCACAGCTGG + Intergenic
1089536782 11:119165491-119165513 TCTCACTCTGTAGCCCAAGCTGG + Intergenic
1089536878 11:119166197-119166219 TCTCACTCTGTAGCCAAGGCTGG + Intergenic
1089544342 11:119211534-119211556 GCTCCCTCTGTTGCCCAGGCTGG + Intronic
1089546809 11:119233478-119233500 GCACCTTGTGAGGCCAAAGCGGG - Intronic
1089715685 11:120357052-120357074 TCACCCTCTGTTGCCCAGGCTGG + Intronic
1089766557 11:120771763-120771785 GCACCCACTGGAGCCACACCTGG - Intronic
1089876124 11:121723451-121723473 GGACTCTCTGATGCCAAAGCGGG + Intergenic
1090018165 11:123104163-123104185 TCTCCCTCTGTAGCCCAGGCTGG + Intronic
1090034487 11:123236760-123236782 TCTCACTCTGTAGCCCAAGCTGG - Intergenic
1090379073 11:126312585-126312607 GCACTCTGAGCAGCCAAAGCGGG - Intronic
1090478731 11:127048977-127048999 TCTCACTCTGTAGCCCAAGCTGG + Intergenic
1090824479 11:130374615-130374637 TCTCCCTCTGTCGCCCAAGCTGG - Intergenic
1091087902 11:132741027-132741049 GCACCCTCTGTCACCCATGCTGG - Intronic
1091217116 11:133908928-133908950 GCCCCCTCTTTTGCCAGAGCGGG - Exonic
1091236884 11:134028104-134028126 GGACCCTCTGCTGCCAAAACAGG + Intergenic
1092612654 12:10188427-10188449 TCTCACTCTGTAGCCCAAGCTGG - Intronic
1092866657 12:12767624-12767646 TCTCCCTCTGTAGCCCAGGCTGG - Intronic
1093722748 12:22463359-22463381 TCTCCCTCTGTTGCCAAGGCTGG - Intronic
1094109622 12:26847913-26847935 TCTCCCTCTGTTGCCAAGGCTGG + Intergenic
1094148722 12:27258289-27258311 GCACCTTGGGAAGCCAAAGCAGG - Intronic
1094454653 12:30619056-30619078 TCTCACTCTGTAGCCCAAGCTGG - Intergenic
1094713020 12:32984456-32984478 TCTCACTCTGTAGCCCAAGCTGG + Intergenic
1095061525 12:37698297-37698319 GAACCCTTTGTGGCCAAAGGTGG - Intergenic
1095782722 12:46078140-46078162 GTACCCCTTGGAGCCAAAGCTGG + Intergenic
1096168418 12:49445932-49445954 TCGCACTCTGTAGCCCAAGCTGG + Intronic
1096189441 12:49605787-49605809 TCTCCCTCTGTAGCCCAGGCTGG + Intronic
1096651137 12:53062489-53062511 CTACCCCCTGCAGCCAAAGCAGG + Intronic
1096813374 12:54185785-54185807 TCTCCCTCTGTAGCCCAGGCTGG - Intronic
1097039831 12:56149239-56149261 TCACCCTCTGTTGCCCATGCTGG + Intergenic
1097091801 12:56511362-56511384 GCACGCTCTATAGCCAAGGAAGG + Intergenic
1098179111 12:67827114-67827136 GCAGGCTCTGGAGTCAAAGCTGG - Intergenic
1098203032 12:68077236-68077258 TCTCCCTCTGTTGCCCAAGCTGG - Intergenic
1098445809 12:70564487-70564509 TCTCCCTCTGTTGCCCAAGCTGG - Intronic
1098511049 12:71314625-71314647 GCACCTGCTCAAGCCAAAGCAGG - Intronic
1098661025 12:73094142-73094164 GCACCTTCTGAAGCAACAGCTGG - Intergenic
1100643517 12:96505530-96505552 GCTCACTCTGTTGCCCAAGCTGG + Intronic
1101162831 12:101996729-101996751 TCTCCCTCTGTCGCCAAGGCTGG + Intronic
1101723084 12:107367532-107367554 TCTCACTCTGTAGCCCAAGCTGG + Intronic
1101735609 12:107460627-107460649 TCTCACTCTGTAGCCCAAGCTGG - Intronic
1101789103 12:107911891-107911913 GAAACCTCTGTAGCCAAAGAGGG + Intergenic
1102064700 12:109964540-109964562 GCAAACGCTGTAGGCAAAGCAGG + Intronic
1102119780 12:110430896-110430918 TCTCACTCTGTCGCCAAAGCTGG - Intergenic
1102172443 12:110852579-110852601 GCTCCCTGTGTACCCAAAGAGGG - Intronic
1102327466 12:111999567-111999589 TCTCGCTCTGTAGCCCAAGCTGG - Intronic
1103063645 12:117878790-117878812 ACAGCCTCTGTGGCCAAAGTGGG - Intronic
1103630929 12:122260327-122260349 TCTCCCTCTGTCGCCCAAGCTGG + Intronic
1103776595 12:123370990-123371012 TCTCCCTCTGTAGCCCAGGCTGG - Intergenic
1103805267 12:123567618-123567640 TCTCCCTCTGTTGCCCAAGCTGG - Intergenic
1103807085 12:123582104-123582126 TCTCCCTCTGTCGCCAAGGCTGG - Intergenic
1104802915 12:131566851-131566873 GCTCCCTCTGGAGCCAGAACTGG - Intergenic
1105452269 13:20510640-20510662 TCTCACTCTGTAGCCCAAGCTGG + Intronic
1105459317 13:20568747-20568769 GCACGCTCTGTTGCCCAGGCTGG + Intronic
1105470870 13:20693791-20693813 GCAACCTCTGTCGCCCAGGCTGG + Intergenic
1105501959 13:20980573-20980595 GCAGCCTCTGTTGCCAAACTTGG - Intronic
1106159731 13:27190080-27190102 TCTCCCTCTGTCGCCAAGGCTGG + Intergenic
1106550062 13:30763276-30763298 TCTCACTCTGTAGCCCAAGCTGG - Intronic
1106592797 13:31111471-31111493 CTTTCCTCTGTAGCCAAAGCTGG + Intergenic
1107224684 13:38032938-38032960 TCTCACTCTGTAGCCCAAGCTGG - Intergenic
1107274985 13:38667768-38667790 GCACCCTATGAAACCACAGCTGG - Intergenic
1107497071 13:40936922-40936944 TCTCCCTCTGTAGCCCAGGCTGG - Intronic
1107910196 13:45098533-45098555 TCTCCCTCTGTTGCCAAGGCTGG - Intergenic
1107928837 13:45289424-45289446 TCTCCCTCTGTTGCCCAAGCTGG - Intergenic
1108018976 13:46105946-46105968 TCTCACTCTGTAGCCCAAGCTGG + Intergenic
1108381626 13:49860136-49860158 TCTCCCTCTGTAGCCCAGGCTGG - Intergenic
1109076790 13:57846037-57846059 GCCACCTCTGAAGCCACAGCCGG + Intergenic
1109706614 13:66101805-66101827 TCTCCCTCTGTAGCCCAGGCTGG + Intergenic
1110044398 13:70810522-70810544 CCACCCTCTGAAGCAACAGCTGG - Intergenic
1110151588 13:72261112-72261134 TCTCCCTATGTTGCCAAAGCTGG - Intergenic
1110250694 13:73377427-73377449 GCACCCTGTGAAGCCATAGCTGG + Intergenic
1110294632 13:73849347-73849369 TCTCCCTCTGTTGCCCAAGCTGG - Intronic
1110399787 13:75076545-75076567 GCTGCCTCTGTTTCCAAAGCAGG - Intergenic
1110436358 13:75481707-75481729 GCACCCCCTGGAGCCCGAGCCGG - Exonic
1110523716 13:76511036-76511058 TCTCACTCTGTAGCCCAAGCTGG + Intergenic
1110578242 13:77085777-77085799 GCACACTATGTAACCAAAACAGG + Intronic
1112031037 13:95456725-95456747 TCTCCCTCTGTAGCACAAGCTGG - Intronic
1112051421 13:95646968-95646990 TCTCCCTCTGTTGCCCAAGCTGG - Intergenic
1112465197 13:99637726-99637748 TCACACTCTGTAGCCCAGGCTGG - Intronic
1112607634 13:100922744-100922766 GCTCTCTCTGTTGCCCAAGCTGG + Intergenic
1113234868 13:108261382-108261404 TCTCCCTCTGTAGCCCAGGCTGG + Intronic
1113450095 13:110402950-110402972 GGACCCACTGGAGCCACAGCTGG + Intronic
1113662146 13:112114922-112114944 GCTCCCTCCGTCTCCAAAGCTGG - Intergenic
1114289444 14:21275985-21276007 TCTCCCTCTGTAGCCCAGGCTGG + Intergenic
1114504043 14:23194703-23194725 TCTCACTCTGTAGCCCAAGCTGG - Intronic
1115237236 14:31219189-31219211 TCTCCCTCTGTCGCCAAGGCTGG - Intergenic
1115551105 14:34505774-34505796 TCACGCTCTGTAGCCCAGGCTGG - Intergenic
1115600581 14:34951903-34951925 TCTCCCTCTGTAGCCCATGCTGG - Intergenic
1115696706 14:35907279-35907301 TCTCCCTCTGTAGCCCAGGCTGG + Intronic
1116265032 14:42677101-42677123 TCTCCCTCTGTTGCCAAGGCTGG + Intergenic
1116382297 14:44285175-44285197 GCTCTCTCTGTGGCCCAAGCTGG - Intergenic
1116924350 14:50619080-50619102 TCTCCCTCTGTCGCCCAAGCTGG + Intronic
1118219972 14:63846623-63846645 TCTCCCTCTGTTGCCCAAGCTGG + Intergenic
1118977464 14:70690013-70690035 GCTCACTCTGTTGCCAAGGCTGG - Intergenic
1119017396 14:71073266-71073288 TCTCCCTCTGTAGCCCAGGCTGG - Intronic
1119358866 14:74031141-74031163 TCTCCCTCTGTTGCCCAAGCTGG + Intronic
1119454260 14:74740970-74740992 TCTCACTCTGTAGCCCAAGCTGG - Intergenic
1119737537 14:76993141-76993163 TCTCCCTCTGTAGCCCAGGCTGG + Intergenic
1119775127 14:77243381-77243403 ACACCCTCTGGACCCCAAGCTGG - Intronic
1119809779 14:77507358-77507380 TCTCCCTCTGTCGCCAAGGCTGG + Exonic
