ID: 959882230

View in Genome Browser
Species Human (GRCh38)
Location 3:111456925-111456947
Sequence ATGTCCCTATAGGAAAGGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 145}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959882230_959882234 17 Left 959882230 3:111456925-111456947 CCAACCCTTTCCTATAGGGACAT 0: 1
1: 0
2: 0
3: 8
4: 145
Right 959882234 3:111456965-111456987 ATGTGTGATTAGTTCTTGATTGG 0: 1
1: 0
2: 0
3: 11
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959882230 Original CRISPR ATGTCCCTATAGGAAAGGGT TGG (reversed) Intronic
901619899 1:10576057-10576079 ATATCCCAATAGAAAATGGTGGG - Intronic
905894008 1:41533688-41533710 ATGTCGGCATGGGAAAGGGTGGG - Intronic
906117132 1:43364508-43364530 AGGCCACTATGGGAAAGGGTGGG - Intronic
906237483 1:44220708-44220730 ATGCCCCTAGTGGGAAGGGTGGG + Intergenic
907054518 1:51352737-51352759 ATTTACTTATAGGAAATGGTAGG - Intergenic
908964381 1:69740378-69740400 AGGCCCCAATATGAAAGGGTGGG - Intronic
910773139 1:90850354-90850376 AAGTCCCTATAGGAAGGAGGAGG - Intergenic
912175326 1:107148658-107148680 ATGTCCCCAAACCAAAGGGTAGG - Exonic
912797271 1:112700789-112700811 CTGACCCTGTAGGGAAGGGTGGG + Intergenic
913256686 1:116960515-116960537 ATGTCCCTGCAGAGAAGGGTGGG - Intronic
915445930 1:155974985-155975007 ATGTCTCTTTGGGAGAGGGTGGG - Intronic
916446356 1:164875747-164875769 ATATCCCTTTAAGAAAGGGCTGG - Intronic
916576785 1:166074132-166074154 ATGTCCATATAGAAAAGCCTTGG - Intronic
918108294 1:181432192-181432214 ATGCCCCTAAATGAAATGGTGGG + Intronic
924277745 1:242405295-242405317 ATGTCCCTGGAGGGAGGGGTGGG - Intronic
1063961796 10:11312573-11312595 ATGACCATATATGAAAGAGTAGG + Intronic
1071684195 10:87737263-87737285 ATGTGACTTCAGGAAAGGGTGGG - Intronic
1072346429 10:94512013-94512035 CTGTCCCTAAAGGATAGGGGAGG + Intronic
1075111831 10:119594082-119594104 AAGGCCCTATGGAAAAGGGTGGG + Intronic
1081592761 11:44436326-44436348 ATATCCCTACAGGAAAAGGGAGG + Intergenic
1081675453 11:44966124-44966146 ATGTCACTAGAGGAAAGAATGGG + Intergenic
1081883601 11:46475603-46475625 CTGTCTCTGAAGGAAAGGGTTGG - Intronic
1082884433 11:58067943-58067965 ATTTCCCTATGGGGGAGGGTAGG + Intronic
1089170054 11:116505541-116505563 ATGTCACTCTGGGAAAAGGTGGG + Intergenic
1089653453 11:119930336-119930358 AGGTCCCTTTGGGAAAGGATGGG + Intergenic
1089870166 11:121665510-121665532 ATATCCCAAAAGGAAAGGGCTGG - Intergenic
1091841079 12:3621282-3621304 ATGACCCAATAGGATGGGGTAGG + Intronic
1092480455 12:8854705-8854727 ATGGCACTAAAGGAAAGGGAAGG - Intronic
1097656587 12:62370877-62370899 TTGTACCTATAAGAAAGTGTAGG - Intronic
1097756842 12:63416186-63416208 AAGTCCTTTTAGGGAAGGGTAGG - Intergenic
1098190869 12:67946912-67946934 ATGTGCTTATATGAAAAGGTCGG + Intergenic
1099954429 12:89339204-89339226 ATATCCTTATAGGAAGGGTTTGG + Intergenic
1102953569 12:117045651-117045673 ATGTCCCTCAAGGACAGGCTTGG + Intronic