1120876229 14:89378735-89378757 TCACGCTCTGCAGCCCAAGCTGG + Intronic
1120961096 14:90125682-90125704 GCACTCTCAGTGGCCAAAGCTGG + Intronic
1121471156 14:94155510-94155532 GCACCCTCTGAAGCAATGGCTGG - Intronic
1121523825 14:94604527-94604549 ACTCACTCTGTAGCCCAAGCTGG - Intronic
1122326988 14:100887718-100887740 TCTCCCTCTGTTGCCCAAGCTGG - Intergenic
1122483395 14:102062334-102062356 TCACGCTCTGTAGCCCAGGCTGG + Intergenic
1122900555 14:104780603-104780625 GCAGCCCCTGTGGCCATAGCTGG - Intronic
1122923120 14:104888091-104888113 GGAGCCTCTGTTCCCAAAGCTGG + Intronic
1122927491 14:104912618-104912640 TCTCACTCTGTAGCCCAAGCTGG - Intergenic
1123466834 15:20523460-20523482 GCACTCTGGGAAGCCAAAGCGGG - Intergenic
1123651279 15:22477581-22477603 GCACTCTGGGAAGCCAAAGCGGG + Intergenic
1123669236 15:22638151-22638173 GCTCCCTCTGTAGCCCAAGCTGG - Intergenic
1123675819 15:22709779-22709801 GCACCCCCGGAAGCCAAGGCGGG - Intergenic
1123676971 15:22719727-22719749 TCTCACTCTGTAGCCCAAGCTGG + Intergenic
1123741689 15:23286424-23286446 GCACTCTGGGAAGCCAAAGCGGG + Intergenic
1123745308 15:23316134-23316156 GCACTCTGGGAAGCCAAAGCGGG - Intergenic
1123767986 15:23500799-23500821 GGGCCCTCTGGAGCCACAGCCGG - Intergenic
1123806824 15:23882121-23882143 TCTCCCTCTGTTGCCCAAGCTGG - Intergenic
1124277581 15:28339454-28339476 GCACTCTGGGAAGCCAAAGCGGG - Intergenic
1124287745 15:28418571-28418593 TCTCCCTCTGTGGCCCAAGCTGG - Intergenic
1124305119 15:28572152-28572174 GCACTCTGGGAAGCCAAAGCGGG + Intergenic
1124327815 15:28782702-28782724 GCACCCCCGGAAGCCAAGGCGGG - Intergenic
1124329187 15:28794005-28794027 TCTCACTCTGTAGCCCAAGCTGG + Intergenic
1124525209 15:30444626-30444648 GCTCCCTCTGTAGCCCAAGCTGG - Intergenic
1124773448 15:32563087-32563109 GCTGCCTCTGTAGCCCAAGCTGG + Intergenic
1125028662 15:35055122-35055144 TCACGCTCTGTTGCCCAAGCTGG + Intergenic
1125624959 15:41100856-41100878 GCTCCCTCTGTCGCCCAGGCTGG + Intronic
1125706128 15:41737948-41737970 TCTCCCTCTGTTGCCCAAGCTGG - Intronic
1126604923 15:50466563-50466585 TCTCCCTCTGTAGCCCAGGCTGG - Intronic
1127124332 15:55797393-55797415 TCACCCTCTGTCGCCCAGGCTGG - Intergenic
1127483288 15:59396830-59396852 GCTCCCTCTGTTGCCCATGCTGG + Intronic
1127785122 15:62349064-62349086 TCTCCCTCTGTTGCCAAGGCTGG + Intergenic
1127917323 15:63465768-63465790 GCACTTTGTGAAGCCAAAGCAGG + Intergenic
1127999700 15:64179214-64179236 TCTCTCTCTGTTGCCAAAGCTGG - Intronic
1128456709 15:67835298-67835320 GCGTCGTCTGTAGCCCAAGCAGG - Intergenic
1128589559 15:68882744-68882766 TCTCCCTCTGTAGCCCAGGCTGG - Intronic
1128676489 15:69612859-69612881 TCTCCCTCTGTTGCCAAGGCTGG - Intergenic
1128831393 15:70772461-70772483 GCTCCCTCTGTCGCCCAGGCTGG - Intergenic
1128940480 15:71784123-71784145 TCTCACTCTGTAGCCCAAGCTGG + Intergenic
1129292370 15:74578201-74578223 TCTCCCTCTGTAGCCCAGGCTGG + Intronic
1129436915 15:75548986-75549008 TCTCCCTCTGTAACCAAGGCTGG + Intronic
1129579785 15:76795813-76795835 GCACCCTGGGAAGCCAAGGCAGG + Intronic
1129636620 15:77325218-77325240 GCTCCCTATGTTGCCCAAGCTGG - Intronic
1130348356 15:83068573-83068595 TCTCGCTCTGTTGCCAAAGCTGG + Intergenic
1130647736 15:85743567-85743589 GCACCTTCCATAGCCAAATCAGG + Exonic
1132031438 15:98441341-98441363 TCTCCCTCTGTAGCCCAGGCTGG + Intronic
1132047054 15:98573006-98573028 TCTCCCTCTGTTGCCAAGGCTGG + Intergenic
1132212826 15:100037438-100037460 TCTCACTCTGTAGCCCAAGCTGG + Intronic
1132251833 15:100340850-100340872 GTACCCTCTATAGGCAAAGGGGG - Intronic
1132458428 16:37090-37112 GCTCCCTCTGTTGCCCAGGCTGG + Intergenic
1132489541 16:218689-218711 TCTCCCTCTGTTGCCCAAGCTGG - Intronic
1132535895 16:480352-480374 GCTCACTCTGTCGCCCAAGCTGG + Intronic
1132827122 16:1910693-1910715 TCACCCTCTGTGGCCCAGGCTGG - Intergenic
1133150758 16:3827718-3827740 GGTCTCTCTGTAGCCCAAGCTGG + Intronic
1133160478 16:3908463-3908485 CCTCACTCTGTAGCCCAAGCTGG + Intergenic
1133193518 16:4151968-4151990 TCTCCCTCTGTAGCCCAGGCTGG - Intergenic
1133488548 16:6244531-6244553 TCTCCCTCTGTAGCCCAGGCTGG + Intronic
1133489072 16:6249492-6249514 TCTCCCTCTGTCGCCCAAGCTGG - Intronic
1133552987 16:6876151-6876173 TCACCCTCTGTTGCCCAGGCTGG - Intronic
1134094461 16:11410575-11410597 GCATGCTCTGTAGACAAAGGTGG + Intronic
1134398961 16:13891000-13891022 TCTCCCTCTGTAGCCCAAGTTGG - Intergenic
1134398984 16:13891120-13891142 TCTCCTTCTGTAGCCCAAGCTGG - Intergenic
1134442906 16:14309865-14309887 GAACCCTTTGAAGCCAGAGCAGG - Intergenic
1134842896 16:17415660-17415682 TCTCACTCTGTAGCCCAAGCTGG - Intronic
1135081354 16:19438715-19438737 TCTCACTCTGTAGCCTAAGCTGG - Intronic
1135528493 16:23232350-23232372 TCTCACTCTGTAGCCCAAGCTGG + Intergenic
1135541331 16:23332575-23332597 GCACCTTGGGAAGCCAAAGCAGG - Intronic
1135678115 16:24434511-24434533 TCTCACTCTGTAGCCCAAGCTGG - Intergenic
1135755422 16:25093055-25093077 TCACTCTCTGTTGCCCAAGCTGG - Intergenic
1135803402 16:25520160-25520182 TCCCACTATGTAGCCAAAGCTGG + Intergenic
1136407909 16:30059590-30059612 GCTCCCTCTGTTGCCCAGGCTGG + Intronic
1137450607 16:48570373-48570395 TCTCACTCTGTAGCCCAAGCTGG + Intronic
1137638549 16:50008699-50008721 GCACCCTCTGAAGCAAAAGCTGG - Intergenic
1137935108 16:52627474-52627496 GCTCACTGTGTTGCCAAAGCTGG - Intergenic
1139015311 16:62683470-62683492 TCACCCTCTGTAGCCCAGGCTGG + Intergenic
1139308979 16:66012345-66012367 TCTCCCTCTGTAGCCCAGGCTGG - Intergenic
1139419525 16:66841928-66841950 TCTCACTCTGTAGCCCAAGCTGG + Intronic
1139441154 16:66967952-66967974 TCTCCCTCTGTTGCCCAAGCTGG + Intronic
1139691424 16:68644522-68644544 TCACCCTATGTTGCCCAAGCTGG - Intronic
1139771755 16:69282972-69282994 TCTCACTCTGTTGCCAAAGCTGG + Intronic
1139892342 16:70261566-70261588 TCTCGCTCTGTAGCCAAGGCTGG - Intronic
1140109267 16:71989182-71989204 TCTCCCTCTGTCGCCCAAGCTGG + Intronic
1140498570 16:75412043-75412065 TCTCACTCTGTAGCCCAAGCTGG + Intronic
1140507849 16:75485433-75485455 TCACACTCTGTTGCCCAAGCTGG - Intronic
1141183482 16:81770688-81770710 TCTCACTCTGTAGCCCAAGCAGG - Intronic
1141321565 16:83014699-83014721 TCTCCCTCTGTTGCCCAAGCTGG - Intronic
1141486818 16:84345802-84345824 TCTCCCTCTGTTGCCCAAGCTGG - Intergenic
1141598514 16:85111818-85111840 TCTCACTCTGTAGCCCAAGCTGG - Intronic
1141728136 16:85804051-85804073 GCACCCTCTACAGGCAAGGCAGG - Intronic
1142840037 17:2621653-2621675 TCACCCTCTGTTGCCCAGGCTGG + Intronic
1143098552 17:4491739-4491761 GCAGCCTCTACAGACAAAGCTGG + Intergenic
1143110423 17:4549754-4549776 TCACTCTCTGTGGCCTAAGCTGG - Intronic
1143653830 17:8281439-8281461 TCTCCCTCTGTAGCCCAGGCTGG + Intergenic
1143695504 17:8612818-8612840 TCTCCCTCTGTAGCCCAGGCTGG - Intronic
1143777818 17:9210874-9210896 TCTCACTCTGTAGCCCAAGCTGG - Intronic
1143820345 17:9556469-9556491 TCACACTCTGTTGCCCAAGCTGG + Intronic
1143959080 17:10699550-10699572 TCTCCCTCTGTCGCCCAAGCTGG + Intronic
1144541163 17:16144832-16144854 TCTCCCTCTGTTGCCGAAGCTGG + Intronic
1144558298 17:16301170-16301192 TCTCCCTCTGTTGCCCAAGCTGG + Intronic
1144621050 17:16818742-16818764 CCGCCCTCTGTACCCCAAGCAGG - Intergenic
1145045786 17:19614621-19614643 TCTCACTCTGTAGCCCAAGCTGG + Intergenic
1146042213 17:29467301-29467323 TCTCCCTCTGTAGCCCAGGCTGG + Intronic
1146060442 17:29602879-29602901 TCTCCCTCTGTCGCCCAAGCTGG + Intronic
1146082397 17:29792704-29792726 TCTCGCTCTGTAGCCCAAGCTGG + Intronic
1146199576 17:30844716-30844738 TCTCACTCTGTAGCCCAAGCTGG - Intronic
1146264328 17:31441772-31441794 GCACCTTGGGAAGCCAAAGCAGG - Intronic
1146270564 17:31482559-31482581 TCTCCCTCTGTCGCCCAAGCTGG - Intronic
1146727620 17:35169042-35169064 TCTCCCTCTGTAGCCCAGGCTGG + Intronic
1147017429 17:37503394-37503416 TCTCCCTCTGTAGCCCAGGCTGG - Intronic
1147508908 17:41048315-41048337 TCTCACTCTGTAGCCCAAGCTGG - Intergenic
1147573026 17:41583035-41583057 CCACCCTCTGTACCCCAAGCAGG - Intronic
1147598104 17:41729518-41729540 GCTCCCTCTGTAACCCAGGCTGG - Intronic
1147599269 17:41735606-41735628 GCTCGCTCTGTAGCCCCAGCTGG - Intergenic
1147719524 17:42530168-42530190 TCTCCCTCTGTCGCCCAAGCTGG - Intergenic
1147792686 17:43023154-43023176 TCTCCCTCTGTAGCCCAGGCTGG - Intronic
1147808023 17:43146336-43146358 TCTCACTCTGTGGCCAAAGCTGG + Intergenic
1147998344 17:44373933-44373955 GCTCGCTCTGTTGCCCAAGCTGG + Intronic
1148010485 17:44476232-44476254 TCTCACTCTGTAGCCCAAGCTGG + Intronic
1148146030 17:45365445-45365467 TCACCCTCTGTCGCCCAGGCTGG - Intergenic
1148269273 17:46250951-46250973 TCTCCCTCTGTTGCCAAGGCTGG + Intergenic
1148374108 17:47126821-47126843 TCTCCCTCTGTTGCCCAAGCTGG + Intronic
1148501859 17:48097585-48097607 TCTCGCTCTGTCGCCAAAGCTGG - Intronic
1148707361 17:49647278-49647300 ACTCACTCTGTAGCCCAAGCTGG - Intronic
1149826219 17:59830851-59830873 TCTCCCTCTGTAGCCCAGGCTGG + Intronic
1149985313 17:61342779-61342801 TCTCCCTCTGTAGCCCAGGCTGG + Intronic
1150679033 17:67269630-67269652 GCCCACTCTGTAGCCCAGGCTGG + Intergenic
1150704455 17:67474681-67474703 TCTCCCTCTGTTGCCAAGGCTGG + Intronic
1150710618 17:67528069-67528091 GCTCCCTCTGTAGCCCAGGCTGG + Intronic
1150762787 17:67977812-67977834 TCTCCCTCTGTCGCCCAAGCTGG - Intronic
1150895316 17:69203430-69203452 TCACCCCTAGTAGCCAAAGCCGG + Intronic
1151188377 17:72380064-72380086 GCCCCCTCAGAACCCAAAGCTGG + Intergenic
1151563198 17:74881963-74881985 GGCTCCTCTGTAGCCCAAGCTGG + Intronic
1151614578 17:75201014-75201036 TCTCCCTCTGTCGCCTAAGCTGG + Intergenic
1151644706 17:75422395-75422417 TCTCACTCTGTAGCCCAAGCTGG + Intergenic
1151794744 17:76336406-76336428 TCTCGCTCTGTAGCCCAAGCTGG - Intronic
1151798889 17:76365682-76365704 GCTCCCTCTGTCGCCCAGGCTGG - Intronic
1151849102 17:76679256-76679278 CCTCCCTCTGTTGCCCAAGCTGG - Intronic
1151907158 17:77056176-77056198 GCGCCCTCAGCAGCCCAAGCCGG + Intergenic
1152082773 17:78198777-78198799 GCTCGCTCTGTCGCCCAAGCTGG - Intronic
1152501334 17:80711770-80711792 TCTCCCTCTGTCGCCAAGGCTGG + Intronic
1153629109 18:7052399-7052421 TCTCACTCTGTAGCCCAAGCTGG - Intronic
1153850784 18:9092298-9092320 TCACCCTCTGTCGCCCAGGCTGG + Intergenic
1155288280 18:24314073-24314095 TCTCACTCTGTAGCCCAAGCTGG - Intronic
1155798083 18:30065337-30065359 GGACCCACTTGAGCCAAAGCTGG + Intergenic
1156065642 18:33140023-33140045 GCACCCTCTGAAGCCACAGCCGG - Intronic
1156266801 18:35496586-35496608 GCTCACTCTGTTGCCCAAGCTGG + Intronic
1156342344 18:36220897-36220919 TCACCCTCTGTTGCCCAAGCTGG - Intronic
1156651099 18:39228035-39228057 CCACTCTCTGAAGCCACAGCTGG - Intergenic
1157283770 18:46363284-46363306 GCTTCCTCTGCAGCCAAAGGTGG - Intronic
1157696093 18:49725009-49725031 TCTCGCTCTGTAGCCCAAGCTGG + Intergenic
1157883529 18:51344526-51344548 GCAACCTCTGGAGCCACAGTAGG + Intergenic
1158335794 18:56414168-56414190 GCACCCTCTGAATCCATGGCCGG - Intergenic
1158818016 18:61126452-61126474 TCTCACTCTGTAGCCAAAGCTGG - Intergenic
1159112462 18:64074919-64074941 TCTCCCTCTGTAGCCCAAGCTGG - Intergenic
1160207111 18:76843744-76843766 TCTCCCTCTGTAGCCCAGGCTGG - Intronic
1160286948 18:77551889-77551911 GCTCCCTCTGTTGCCCAGGCTGG + Intergenic
1160942388 19:1626556-1626578 GCACCCTGTGTGGCCACCGCGGG + Intronic
1161158216 19:2746029-2746051 TCTCCCTCTGTAGCCCAGGCTGG + Intergenic
1161373154 19:3924925-3924947 GCAGCCTCTGTGGTCAGAGCTGG + Exonic
1161445115 19:4313996-4314018 TCTCCCTCTGTTGCCCAAGCTGG - Intronic
1161722526 19:5911163-5911185 TCTCCCTCTGTCGCCCAAGCTGG - Intronic
1161743793 19:6042538-6042560 TCTCCCTCTGTAGCTCAAGCTGG + Intronic
1162162268 19:8727137-8727159 GCACCCTATGTTGCCCAGGCTGG + Intergenic
1162241715 19:9360484-9360506 TCACCCTCTGTTGCCCAGGCTGG - Intronic
1162361880 19:10225424-10225446 TCTCCCTCTGTTGCCAAGGCTGG + Intronic
1162389847 19:10382930-10382952 TCTCACTCTGTAGCCCAAGCTGG - Intergenic
1162419695 19:10559032-10559054 GCTCCCTCTGTCGCCCAGGCTGG + Intronic
1162447775 19:10734311-10734333 TCCCCCTCTGTTGCCCAAGCTGG - Intronic
1162494634 19:11016753-11016775 GCACTCCCAGTGGCCAAAGCTGG - Intronic
1162603504 19:11688900-11688922 CCTCACTCTGTAGCCCAAGCTGG - Intergenic
1162648500 19:12067168-12067190 TCTCACTCTGTAGCCCAAGCTGG - Intronic
1162680616 19:12338070-12338092 TCTCACTCTGTTGCCAAAGCTGG - Intergenic
1163281440 19:16320474-16320496 TCTCCCTCTGTAGCCCAGGCTGG - Intergenic
1163354894 19:16803893-16803915 TCTCACTCTGTTGCCAAAGCTGG - Intronic
1163450493 19:17374129-17374151 TCTCCCTCTGTTGCCAAGGCTGG - Intronic
1163474688 19:17518558-17518580 TCTCCCTCTGTCGCCAAGGCTGG + Intronic
1163502039 19:17681980-17682002 TCTCACTCTGTAGCCCAAGCTGG + Intronic
1163753894 19:19095169-19095191 TCTCCCTCTGTAGCCCAGGCTGG - Intronic
1164399023 19:27890198-27890220 GCACCCTCTGGAGACAGAACAGG - Intergenic
1165053520 19:33158727-33158749 GCTCCCTCTGTTGCCCAGGCTGG + Intronic
1165442174 19:35835327-35835349 TCTCCCTCTGTTGCCAAGGCTGG + Intronic
1165530773 19:36398713-36398735 TCACCCTCTGTCACCACAGCTGG + Intronic
1165617536 19:37215120-37215142 TCTCCCTCTGTTGCCCAAGCTGG - Intronic
1165684861 19:37811266-37811288 TCTCACTCTGTAGCCCAAGCTGG + Intronic
1165907316 19:39202045-39202067 GCTCCCTCTGTTGCCCAGGCTGG + Intergenic
1166081905 19:40449046-40449068 TCTCCCTCTGTAGCCCAGGCTGG - Intronic
1166165527 19:40985117-40985139 TCTCCCTCTGTAGCCTAGGCTGG - Intergenic
1166627699 19:44374250-44374272 TCTCCCTCTGTAGCCTAGGCTGG - Intronic
1166732240 19:45065529-45065551 TCTCACTCTGTAGCCCAAGCTGG - Intronic
1166835574 19:45665794-45665816 TCTCCCTCTGTAGCCCAGGCTGG - Intergenic
1166839778 19:45690005-45690027 TCTCACTCTGTAGCCCAAGCTGG - Intronic
1167026593 19:46923889-46923911 TCTCCCTCTGTTGCCCAAGCTGG - Intronic
1167151913 19:47715006-47715028 TCTCACTCTGTAGCCCAAGCTGG - Intronic
1167368757 19:49068340-49068362 GCTCCCTCTGTTGCCCAGGCTGG + Exonic
1167572031 19:50294462-50294484 TCTCCCTCTGTTGCCCAAGCTGG + Intronic
1167610159 19:50503542-50503564 TCTTCCTCTGTTGCCAAAGCTGG + Intergenic
1167800573 19:51738625-51738647 TCTCCCTCTGTAGCCCAGGCTGG + Intergenic
1168214406 19:54914767-54914789 TCTCACTCTGTAGCCCAAGCTGG + Intronic
1168650755 19:58090617-58090639 TCACCCTCTGTCACCCAAGCTGG + Intronic
925517873 2:4704736-4704758 TATCCCTCTGTAGCCCAAGCTGG - Intergenic