1105224891 13:18423266-18423288 TTTTCCCTATTGGATAGGGTTGG - Intergenic
1105629879 13:22152556-22152578 TTGTCCCTCTAGGAGAGGGAGGG - Intergenic
1109023604 13:57131303-57131325 ATGCCCCTCTAGGGAAGGATTGG + Intergenic
1113092032 13:106626685-106626707 GTGTCCCAACAGGAAATGGTTGG + Intergenic
1113454591 13:110439069-110439091 ATGTCCCTAGTCGTAAGGGTCGG + Intronic
1114008994 14:18347632-18347654 TTTTCCCTATTGGATAGGGTTGG - Intergenic
1114326026 14:21589688-21589710 ATTCCCCTATTGGATAGGGTTGG - Intergenic
1115836818 14:37415205-37415227 ATGTGCCTCCAGGAAAGGTTTGG + Intronic
1115913191 14:38279529-38279551 ATCTCCCTATAGGATAGAGAGGG + Intergenic
1120853747 14:89195241-89195263 GTGTCCTCATAGGAAGGGGTGGG - Intronic
1121967532 14:98324349-98324371 ATGTCTCTGAAGGAAAGGGTGGG - Intergenic
1122841605 14:104467211-104467233 AGGTCCCTTTGGGAAAGGCTGGG + Intergenic
1123392197 15:19888236-19888258 TTTTCCCTATTGGATAGGGTTGG - Intergenic
1126614337 15:50561482-50561504 AAGTCCCTATAGGATAGAGCTGG - Exonic
1127338038 15:58009655-58009677 ATATCCTTATAGGAAAGGGATGG - Intronic
1127417306 15:58770632-58770654 TTCGCCCTACAGGAAAGGGTCGG - Intergenic
1131341173 15:91602538-91602560 ATCTGCCTATAGGAATGGGAAGG - Intergenic
1139090553 16:63641351-63641373 TTGTCCCTGTATGAAAGGGGAGG - Intergenic
1142799078 17:2333463-2333485 AGGGCCCTATAGGATAGAGTGGG - Intronic
1146200508 17:30853391-30853413 ATGTCTCTATAGCAGAAGGTAGG - Intronic
1151144672 17:72030022-72030044 ATTTCCCTTAAGGGAAGGGTGGG - Intergenic
1154528470 18:15316256-15316278 TTTTCCCTATTGGATAGGGTTGG + Intergenic
1155200855 18:23516386-23516408 ATGTCTCTTTCGGAAAGGCTGGG - Exonic
1155858865 18:30870729-30870751 ATGTTCCTATGGGAGAGAGTTGG + Intergenic
1157199044 18:45643358-45643380 ATGTACCTCTAGGAGAGGGAGGG + Intronic
1157469070 18:47973954-47973976 ATGTCCCTATCGCATAGGGATGG + Intergenic
1159703661 18:71660599-71660621 ATGACCCGGTAGGAAAGAGTCGG + Intergenic
1162381594 19:10334852-10334874 ATATCCCGAGAGGAAAGGGGAGG - Intronic
1164129441 19:22348625-22348647 ATGTCCCTGTAGGAACAGGGAGG - Intergenic
1164170106 19:22717366-22717388 ATGTCCCTGTAGGAACAGGGAGG + Intergenic
1166787919 19:45380310-45380332 AGGTCCCCTTAGGAAGGGGTGGG - Intronic
1167758047 19:51425807-51425829 ATGGCTCTATAGGAATGGTTGGG - Intergenic
927816235 2:26220019-26220041 AGGTCCCTTTGGGGAAGGGTAGG - Intronic
929576760 2:43057053-43057075 TTGTCCCCATAGGGCAGGGTAGG - Intergenic
929999916 2:46854392-46854414 TTGTGCCTACAGGAAAGGGAGGG - Intronic
933375441 2:81474307-81474329 AATTCACTATAGAAAAGGGTAGG - Intergenic
935584385 2:104787700-104787722 ATCCCCCTATAGGAAAGATTGGG + Intergenic
937495786 2:122417683-122417705 ATGTTTCTATAAGAAAAGGTAGG - Intergenic
938527577 2:132147720-132147742 TTTTCCCTATTGGATAGGGTTGG + Intronic
942982674 2:182100998-182101020 AATTCCCTATAAGAAAGGGAAGG + Intronic