925529833 2:4846896-4846918 TCTCACTCTGTAGCCAAGGCTGG - Intergenic
926117937 2:10225063-10225085 GCTCCCTCTGTTGCCCAGGCTGG + Intergenic
926564259 2:14452594-14452616 GGACCCTCTGTAGCCACAGCTGG + Intergenic
926640923 2:15236058-15236080 GCACCTTATATAGCAAAAGCTGG - Intronic
926665425 2:15516691-15516713 TCTCACTCTGTAGCCCAAGCTGG - Intronic
926763583 2:16302712-16302734 GCACCCTGTGTAGCCCCAGAAGG - Intergenic
927545859 2:23952291-23952313 TCTCCCTCTGTTGCCCAAGCTGG + Intronic
927705407 2:25293699-25293721 TCTCCCTCTGTAGCCCAGGCTGG + Intronic
928009652 2:27595097-27595119 TCTCCCTCTGTTGCCAAGGCTGG - Intronic
929448099 2:42016063-42016085 TCTCCCTCTGTTGCCAAGGCAGG + Intergenic
929716639 2:44317430-44317452 TCTCCCTCTGTTGCCCAAGCTGG - Intronic
930333551 2:50017027-50017049 ACATCCTCTGTCTCCAAAGCTGG - Intronic
930493827 2:52111869-52111891 GCACTTTCTGAGGCCAAAGCAGG + Intergenic
930508828 2:52318660-52318682 TCTCCCTCTGTTGCCCAAGCCGG + Intergenic
930666268 2:54101642-54101664 TCTCCCTCTGTAACCCAAGCTGG - Intronic
931277078 2:60753527-60753549 TCTCCCTCTGTTGCCCAAGCTGG - Intergenic
931342411 2:61414216-61414238 TCTCCCTCTGTAGCCCAGGCTGG - Intronic
932038152 2:68269715-68269737 GCTCCCTCTGTCGCCTAGGCTGG + Intergenic
932116207 2:69050267-69050289 GCACACTCTGTTGCCCAGGCTGG - Intronic
932223312 2:70018103-70018125 TCTCACTCTGTAGCCCAAGCTGG - Intergenic
932245448 2:70192803-70192825 TCTCCCTCTGTTGCCCAAGCTGG + Intronic
932560392 2:72862738-72862760 GCACCCTCAGCATCCTAAGCCGG - Intergenic
932674826 2:73770483-73770505 TCTCACTCTGTCGCCAAAGCTGG - Intronic
933228470 2:79778313-79778335 TCTCACTCTGTAGCCCAAGCTGG - Intronic
933581623 2:84133431-84133453 TCTCACTCTGTAGCCCAAGCTGG + Intergenic
933715305 2:85355401-85355423 GCACCCTCTTTAGGCAAGGAGGG - Intronic
933732094 2:85464814-85464836 TCTCCCTCTGTAGCCCAGGCTGG + Intergenic
933755818 2:85637723-85637745 TCTCCCTCTGTCGCCAAGGCTGG + Intronic
933806619 2:86002985-86003007 GCACCCTCTGTATGCAGAGATGG + Intergenic
934034779 2:88079789-88079811 TCACACTCTGTAGCCCAGGCTGG - Intronic
934671358 2:96215232-96215254 TCTCCCTCTGTAGCCCAGGCTGG - Intergenic
934891014 2:98069339-98069361 TCTCCCTCTGTAGCCCAGGCTGG + Intergenic
935040184 2:99419239-99419261 GCTCACTCTGTTGCCCAAGCTGG + Intronic
935197284 2:100824910-100824932 GAACCCCCTGGAGCCAAGGCAGG + Intronic
935240065 2:101170521-101170543 GCACCCTCTGAAGCCACAGGCGG - Intronic
935483092 2:103617480-103617502 TCTCCCTCTGTTGCCAAGGCTGG + Intergenic
935642281 2:105302194-105302216 ACATCCTCTGTTGGCAAAGCTGG + Intronic
935744902 2:106181684-106181706 TCTCACTCTGTAGCCCAAGCTGG - Intronic
936499569 2:113055285-113055307 TTGCCCTCTTTAGCCAAAGCTGG + Intergenic
936974806 2:118208171-118208193 GCCACCTATGTAGACAAAGCAGG + Intergenic
937198374 2:120180291-120180313 GAACCCTCTGCAGCCCAGGCTGG + Intergenic
937350233 2:121155881-121155903 GCAGCCTCTGTCATCAAAGCTGG + Intergenic
937400107 2:121574911-121574933 TCTCCCTCTGTAGCCCAAGTTGG - Intronic
937479427 2:122243282-122243304 TCTCGCTCTGTAGCCCAAGCTGG + Intergenic
937979223 2:127604101-127604123 GCTCCCTCTGTCGCCCAGGCTGG - Intronic
938336719 2:130507232-130507254 TCTCACTCTGTAGCCCAAGCTGG - Intronic
938353103 2:130613429-130613451 TCTCACTCTGTAGCCCAAGCTGG + Intronic
938752604 2:134347877-134347899 GCACTCTGTGCAGGCAAAGCAGG - Intronic
938867893 2:135443084-135443106 TCTCCCTCTGTAGCCTAGGCTGG - Intronic
939115679 2:138057597-138057619 TCACCCTCTGTGGCCCATGCTGG + Intergenic
939670787 2:145009119-145009141 TCTCACTCTGTAGCCCAAGCTGG - Intergenic
939990151 2:148870551-148870573 TCTCCCTCTGTAGCCCAGGCCGG + Intergenic
940360934 2:152795000-152795022 CCTCCCTCTGTCGCCAAGGCTGG + Intergenic
940504872 2:154540367-154540389 TCTCACTCTGTAGCCCAAGCTGG - Intergenic
940998711 2:160178719-160178741 TCTCCCTCTGTAGCCCAGGCTGG + Intronic
942655585 2:178211238-178211260 TCTCACTCTGTAGCCCAAGCTGG - Intronic
942907417 2:181200405-181200427 TCTCCCTCTGTTGCCCAAGCTGG - Intergenic
943315421 2:186381711-186381733 TCTCCCTCTGTCGCCCAAGCGGG + Intergenic
943418691 2:187638109-187638131 TCTCCCTCTGTTGCCAAGGCTGG - Intergenic
943592985 2:189821425-189821447 TCTCCCTCTGTAGCCCAGGCTGG - Intronic
944233152 2:197416011-197416033 TCTCCCTCTGTTGCCCAAGCTGG + Intronic
944242160 2:197497187-197497209 GCACGCTCTATAGCCAAGGAAGG - Exonic
944389875 2:199206880-199206902 GCAGCCTGTCTAGCAAAAGCAGG + Intergenic
944788611 2:203100574-203100596 TCTCCCTCTGTCGCCCAAGCTGG + Intronic
944964159 2:204910667-204910689 TCTCCCTCTGTAGCCTAGGCTGG + Intronic
945296481 2:208176203-208176225 TCTCCCTCTGTTGCCCAAGCTGG + Intronic
945330755 2:208536761-208536783 GCACCCTCTGAAGCCATGGCTGG + Intronic
945966971 2:216198583-216198605 TCTCCCTCTGTTGCCCAAGCTGG + Intronic
946207945 2:218124362-218124384 GCACCGGTTGTAGCTAAAGCAGG + Intergenic
946247381 2:218395494-218395516 TCTCCCTCTGTTGCCAAGGCTGG + Exonic
946357384 2:219196641-219196663 TCTCCCTCTGTAGCCCAGGCTGG + Intronic
946722676 2:222627004-222627026 TCTCCCTCTGTCGCCAAGGCTGG - Intronic
946914939 2:224509241-224509263 TCTCCCTCTGTAGCCCAGGCTGG + Intronic
947181503 2:227415384-227415406 TCACACTCTGTAGCCCAGGCTGG - Intergenic
947424297 2:229969243-229969265 TCACCCTCTGTTGCCCAGGCTGG + Intronic
947426368 2:229986562-229986584 TCTCCCTCTGTAGCCTAGGCTGG + Intronic
947599764 2:231439318-231439340 TCTCCCTCTGTTGCCAAGGCTGG - Intergenic
948016765 2:234697410-234697432 GTACCCTCTGAAGCCACAGCTGG + Intergenic
1168895790 20:1322599-1322621 TCTCACTCTGTTGCCAAAGCTGG + Intronic
1169413139 20:5391780-5391802 TCTCACTCTGTTGCCAAAGCTGG - Intergenic
1169933399 20:10857821-10857843 TCTCCCTCTGTAGCCCAGGCTGG + Intergenic
1170183574 20:13561393-13561415 TCTCCCTCTGTCGCCCAAGCTGG + Intronic
1170188667 20:13621399-13621421 TCTCACTCTGTAGCCCAAGCTGG - Intronic
1170710615 20:18787154-18787176 GCACCCTCTGAAGCCATGGCTGG + Intergenic
1171301913 20:24070004-24070026 TCTCCCTCTGTCACCAAAGCTGG + Intergenic
1171383466 20:24751251-24751273 GCACCTTGGGAAGCCAAAGCGGG + Intergenic
1171992805 20:31709389-31709411 TCTCCCTCTGTCGCCCAAGCTGG + Intronic
1172032939 20:31994464-31994486 GCACCCTGGGAGGCCAAAGCAGG + Intronic
1172050334 20:32112368-32112390 TCTCGCTCTGTTGCCAAAGCTGG - Intronic
1172145294 20:32753330-32753352 TCTCACTCTGTAGCCCAAGCTGG - Intergenic
1172377812 20:34459704-34459726 TCACACTCTGTCGCCCAAGCTGG - Intronic
1173325013 20:42025352-42025374 TCTCCCTCTGTCGCCCAAGCTGG + Intergenic
1173607173 20:44339806-44339828 TCTCCCTCTGTTGCCCAAGCTGG + Intronic
1174299133 20:49568927-49568949 GCACTATCTGTCCCCAAAGCAGG - Intergenic
1174311725 20:49661263-49661285 TCTCCCTCTGTCGCCCAAGCTGG + Intronic
1174475085 20:50790789-50790811 GCTCCCTCTGGTGCCCAAGCCGG - Intergenic
1174822788 20:53741996-53742018 TCTCCCTCTGTAGCCCAGGCCGG + Intergenic
1176055178 20:63141445-63141467 GCACCCTCTGCAACCCCAGCTGG - Intergenic
1176289205 21:5035319-5035341 GCAGCCCCTGTAGCCAAACACGG - Intronic
1177297824 21:19200088-19200110 GCTCCCTCTGTCGCCCAGGCTGG - Intergenic
1177303930 21:19288000-19288022 TCTCCCTCTGTAGCCCAAGCTGG - Intergenic
1177322695 21:19543559-19543581 TCTCACTCTGTAGCCTAAGCTGG + Intergenic
1177327246 21:19607001-19607023 GCAGCCTCTGGAGCCAGAGTAGG + Intergenic
1177367388 21:20155242-20155264 GCACCTGCTTTAGCCACAGCAGG + Intergenic
1177677137 21:24315313-24315335 TCTCCCTCTGTAGCCCAGGCTGG - Intergenic
1178858968 21:36273375-36273397 GCACCCTCTGTTGCCCAGACTGG - Intronic
1178866047 21:36328379-36328401 GCTCCCTCTGTCGCCCAGGCTGG + Intronic
1178963337 21:37089541-37089563 TCACCCTCTGTCGCCCATGCTGG + Intronic
1179833660 21:44013498-44013520 GCACTCTCTGTTGCAAAATCTGG + Intronic
1179868030 21:44228285-44228307 GCAGCCCCTGTAGCCAAACACGG + Intronic
1180428966 22:15227585-15227607 TCTCCCTCTGTTGCCCAAGCTGG - Intergenic
1180511582 22:16095947-16095969 TCTCCCTCTGTAGCCCAGGCTGG - Intergenic
1180647520 22:17351854-17351876 TCTCACTCTGTAGCCCAAGCTGG + Intergenic
1180928510 22:19573028-19573050 TCTCACTCTGTAGCCCAAGCTGG + Intergenic
1181296821 22:21847038-21847060 TCTCCCTCTGTTGCCGAAGCTGG + Intronic
1181334922 22:22122168-22122190 TCTCACTCTGTCGCCAAAGCTGG + Intergenic
1181482492 22:23209328-23209350 TCTCACTCTGTAGCCCAAGCTGG - Intronic
1181810024 22:25398352-25398374 GTGCCCTCTGTCGCCCAAGCTGG - Intronic
1182339684 22:29609320-29609342 GCGACCTCTATAGCCAAAGATGG - Intronic
1182541775 22:31047064-31047086 TCTCCCTCTGTCGCCCAAGCTGG + Intergenic
1182617934 22:31601151-31601173 GCAACCTCTGTGGCCCAGGCTGG + Intronic
1183891739 22:40935345-40935367 TCCCCCTCTGTAGCCCAGGCTGG - Intergenic
1183971194 22:41478794-41478816 TCTCACTCTGTAGCCCAAGCTGG + Intronic
1184203454 22:42985303-42985325 TCTCGCTCTGTCGCCAAAGCTGG - Intronic
1184808508 22:46812325-46812347 GCACCCCCTGTGGGCACAGCAGG + Intronic
1185354228 22:50356902-50356924 TCTCCCTCTGTCGCCCAAGCTGG - Intronic
950179046 3:10898021-10898043 GCACCCTCTGAAGCCATGGCCGG + Intronic
950383014 3:12633451-12633473 TCTCCCTCTGTTGCCCAAGCTGG - Intronic
950393326 3:12714119-12714141 CCGCACTCTGTAGCCCAAGCTGG + Intergenic
950595350 3:13975753-13975775 GAACCCACTGTGGCTAAAGCAGG + Intronic
950760685 3:15221922-15221944 TCTCCCTCTGTTGCCCAAGCTGG - Intronic
952303342 3:32124093-32124115 TCTTCCTCTGTAGCCCAAGCTGG + Intronic
952372322 3:32735313-32735335 TCTCACTCTGTCGCCAAAGCTGG - Intronic
952429893 3:33213159-33213181 GCACTCTGGGAAGCCAAAGCAGG + Intronic
952948595 3:38498523-38498545 TCTCCCTCTGTTGCCTAAGCTGG - Intronic
953014847 3:39063919-39063941 TCTCCCTCTGTTGCCCAAGCTGG - Intronic
953112181 3:39953694-39953716 GCAGCCCATGAAGCCAAAGCAGG + Intronic
953166101 3:40466159-40466181 TCTCCCTCTGTCGCCCAAGCTGG - Intergenic
953272107 3:41455799-41455821 TCAGCCTCTGTAGCCTGAGCTGG - Intronic
953870410 3:46621519-46621541 GCACCCTGGGAAGCCAAGGCAGG + Intronic
953871751 3:46633048-46633070 CCACTCTCTGCAGCCAAGGCTGG - Intergenic
954042625 3:47900704-47900726 TCTCCCTCTGTAGCCCAGGCTGG - Intronic
954141988 3:48612242-48612264 TCTCCCTCTGTAGCCCAGGCTGG - Intergenic
954244274 3:49318345-49318367 ACACCATCTGTAGGCAAAGGTGG + Intronic
954511619 3:51130735-51130757 TCCCTCTCTGTAGCCCAAGCTGG + Intronic
954911169 3:54111365-54111387 TCTCACTCTGTAGCCCAAGCTGG + Intergenic
954917398 3:54160468-54160490 TCACCCTCTGTTGCCCAGGCTGG - Intronic
955307690 3:57850661-57850683 TCTCACTCTGTAGCCCAAGCTGG + Intronic
956080467 3:65550767-65550789 TCTCCCTCTGTTGTCAAAGCTGG - Intronic
956260278 3:67331694-67331716 TCTCACTCTGTAGCCCAAGCTGG - Intergenic
956330392 3:68100442-68100464 ACACCCTCTGTTGCCCAGGCTGG - Intronic
956337477 3:68180284-68180306 GCACTCTGAGTGGCCAAAGCAGG - Intronic
956956495 3:74347434-74347456 CCTCCCTCTGTTGCCCAAGCTGG + Intronic
957726981 3:84079377-84079399 TCACCCTCTGTTGCCCAGGCTGG - Intergenic
958650084 3:96927151-96927173 GCACCCACTGAAGCAACAGCCGG + Intronic
958879203 3:99650462-99650484 TCTCACTCTGTAGCCCAAGCTGG + Intronic
959057069 3:101577552-101577574 TCACGCTCTGTCGCCCAAGCTGG + Intronic
959079714 3:101787121-101787143 TCTCCCTCTGTAGCCCAAGCTGG - Intronic
959879658 3:111429079-111429101 GCACCCTCTGTAGCCAAAGCTGG - Intronic
960180740 3:114573427-114573449 TCTCACTCTGTAGCCCAAGCTGG - Intronic
960683474 3:120273669-120273691 TCTCCCTCGGTAGCCCAAGCTGG + Intronic
960819619 3:121715231-121715253 TCTCCCTCTGTTGCCTAAGCTGG + Intronic
961607697 3:128109409-128109431 TCTCACTCTGTAGCCCAAGCTGG + Intronic
961693826 3:128690015-128690037 TCTCACTCTGTAGCCCAAGCTGG - Intergenic
961844305 3:129748320-129748342 TCTCGCTCTGTAGCCAAGGCTGG + Intronic
962460999 3:135612643-135612665 GCATCCTCTGAAGCCATGGCTGG - Intergenic
962761671 3:138520847-138520869 TCTCCCTCTGTTGCCAAGGCTGG + Intronic
962801541 3:138895110-138895132 TCTCCCTCTGTAGCCCAGGCTGG + Intergenic
963011683 3:140775979-140776001 ACACCCTCTGAAGCCACAGCTGG + Intergenic
963017003 3:140834197-140834219 GCTCCCTCTGTCACCCAAGCTGG + Intergenic
963162642 3:142167342-142167364 TCTCACTCTGTAGCCCAAGCTGG - Intronic
964776136 3:160279890-160279912 TCACACTCTGTTGCCAAAGCTGG - Intronic
965541275 3:169873573-169873595 TCTCACTCTGTAGCCCAAGCTGG - Intergenic
966608866 3:181848632-181848654 TCTCACTCTGTTGCCAAAGCTGG + Intergenic
966842767 3:184102893-184102915 TCTCACTCTGTAGCCTAAGCTGG - Intronic
967341510 3:188404272-188404294 TCTCCCTCTGTTGCCCAAGCTGG + Intronic
967698491 3:192564091-192564113 TCTCCCTCTGTAGCCCAGGCTGG + Intronic
967743287 3:193026928-193026950 TCTCCCTCTGTAGCCCAGGCTGG + Intergenic
968390284 4:187254-187276 TCTCGCTCTGTAGCCCAAGCTGG + Intergenic
968420648 4:481596-481618 TCTCCCTCTGTCGCCAAGGCTGG + Intronic
968857897 4:3141731-3141753 TCTCACTCTGTAGCCCAAGCTGG - Intronic
970218068 4:13779828-13779850 CCACCCTCTGAAGCCACAGCCGG + Intergenic
971162540 4:24147912-24147934 TCTCACTCTGTAGCCCAAGCTGG - Intergenic
971423919 4:26498102-26498124 GCTCCCTCTGTTCCCCAAGCTGG + Intergenic
971499251 4:27300746-27300768 GCACCCTCTGAAGCTATGGCTGG + Intergenic
971783835 4:31074753-31074775 TCTCCCTCTGTAGCCCAGGCTGG - Intronic
972487387 4:39555260-39555282 TCTCACTCTGTAGCCCAAGCTGG + Intronic
972683636 4:41330641-41330663 TCTCACTCTGTAGCCCAAGCTGG + Intergenic
972866698 4:43241962-43241984 TCTCCCTGTGTTGCCAAAGCTGG - Intergenic
973756612 4:54080724-54080746 TCTCACTCTGTAGCCCAAGCTGG - Intronic
974508118 4:62803941-62803963 TCACTCTCTGTTGCCAAGGCTGG + Intergenic
974597719 4:64036684-64036706 TCTCCCTCTGTTGCCAAGGCTGG + Intergenic
974628482 4:64453760-64453782 GCACCCTCTGAAGCGATGGCTGG + Intergenic
974641979 4:64642670-64642692 TCTCCCTCTGTAGCCCAGGCTGG - Intergenic
974962819 4:68724892-68724914 CCTCACTCTGTAGCCCAAGCTGG + Intergenic
975132775 4:70845305-70845327 TCTCACTCTGTAGCCCAAGCTGG + Intergenic
975680886 4:76874646-76874668 TCTCCCTCTGTTGCCCAAGCTGG - Intergenic
976302085 4:83524989-83525011 TCTCCCTCTGTCGCCCAAGCTGG + Intergenic
976628887 4:87217590-87217612 GCACTTTCAGAAGCCAAAGCAGG - Intronic
976867658 4:89750102-89750124 TCTCCCTCTGTAGCCCAGGCTGG + Intronic
976901253 4:90179420-90179442 TCACTCTCTGTAGCCTAGGCTGG + Intronic