944944385 2:204666441-204666463 ATGTCACTATAGGAAGGGCATGG + Intronic
945366956 2:208966115-208966137 ACCTCCCGCTAGGAAAGGGTTGG + Intergenic
945483153 2:210365508-210365530 ATTCCCCTATTGGATAGGGTTGG + Intergenic
1171302672 20:24077549-24077571 ATGTCCTTATATGACAGGGAAGG + Intergenic
1172175424 20:32969391-32969413 GTGTCCCAACAGGAAAGGGGGGG - Intergenic
1172474195 20:35225603-35225625 GGGTTCCTATAGGAAAGTGTTGG - Intergenic
1172818078 20:37705770-37705792 GTGTCCCTAAAGGAAGTGGTTGG + Intronic
1174683032 20:52426381-52426403 ATTTCCCTTTAGGAAAAAGTAGG - Intergenic
1174780855 20:53387433-53387455 ATGTCACTAAAGTAAAGGCTCGG + Intronic
1176768941 21:13052284-13052306 TTTTCCCTATTGGATAGGGTTGG - Intergenic
1177192987 21:17872320-17872342 ATGTCTCTTTAGGGAAGGTTAGG + Intergenic
1179963277 21:44784149-44784171 ATGTCTCCATAAGAAAGGGAGGG + Intronic
1180433494 22:15278442-15278464 TTTTCCCTATTGGATAGGGTTGG - Intergenic
1180516057 22:16146351-16146373 TTTTCCCTATTGGATAGGGTTGG - Intergenic
1185395358 22:50584037-50584059 AGGTCCCTTTAGGGAAGGATTGG - Intronic
950136962 3:10588282-10588304 ATGTCCCTAGGGGTAAGGGTGGG + Intronic
951338804 3:21458510-21458532 ATGTCTCTAGAAGAAAGGGAAGG + Intronic
953764195 3:45722287-45722309 AAATCCCTAGAGGAGAGGGTAGG + Intronic
955464256 3:59219790-59219812 ATGTCCTTATTCCAAAGGGTTGG - Intergenic
956387110 3:68731236-68731258 ATTTCCCTACAGGAAAGGAATGG + Intergenic
956601011 3:71022624-71022646 ATTTCCCTATAGGAATGGTTGGG + Intronic
957553422 3:81735692-81735714 AAGTCCCTTTAGGAAAGCCTTGG + Intronic
959882230 3:111456925-111456947 ATGTCCCTATAGGAAAGGGTTGG - Intronic
959938786 3:112058834-112058856 CTGGCCCTTTAGGAAAGGATGGG - Intronic
966423248 3:179754890-179754912 CTGTTCCTATAGAACAGGGTGGG - Intronic
968900147 4:3427115-3427137 CTTTCCCTAGAGCAAAGGGTGGG - Intronic
970191986 4:13526002-13526024 ATTTCCCTATAGGAAGAGATTGG - Intergenic
970505983 4:16731002-16731024 AAGTCCCTTGAGGAAAGTGTGGG - Intronic
971534031 4:27725912-27725934 TTGTTTCTATAGGAAAAGGTTGG + Intergenic
973080421 4:45984569-45984591 ATTTCTCTGTAGGAAAAGGTTGG - Intergenic
977622643 4:99154639-99154661 GAGTACCTATAGGAAAGAGTAGG - Intronic
977891656 4:102319227-102319249 ATGTCCTTATGGGAAAGTGGGGG + Intronic
977976904 4:103276523-103276545 ATGTCCCTTTGGGGAAGGGTGGG + Intergenic
980599265 4:134998289-134998311 ATTTCCCTATAGTAAAGGCTTGG + Intergenic
984318181 4:178156659-178156681 ATCTGCCTCTAGGGAAGGGTTGG + Intergenic
987234039 5:15925237-15925259 ATGTCTGTATAACAAAGGGTGGG + Intronic
993237050 5:85324854-85324876 TTTTTCCTATAGGAAAAGGTGGG + Intergenic
994368662 5:98945350-98945372 AGATCCCTTTAGGAAAGGATGGG + Intergenic
994701489 5:103140941-103140963 CTGTCCTTATAGGACAGGATAGG + Intronic
996347560 5:122503134-122503156 CTGTCCCTAAGGGATAGGGTGGG - Intergenic
1001192878 5:169647055-169647077 ATGTCCCCATTGGACAGGTTGGG + Intronic