977075655 4:92445972-92445994 TCTCCCTCTGTAGCCCAGGCTGG + Intronic
977276623 4:94985175-94985197 GAACCCTCTGTTGCCAGAGGAGG + Intronic
977520514 4:98077271-98077293 TCCCCCTCTGTCGCCCAAGCTGG + Intronic
977958550 4:103058425-103058447 TCTCCCTCTGTAGCCCAGGCTGG + Intronic
978157093 4:105501177-105501199 TCTCCCTCTGTTGCCAAGGCTGG - Intergenic
978297636 4:107225838-107225860 TCTCACTCTGTAGCCCAAGCTGG + Intronic
979195410 4:117915502-117915524 GAACCAACTGTAGCTAAAGCAGG + Intergenic
979482727 4:121238020-121238042 TCTCCCTCTGTTGCCAAGGCTGG + Intergenic
979793355 4:124814359-124814381 GCTCACTCTGTTGCCAAGGCTGG + Intergenic
979862044 4:125706621-125706643 TCTCGCTCTGTAGCCCAAGCGGG - Intergenic
980796923 4:137697382-137697404 GCTCGCTCTGTTGCCCAAGCTGG + Intergenic
981933051 4:150210607-150210629 GCTCGCTCTGTTGCCCAAGCTGG - Intronic
982584889 4:157223043-157223065 CCAAGCTCTGTAGCCAAAGTGGG - Intronic
982659403 4:158189040-158189062 TCTCGCTCTGTAGCCAAGGCTGG - Intergenic
982741071 4:159057892-159057914 GCTCACTCTGTAGCCCAGGCTGG + Intergenic
982886375 4:160787878-160787900 GCACCTTCTGAAGCCATGGCTGG - Intergenic
983191207 4:164755448-164755470 TCTCCCTCTGTAGCCCAGGCTGG - Intergenic
983613908 4:169679847-169679869 TCTCCCTCTGTTGCCAAGGCTGG - Intronic
983643590 4:169967181-169967203 TCTCACTCTGTAGCCCAAGCTGG + Intergenic
983829988 4:172314635-172314657 TCTCCCTCTGTAGCCCAGGCTGG + Intronic
984073050 4:175140508-175140530 TCTCCCTCTGTAGCCCAGGCTGG + Intergenic
984302432 4:177939583-177939605 TCTCGCTCTGTAGCCCAAGCTGG + Intronic
986296537 5:6443986-6444008 GCTCTGTCTGGAGCCAAAGCTGG + Intergenic
986678792 5:10214765-10214787 TCTCCCTCTGTTGCCCAAGCTGG - Intergenic
986709019 5:10474120-10474142 TCTCACTCTGTAGCCCAAGCTGG - Intergenic
987386129 5:17331191-17331213 TCTCCCTCTGTAGCCCAGGCTGG - Intergenic
987728592 5:21737093-21737115 TCTCCCTCTGTTGCCCAAGCTGG + Intergenic
987833730 5:23133983-23134005 TCTCACTCTGTAGCCCAAGCTGG - Intergenic
988573587 5:32396712-32396734 TCTCGCTCTGTAGCCAAGGCTGG - Intronic
989225773 5:39026312-39026334 GCACTGTCTGTTGCCCAAGCTGG - Intronic
989276868 5:39599281-39599303 GCTCCCACTGTAGCCAAGGCAGG - Intergenic
989980331 5:50635674-50635696 TCTCCCTCTGTTGCCAAGGCTGG - Intergenic
990203532 5:53404747-53404769 TCTCACTCTGTAGCCAAGGCTGG + Intergenic
990378328 5:55195922-55195944 TCTCCCTCTGTTGCCAAGGCTGG + Intergenic
990929487 5:61072624-61072646 TCTCACTCTGTAGCCCAAGCTGG + Intronic
991314718 5:65288342-65288364 TCTCCCTCTGTAGCCCAGGCTGG + Intronic
991593518 5:68278911-68278933 TCTCACTCTGTAGCCAAGGCTGG - Intronic
992248298 5:74851361-74851383 CCACCCTGGGGAGCCAAAGCAGG + Intronic
992471006 5:77053487-77053509 TCTCACTCTGTAGCCCAAGCTGG - Intronic
992474890 5:77091906-77091928 GCACCATCTTAAGCCTAAGCAGG + Intergenic
992534515 5:77685277-77685299 TCTCCCTCTGTAGCCCAGGCTGG - Intergenic
992540598 5:77760450-77760472 TCTCCCTCTGTTGCCAAGGCTGG + Intronic
992809592 5:80373512-80373534 TCTCACTCTGTAGCCCAAGCTGG + Intergenic
993208787 5:84921346-84921368 GCACCTTCTGAAGCCACAGATGG - Intergenic
993262694 5:85680281-85680303 GCACCCTGTGAGGCCAAGGCAGG - Intergenic
993273754 5:85830109-85830131 TCTCACTCTGTAGCCCAAGCTGG + Intergenic
993552874 5:89296467-89296489 TCTCACTCTGTAGCCCAAGCTGG - Intergenic
993766412 5:91864035-91864057 TCACACTCTGTTGCCCAAGCTGG - Intergenic
993966979 5:94370878-94370900 TCTCCCTCTGTCGCCCAAGCTGG - Intronic
994159539 5:96541257-96541279 GAACTCTTAGTAGCCAAAGCTGG - Intronic
994695551 5:103069245-103069267 CCACCCTCTGTAGACAGACCAGG - Intergenic
995021566 5:107372596-107372618 TCTCACTCTGTTGCCAAAGCTGG - Intergenic
995244630 5:109922066-109922088 GCACCCTCTGCTTCCAAAGAGGG - Intergenic
995690975 5:114825423-114825445 GCTTCAGCTGTAGCCAAAGCAGG - Intergenic
995706681 5:114994623-114994645 TCACCTGCTGTAGGCAAAGCTGG - Intergenic
996305553 5:122043243-122043265 TCTCCCTCTGTCGCCCAAGCTGG + Intronic
996988619 5:129600897-129600919 TCTCCCTCTGTAGCCCAGGCTGG + Intronic
997546700 5:134714010-134714032 CCTCCCTCTGTCGCCAAGGCTGG - Intronic
999447252 5:151649868-151649890 CCTCCCTCTGTTGCCCAAGCTGG + Intergenic
1000170961 5:158702712-158702734 TCTCCCTCTGTAGCCCAGGCTGG - Intronic
1000320761 5:160132729-160132751 TCTCACTCTGTAGCCAAGGCTGG - Intergenic
1000866861 5:166524638-166524660 TCTCACTCTGTAGCCCAAGCTGG - Intergenic
1001037290 5:168306364-168306386 TCTCGCTCTGTAGCCCAAGCTGG - Intronic
1001066187 5:168536703-168536725 TCTCACTCTGTAGCCCAAGCTGG - Intergenic
1001087686 5:168713075-168713097 CCTCCCTCTGTCACCAAAGCTGG - Intronic
1001175191 5:169461965-169461987 CCTCACTCTGTAGCCCAAGCTGG - Intergenic
1002143263 5:177158366-177158388 TCTCCCTCTGTAGCCCAGGCTGG + Intronic
1002445154 5:179286182-179286204 TCTCACTCTGTAGCCCAAGCTGG - Intronic
1003174527 6:3745156-3745178 GCTCCCTCTTTAGCCAGGGCAGG + Intronic
1003303939 6:4909597-4909619 TCTCCCTCTGTTGCCCAAGCTGG + Intronic
1003945380 6:11070664-11070686 TCTCCCTCTGTTGCCCAAGCTGG - Intergenic
1004237614 6:13888427-13888449 TCTCACTCTGTAGCCCAAGCTGG + Intergenic
1004664964 6:17741264-17741286 TCTCACTCTGTAGCCCAAGCTGG + Intergenic
1005036569 6:21560757-21560779 TCACACTCTGTAGCCCAGGCTGG + Intergenic
1005315555 6:24599659-24599681 GCACCCGCCAGAGCCAAAGCTGG - Intronic
1005492550 6:26360247-26360269 GCTCACTCTGTAGCCCAGGCTGG + Intergenic
1005591646 6:27334838-27334860 TCTCACTCTGTAGCCCAAGCTGG - Intergenic
1005841469 6:29747397-29747419 CCTCCCTCTGTCGCCAAAGTTGG - Intergenic
1006103969 6:31704960-31704982 GCACTCTGTGAGGCCAAAGCAGG - Intronic
1006648739 6:35533923-35533945 TCATCCTCTGTTGCCAAGGCTGG - Intergenic
1006780176 6:36627266-36627288 GCACCTTCGGAAGCCAAGGCAGG - Intergenic
1007518669 6:42433991-42434013 GCTCACTCTGTTGCCTAAGCTGG - Intronic
1007577659 6:42936563-42936585 TCACACTCTGTTGCCCAAGCTGG + Intronic
1007592673 6:43032297-43032319 TCTCCCTCTGTCGCCCAAGCTGG + Intronic
1007675205 6:43588001-43588023 TCTCCCTCTGTAGCCTAGGCTGG - Intronic
1009763000 6:68032145-68032167 GCTCACTCTGTAGCCCAGGCTGG - Intergenic
1010252371 6:73721392-73721414 TCTCCCTCTGTAGCCCAGGCTGG + Intronic
1010583664 6:77630489-77630511 TCTCCCTCTGTCGCCCAAGCTGG + Intergenic
1010816088 6:80359622-80359644 TCTCCCTCTGTCGCCAAGGCTGG + Intergenic
1011280467 6:85672088-85672110 GCTCACTGTGTAGCCCAAGCTGG - Intergenic
1011421906 6:87181709-87181731 TCTCCCTCTGTAGCCTAGGCTGG + Intronic
1011425644 6:87226707-87226729 TCTCCCTCTGTCGCCCAAGCTGG + Intronic
1011445771 6:87437683-87437705 GCTCACTCTGTAGCCCAGGCTGG + Intronic
1011455138 6:87540546-87540568 GCACCCTCTGTGGCTTAAGCTGG + Intronic
1011677250 6:89746562-89746584 TCTCCCTCTGTAGCCCAGGCTGG - Intronic
1011918989 6:92547586-92547608 GCACACTCTGAAGCCATAGCAGG - Intergenic
1012441298 6:99264568-99264590 TGACCCGCTGTAGGCAAAGCTGG + Intergenic
1012494185 6:99816223-99816245 TCTCACTCTGTAGCCAAGGCTGG + Intergenic
1012696604 6:102391828-102391850 ACACCCACTGTAGACACAGCTGG + Intergenic
1013263714 6:108472831-108472853 TCTCCCTCTGTAGCCCAGGCTGG + Intronic
1013478945 6:110535827-110535849 ACTCCCTCTGTAGCCTAGGCTGG - Intergenic