1001881615 5:175249596-175249618 ATGTCCCTAGGTCAAAGGGTGGG + Intergenic
1004598483 6:17124537-17124559 ATCTCCCTAGAGGTAAGGGGAGG + Intronic
1012003301 6:93681358-93681380 ATGTACCTACAGGCAAGGGAGGG + Intergenic
1013004773 6:106062001-106062023 ATGCCAGTATAGGCAAGGGTGGG + Intergenic
1014686410 6:124506851-124506873 ATTTCCCTAGAGGGGAGGGTGGG - Intronic
1017989531 6:159473886-159473908 ATTTCCCTTTTGGAAAGGCTGGG - Intergenic
1023187431 7:37547053-37547075 ATGTCCCTACAGCAAAGGAGAGG - Intergenic
1024525922 7:50349439-50349461 ATGTACCTATAAGAATGGGTAGG + Intronic
1024593600 7:50913175-50913197 ATATCTCTATAGGCAAGGTTGGG - Intergenic
1025763321 7:64415657-64415679 ATGTTCTTATTGGAAAGGCTAGG + Intergenic
1027983636 7:85257497-85257519 ATATGTCTATAGGTAAGGGTTGG - Intergenic
1030168742 7:106580470-106580492 CTGTCTCTATAGGGAAGGGGTGG + Intergenic
1036220875 8:6920915-6920937 ATGTCTCTAGGGGAAGGGGTGGG + Intergenic
1045174379 8:99705958-99705980 ATCTCCCTCTACGAAAGGCTGGG - Intronic
1046389065 8:113543839-113543861 CTGTCCCCATTGGTAAGGGTGGG + Intergenic
1046619966 8:116518644-116518666 ATGTGCCTACAGCATAGGGTAGG - Intergenic
1048224526 8:132572081-132572103 ATTTACCTATAATAAAGGGTTGG - Exonic
1048642828 8:136383406-136383428 AGGTCCCTACAGGAAAGACTTGG - Intergenic
1048705124 8:137145501-137145523 AGGTGCCTAGATGAAAGGGTTGG + Intergenic
1049027865 8:140008875-140008897 ATATCCCAGTAGGAAAGGCTGGG + Intronic
1053706253 9:40754995-40755017 TTTTCCCTATTGGATAGGGTTGG + Intergenic
1054416329 9:64878600-64878622 TTTTCCCTATTGGATAGGGTTGG + Intergenic
1059563385 9:115357275-115357297 AAGTCCCTATAGGAATGGAGTGG + Intronic
1061091788 9:128430653-128430675 GTGACCCTTGAGGAAAGGGTGGG - Intronic
1062233606 9:135497308-135497330 ATGTTCCTATTGTAAATGGTAGG - Intronic
1186194516 X:7097759-7097781 ATGCTCCTAATGGAAAGGGTGGG + Intronic
1186869685 X:13758676-13758698 ATGCCCCAATAGGAAAGGCGTGG + Intronic
1187852637 X:23606362-23606384 ATGTCCTTGTAGACAAGGGTGGG + Intergenic
1190282424 X:48939837-48939859 ATGTCTCTAAAGCAAATGGTAGG - Intronic
1190296224 X:49029519-49029541 CTGTTCCTATAGGGAAGGGGTGG + Exonic
1190575916 X:51838001-51838023 ATTTCACTATAGGAAAAGATGGG + Intronic
1192907662 X:75568313-75568335 ATGGCCACATAGAAAAGGGTAGG - Intergenic
1194923010 X:99791213-99791235 ATGGCCTCAAAGGAAAGGGTGGG - Intergenic
1198385979 X:136129821-136129843 ATGACCCAAAAGGAATGGGTGGG + Intergenic
1199537911 X:148924620-148924642 ATGCCCCTATAGGCAGGTGTTGG - Intronic
1201277429 Y:12312445-12312467 TTGTCCCTATGGGATAGGATGGG - Intergenic
1201566383 Y:15369078-15369100 ATGTTCCTAATGGAAAGGGTGGG + Intergenic
1202265567 Y:23014067-23014089 ATCTCCCTATAGGCAGGGTTAGG - Intergenic
1202418560 Y:24647809-24647831 ATCTCCCTATAGGCAGGGTTAGG - Intergenic
1202452226 Y:25022277-25022299 ATCTCCCTATAGGCAGGGTTAGG + Intergenic