1013558783 6:111283747-111283769 TCACCCTCTGAAGCCATGGCTGG + Intergenic
1013639152 6:112056544-112056566 TCACCCTCTGTTGCCTAGGCTGG + Intronic
1013947220 6:115735877-115735899 GCACACTCTGAAGCCATGGCCGG - Intergenic
1014444167 6:121506946-121506968 GTACCCTATGTAGAGAAAGCTGG - Intergenic
1014652483 6:124057136-124057158 GCACCCTTTATAGCTAAATCAGG + Intronic
1014665340 6:124230663-124230685 CCACCCTCTGAAGCAACAGCTGG - Intronic
1015391926 6:132691972-132691994 TCTCACTCTGTAGCCCAAGCTGG - Intronic
1015635848 6:135273407-135273429 TCACCCTCTGTTGCCCAGGCTGG + Intergenic
1016651465 6:146466191-146466213 TCTCCCTCTGTAGCCCAGGCTGG + Intergenic
1016732806 6:147444608-147444630 GAACCCTCCATAGCCCAAGCGGG + Intergenic
1016808123 6:148233697-148233719 GCTCCCTGTGTTGCCTAAGCTGG - Intergenic
1017024436 6:150168904-150168926 TCTCACTCTGTAGCCCAAGCTGG + Intronic
1017316148 6:153033686-153033708 TCTCACTCTGTAGCCCAAGCTGG - Intronic
1017451701 6:154560205-154560227 TCTCCCTCTGTTGCCCAAGCTGG + Intergenic
1017533931 6:155326741-155326763 TCTCCCTCTGTCGCCCAAGCTGG + Intergenic
1017625521 6:156343567-156343589 TCTCACTCTGTAGCCCAAGCTGG - Intergenic
1017663173 6:156693886-156693908 TCTCACTCTGTAGCCCAAGCTGG + Intergenic
1017699320 6:157053113-157053135 TCTCACTCTGTAGCCCAAGCTGG + Intronic
1017776812 6:157687213-157687235 TCTCCCTCTGTCGCCAAGGCTGG - Intergenic
1017786701 6:157762679-157762701 GCATCCTCCCTAGCCACAGCGGG - Intronic
1017826517 6:158085962-158085984 GCAGCCTCTGGAGCCAGTGCAGG + Intronic
1018440431 6:163807321-163807343 GGTCCCTCTGTTCCCAAAGCAGG - Intergenic
1018799495 6:167211022-167211044 GCCCTCCCTGTAGCCACAGCCGG - Intergenic
1018993181 6:168690193-168690215 GCTCACTCTGTAACCAAGGCTGG + Intergenic
1019008785 6:168825398-168825420 TCGCCCTCTGTTGCCCAAGCTGG - Intergenic
1019657344 7:2202951-2202973 CCATCCCCTGTAGTCAAAGCTGG - Intronic
1020103796 7:5411184-5411206 TCTCACTCTGTAGCCCAAGCGGG - Intronic
1020249731 7:6458005-6458027 TCTCCCTCTGTAGCCCAGGCTGG + Intronic
1020376438 7:7492553-7492575 TCTCACTCTGTTGCCAAAGCTGG - Intronic
1022081560 7:27026845-27026867 TCACACTCTGTTGCCAAGGCTGG - Intergenic
1022087005 7:27078143-27078165 TCTCACTCTGTAGCCCAAGCTGG - Intergenic
1022160329 7:27703911-27703933 GCTCCCTTTGTCGCCAAGGCTGG - Intergenic
1022332779 7:29396429-29396451 TCTCACTCTGTAGCCTAAGCTGG - Intronic
1022899641 7:34792939-34792961 GCACCTTGGGAAGCCAAAGCAGG + Intronic
1023973483 7:45009269-45009291 GCTCCCTCTGTCGCCCAGGCTGG - Intronic
1024092973 7:45962644-45962666 CCTCCCTCTGTCGCCCAAGCTGG + Intergenic
1024702535 7:51920059-51920081 TCTCACTCTGTAGCCCAAGCTGG - Intergenic
1026222564 7:68413302-68413324 TCTCCCTCTGTAGCCCAGGCTGG + Intergenic
1028288053 7:89029131-89029153 TCTCGCTCTGTTGCCAAAGCTGG + Intronic
1028291865 7:89075414-89075436 GCACCCTCTGAAGCCACAGCTGG - Intronic
1028544995 7:91987974-91987996 TCTCCCTATGTAGCCAAGGCTGG - Intronic
1028970818 7:96857188-96857210 TCTCCCTCTGTAGCCCAGGCTGG + Intergenic
1029208542 7:98885326-98885348 GCACCTTGGGAAGCCAAAGCAGG - Intronic
1029377136 7:100185570-100185592 TCTCACTCTGTAGCCCAAGCTGG - Intronic
1029733009 7:102450093-102450115 TCACCCTCTGTCGCCCAGGCTGG - Exonic
1030255401 7:107505226-107505248 CCACCTGCTTTAGCCAAAGCTGG - Intronic
1030581715 7:111364603-111364625 TCTCACTCTGTAGCCCAAGCTGG - Intronic
1030860319 7:114617053-114617075 GCACGCTCTGTTGCTAATGCTGG - Intronic
1031220663 7:118960281-118960303 TCTCCCTCTGTAGCCCAGGCTGG - Intergenic
1031363967 7:120881620-120881642 TCTCCCTCTGTAGCCGAGGCTGG + Intergenic
1032162920 7:129524586-129524608 GCTCCCTCTGTTGCCCAGGCTGG + Intergenic
1032184969 7:129716838-129716860 TCTCCCTCTGTCGCCCAAGCCGG - Intronic
1032251655 7:130262725-130262747 GCACCTTTTGGAGCCTAAGCTGG - Intergenic
1032584592 7:133134598-133134620 TCTCCCTCTGTTGCCCAAGCTGG - Intergenic
1032763277 7:134965084-134965106 TCTCACTCTGTAGCCCAAGCTGG - Intronic
1033073985 7:138231485-138231507 GCACTTTCGGAAGCCAAAGCAGG + Intergenic
1033082807 7:138313800-138313822 GCTCACTCTGTTGCCAAGGCTGG - Intergenic
1033180639 7:139174380-139174402 GCACCCCCTGATGCCAACGCGGG - Intronic
1033348617 7:140544222-140544244 TCTCCCTCTGTTGCCCAAGCTGG + Intronic
1033391439 7:140932245-140932267 TCTCCCTCTGTCGCCAAGGCTGG + Intergenic
1033492032 7:141853508-141853530 GCACCCTCTGAAGCAACAGCTGG + Intergenic
1034178431 7:149118783-149118805 GCTCACTCTGTAGCCCAGGCTGG - Intronic
1034190379 7:149208989-149209011 TCTCCCTCTGTAGCCCAGGCTGG - Intronic
1034238097 7:149588272-149588294 GCTCCCTCTGTCACCCAAGCTGG - Intergenic
1034864221 7:154627223-154627245 GCTCGCTCTGTCGCCCAAGCTGG + Intronic
1035029447 7:155848027-155848049 GCATCCTCAGCAGCCAAGGCGGG - Intergenic
1035056992 7:156042353-156042375 CCACCCTGTGTAGTCAAGGCAGG - Intergenic
1035119455 7:156554067-156554089 CCTCCCTCTGTTGCCCAAGCTGG + Intergenic
1035210381 7:157323688-157323710 TCTCCCTCTGTTGCCCAAGCTGG + Intergenic
1035547905 8:497886-497908 GCACCCTCTGAAGTCATGGCTGG - Intronic
1035957182 8:4094176-4094198 GCACTCTTTGGAGCCAAACCTGG + Intronic
1036399756 8:8397580-8397602 TCTCACTCTGTAGCCCAAGCTGG + Intergenic
1036965525 8:13293198-13293220 TCACGCTCTGTTGCCCAAGCTGG - Intronic
1036996595 8:13665099-13665121 TCTCCCTCTGTCGCCAAGGCTGG + Intergenic
1037068411 8:14612714-14612736 TCTCACTCTGTAGCCCAAGCTGG + Intronic
1037078419 8:14751900-14751922 TCTCACTCTGTAGCCCAAGCTGG - Intronic
1037794154 8:21977553-21977575 TCTCCCTCTGTAGCCCAGGCTGG - Intronic
1037964682 8:23125008-23125030 TCTCCCTCTGTCGCCCAAGCTGG + Intergenic
1038149759 8:24931892-24931914 GCAGCCTCTTAAGCCAAAGTAGG - Intergenic
1038909599 8:31947913-31947935 TCTCACTCTGTAGCCCAAGCTGG - Intronic
1039496324 8:37983389-37983411 TCTCACTCTGTAGCCCAAGCTGG + Intergenic
1039500306 8:38011223-38011245 GCTCCCTCTGTTGCCCAGGCTGG - Intergenic
1039535783 8:38311159-38311181 GCACACTGGGGAGCCAAAGCAGG - Intronic
1039565370 8:38548342-38548364 TCTCCCTCTGTAGCCCAGGCTGG + Intergenic
1039590085 8:38738918-38738940 TCACACTCTGTCGCCCAAGCTGG + Intronic
1039687911 8:39826691-39826713 TCTCGCTCTGTAGCCAAGGCTGG - Intronic
1039695576 8:39906861-39906883 TCTCCCTCTGTTGCCCAAGCTGG - Intronic
1039981821 8:42414801-42414823 ACAGTCTCTGTAGCCCAAGCTGG - Intergenic
1040012185 8:42671216-42671238 TCTCACTCTGTTGCCAAAGCTGG + Intergenic
1040012378 8:42672950-42672972 TCTCCCTCTGTTGCCCAAGCTGG + Intergenic
1040631990 8:49224775-49224797 GCACCGTCTGTCGCCCAGGCTGG + Intergenic
1040869919 8:52090041-52090063 TCTCACTCTGTAGCCCAAGCTGG + Intergenic
1041083850 8:54238937-54238959 TCTCCCTCTGTAGCCCAGGCTGG + Intergenic
1041110202 8:54476478-54476500 AGACCCTCTGCAGCCAATGCTGG + Intergenic
1041218963 8:55630220-55630242 GCTCGCTCTGTAGCCCAGGCTGG + Intergenic
1041256978 8:55987375-55987397 TCTCACTCTGTAGCCCAAGCTGG - Intronic
1042086293 8:65112825-65112847 GCACTCTCTGGAGCCTAATCTGG - Intergenic
1042629294 8:70799358-70799380 TCTCACTCTGTAGCCCAAGCTGG + Intergenic
1043426096 8:80150168-80150190 GCACCCTCTGAAGCCACAGTTGG - Intronic
1043437275 8:80246762-80246784 GCTCACTCTGTTGCCAAGGCTGG - Intergenic
1043461055 8:80460733-80460755 TCTCCCTATGTTGCCAAAGCTGG - Intergenic
1043578749 8:81687752-81687774 GCTCCCTCTGTCGCCCAGGCTGG - Intergenic
1043804557 8:84655356-84655378 TCTCCCTCTGTTGCCCAAGCTGG + Intronic
1043933159 8:86113450-86113472 TCTCCCTCTGTAGCCCAGGCAGG - Intronic
1044538245 8:93381791-93381813 CCACCCTCTGAAGCCATAGCTGG + Intergenic
1044657863 8:94566942-94566964 GCTCGCTCTGTTGCCAAGGCTGG - Intergenic
1045453036 8:102347665-102347687 TCTCCCTCTGTCGCCCAAGCTGG + Intronic
1045793908 8:106020393-106020415 CCTCCCTCTGTTGCCAAGGCTGG - Intergenic
1046057118 8:109092464-109092486 TCTCCCTCTGTAGCCCAGGCTGG + Intronic
1046134669 8:110010998-110011020 GCACCCTCTGAAGCAACAGCTGG - Intergenic
1046703446 8:117426205-117426227 TCTCCCTCTGTTGCCAAGGCTGG + Intergenic
1046784092 8:118247620-118247642 TCTCACTCTGTAGCCCAAGCTGG + Intronic
1046958825 8:120088424-120088446 TCTCACTCTGTAGCCGAAGCTGG + Intronic
1047030538 8:120874929-120874951 TCACGCTCTGTAGCCCAGGCTGG + Intergenic
1047109611 8:121774361-121774383 TCTCGCTCTGTCGCCAAAGCTGG - Intergenic
1047192315 8:122689365-122689387 GCACCATTTTTAGCCAAAACTGG + Intergenic
1047396380 8:124502970-124502992 GCTTGCTCTGTAGCCCAAGCTGG - Intronic
1047776734 8:128077403-128077425 TCACCCCCTGAAGCCCAAGCAGG - Intergenic
1048039020 8:130707074-130707096 GAACCCTCTGAAGCAACAGCCGG + Intergenic
1048152796 8:131910299-131910321 TCTCACTCTGTAGCCCAAGCTGG + Intronic
1049481771 8:142827766-142827788 TCTCCCTCTGTTGCCAAGGCTGG - Intergenic
1049608492 8:143541142-143541164 CCACCCTCTGCAGCCCCAGCAGG + Intronic
1049865773 8:144934497-144934519 ACACCCTCTGGAGCCAGGGCTGG - Intronic
1050104662 9:2152820-2152842 GCTCCCTCTGTTGCCCAGGCTGG - Intronic
1050472188 9:6005473-6005495 TCTCCCTCTGTAGCCCAGGCTGG - Intronic
1050771650 9:9208835-9208857 TCTCGCTCTGTCGCCAAAGCTGG + Intronic
1051246657 9:15118511-15118533 ACAGCCTCTGTAGTCAAAACAGG + Intergenic
1051420476 9:16884140-16884162 TCACACTCTGTAGCCCAGGCTGG - Intergenic
1052754820 9:32529918-32529940 TCTCACTCTGTAGCCCAAGCTGG + Intergenic
1053247541 9:36546915-36546937 TCTCCCTCTGTCGCCCAAGCTGG - Intergenic
1053248636 9:36556217-36556239 TCTCACTCTGTAGCCCAAGCTGG + Intergenic
1054780315 9:69159833-69159855 TCTCCCTCTGTTGCCCAAGCTGG - Intronic
1055805478 9:80088476-80088498 TCTCACTCTGTAGCCCAAGCTGG + Intergenic
1056150648 9:83784235-83784257 TCTCACTCTGTAGCCCAAGCTGG - Intronic
1056300645 9:85237144-85237166 GCACATTTAGTAGCCAAAGCAGG - Intergenic
1056331597 9:85525692-85525714 TCAGCCTCTGTAGCCAGAGAAGG - Intergenic
1056588829 9:87948897-87948919 TCTCACTCTGTAGCCCAAGCTGG + Intergenic
1056595145 9:88001913-88001935 GCACCCTCTAAAGCCATGGCTGG - Intergenic
1057341513 9:94206317-94206339 TCTCCCTCTGTTGCCAAGGCTGG + Intergenic
1057674995 9:97131253-97131275 TCTCCCTCTGTTGCCAAGGCTGG - Intergenic
1058013952 9:100009139-100009161 TCTCACTCTGTAGCCCAAGCTGG + Intronic
1058060144 9:100486663-100486685 TCTCCCTCTGTTGTCAAAGCTGG + Intronic
1058448435 9:105074292-105074314 TCTCACTCTGTAGCCCAAGCTGG + Intergenic
1058660479 9:107262777-107262799 TCTCCCTCTGTTGCCCAAGCTGG + Intergenic
1058687826 9:107493184-107493206 TCTCACTCTGTAGCCCAAGCTGG + Intergenic
1059084108 9:111281651-111281673 TCACACTCTGTTGCCCAAGCTGG + Intergenic
1059126390 9:111690392-111690414 TCTCCCTCTGTAGCCCAGGCTGG - Intronic
1059207393 9:112479730-112479752 TCTCCCTCTGTTGCCAAGGCTGG + Intronic
1059310191 9:113383307-113383329 TCTCCCTCTGTAGCCCAGGCCGG + Intergenic
1059787574 9:117602270-117602292 TCTCCCTCTGTCGCCCAAGCTGG - Intergenic
1060295016 9:122337501-122337523 GCAGCCTCTGTGGCCAAGGCTGG + Intergenic
1060751385 9:126171774-126171796 TCTCCCTATGTAGCCCAAGCTGG + Intergenic
1061069115 9:128297913-128297935 TCACCCTATGTTGCCCAAGCTGG + Intergenic
1061078697 9:128357062-128357084 TCTCACTCTGTAGCCCAAGCTGG - Intronic
1061563304 9:131420520-131420542 GCTCCCTCTGTCGCCCAGGCTGG + Intronic
1061567141 9:131448512-131448534 TCTCCCTCTGTCGCCCAAGCTGG - Intronic
1061591257 9:131599152-131599174 TCTCCCTCTGTAGCCCAGGCTGG + Intronic
1185696785 X:2200928-2200950 TCTCCCTCTGTTGCCCAAGCTGG - Intergenic
1185807783 X:3076610-3076632 CCTCCCTCTGCAGCCCAAGCCGG + Exonic
1187142420 X:16606789-16606811 TCTCCCTCTGTCGCCCAAGCTGG + Intronic
1187347584 X:18480744-18480766 GGGCCCCCAGTAGCCAAAGCAGG - Intronic
1187416291 X:19095987-19096009 GCTCCCTCTGTTGCCCAGGCTGG - Intronic
1189466722 X:41283249-41283271 TCACCCTATGTTGCCAAGGCTGG - Intergenic
1189890495 X:45597210-45597232 GCACCTGCTGTGGCCATAGCAGG - Intergenic
1190014430 X:46814552-46814574 TCACACTCTGTTGCCCAAGCTGG - Intergenic
1190026400 X:46927641-46927663 GCACTTTCTGAGGCCAAAGCAGG - Intronic
1190198663 X:48341945-48341967 TCACCCTCTGTTGCCCAGGCTGG + Intergenic
1190313897 X:49137173-49137195 TCTCCCTCTGTTGCCAAGGCTGG - Intergenic
1190772462 X:53526738-53526760 GCACCCTCTGAAGCAAAGGCTGG - Intergenic
1190863442 X:54364538-54364560 GCCCCCTCTATTGCCCAAGCTGG - Intergenic
1191828545 X:65391804-65391826 TCTCCCTCTGTTGCCAAGGCTGG + Intronic
1191923230 X:66279406-66279428 GCACCCTCTGAAGCAAAGCCTGG + Intergenic
1192407407 X:70900347-70900369 TCTCCCTCTGTAGCCCAGGCTGG - Intronic
1192466519 X:71360568-71360590 TCTCACTCTGTAGCCCAAGCTGG + Intergenic
1192741886 X:73901135-73901157 TCTCCCTCTGTAGCCCAGGCTGG - Intergenic
1195028965 X:100908150-100908172 TCTCACTCTGTAGCCCAAGCTGG + Intergenic
1195046999 X:101063428-101063450 TCTCCCTCTGTCGCCCAAGCTGG + Intergenic
1195624133 X:106990284-106990306 TCTCCCTCTGTTGCCCAAGCTGG + Intronic
1196063584 X:111438074-111438096 TCTCCCTCTGTTGCCCAAGCTGG - Intergenic
1196319961 X:114275068-114275090 TCTCCCTCTGTAGCCCAGGCTGG + Intergenic
1196351422 X:114735285-114735307 TCTCCCTCTGTCGCCCAAGCTGG - Intronic
1196387741 X:115176774-115176796 TCTCACTCTGTAGCCCAAGCTGG + Intronic
1196392073 X:115218105-115218127 GCTCCCTCTGTTGCCCAGGCTGG - Intronic
1196682578 X:118484020-118484042 TCTCCCTCTGTAGCCCAGGCTGG + Intergenic
1196846702 X:119902089-119902111 TCTCCCTCTGTAGCCCAGGCTGG + Intronic
1197208628 X:123811399-123811421 TCTCCCTCTGTCGCCCAAGCTGG - Intergenic
1197223128 X:123932347-123932369 GCACCCTCTGAAGCAATGGCTGG - Intergenic
1198253002 X:134899924-134899946 TCTCCCTCTGTAGCCCAGGCTGG - Intronic
1198323416 X:135542466-135542488 TCTCACTCTGTAGCCCAAGCTGG - Intronic
1198803255 X:140469095-140469117 TCTCCCTCTGTCGCCCAAGCTGG - Intergenic
1199410564 X:147517754-147517776 TCTCCCTCTGTCGCCCAAGCTGG - Intergenic
1199461829 X:148093759-148093781 GCAGCCTCTGCTGCCCAAGCTGG - Intergenic
1199686957 X:150273396-150273418 GCACCTCCTGAAGCCACAGCTGG - Intergenic
1199767367 X:150951025-150951047 CCTCCCTCTGTTGCCTAAGCTGG + Intergenic
1200670369 Y:6080980-6081002 TCTCCCTCTGTCGCCCAAGCTGG - Intergenic
1201404763 Y:13638470-13638492 TCTCGCTCTGTAGCCAAGGCTGG + Intergenic
1201457570 Y:14186586-14186608 TCTCCCTCTGTAGCCCAGGCTGG - Intergenic
1201559472 Y:15300828-15300850 GCACCCTATGTTGCCAAGGCTGG + Intergenic