ID: 959883309

View in Genome Browser
Species Human (GRCh38)
Location 3:111471786-111471808
Sequence TGTTAAATACAGCACACCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 912
Summary {0: 1, 1: 0, 2: 16, 3: 132, 4: 763}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959883307_959883309 8 Left 959883307 3:111471755-111471777 CCTGTGTGTGTCTTTGCTGGTGA 0: 1
1: 2
2: 90
3: 1205
4: 6091
Right 959883309 3:111471786-111471808 TGTTAAATACAGCACACCAGTGG 0: 1
1: 0
2: 16
3: 132
4: 763
959883305_959883309 21 Left 959883305 3:111471742-111471764 CCTTTATTTTGAGCCTGTGTGTG 0: 268
1: 4131
2: 2824
3: 1834
4: 1794
Right 959883309 3:111471786-111471808 TGTTAAATACAGCACACCAGTGG 0: 1
1: 0
2: 16
3: 132
4: 763
959883304_959883309 22 Left 959883304 3:111471741-111471763 CCCTTTATTTTGAGCCTGTGTGT 0: 386
1: 7072
2: 3503
3: 1935
4: 1956
Right 959883309 3:111471786-111471808 TGTTAAATACAGCACACCAGTGG 0: 1
1: 0
2: 16
3: 132
4: 763
959883303_959883309 26 Left 959883303 3:111471737-111471759 CCATCCCTTTATTTTGAGCCTGT 0: 314
1: 4602
2: 5827
3: 2363
4: 1784
Right 959883309 3:111471786-111471808 TGTTAAATACAGCACACCAGTGG 0: 1
1: 0
2: 16
3: 132
4: 763
959883302_959883309 29 Left 959883302 3:111471734-111471756 CCTCCATCCCTTTATTTTGAGCC 0: 4180
1: 5605
2: 1776
3: 568
4: 424
Right 959883309 3:111471786-111471808 TGTTAAATACAGCACACCAGTGG 0: 1
1: 0
2: 16
3: 132
4: 763

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959883309 Original CRISPR TGTTAAATACAGCACACCAG TGG Intronic
902102037 1:13998452-13998474 TCCTGAATACAGCACACCAATGG - Intergenic
903566685 1:24272680-24272702 TCCTGAATACAGCACACCAATGG + Intergenic
905306466 1:37022288-37022310 TATTAACGACAGCACAGCAGAGG + Intronic
906586999 1:46987104-46987126 TCCTGAATACAGCACACCAATGG - Intergenic
907374310 1:54022972-54022994 TGTTAAGTACAGCACAATTGAGG + Intergenic
907565875 1:55432796-55432818 TCCTGAATACAGCACACCAAAGG - Intergenic
907637308 1:56148674-56148696 TGTTACCTCCTGCACACCAGAGG - Intergenic
908723859 1:67154702-67154724 TCCTGAATACAGCACACCAATGG + Intronic
908930313 1:69310406-69310428 TCCTGAATACAGCACACCAATGG + Intergenic
909024910 1:70470373-70470395 TGTTGAAGACAGCATACCACTGG - Intergenic
909033169 1:70566198-70566220 TTTGAAACACAGCACACCATTGG + Intergenic
909689929 1:78396152-78396174 TCTTGAACACAGCACACCAATGG + Intronic
910605070 1:89074076-89074098 TCCTGAATACAGCACACCAATGG - Intergenic
910627135 1:89318834-89318856 TTCTGAATACAGCACACCAATGG - Intergenic
910805506 1:91186602-91186624 TCCTGAATACAGCACACCAATGG + Intergenic
910915315 1:92281697-92281719 TCCTGAATACAGCACACCAATGG - Intronic
911242995 1:95485307-95485329 TCCTGAATACAGCACACCAATGG - Intergenic
911495208 1:98623139-98623161 TCCTGAATACAGCACACCAATGG + Intergenic
911508814 1:98786301-98786323 TCCTGAATACAGGACACCAGTGG - Intergenic
911535631 1:99096950-99096972 TCTTGAATACAGCACACCAATGG + Intergenic
911538446 1:99129019-99129041 TCTTAAAGACAGCGCACCAATGG + Intergenic
911595863 1:99798503-99798525 TCCTGAATACAGCACACCAATGG + Intergenic
911675091 1:100649352-100649374 TCTTAAAGACAGCATATCAGTGG - Intergenic
911835389 1:102612338-102612360 ACTTGAATACAGCATACCAGTGG - Intergenic
912038046 1:105347402-105347424 TGTTGAAGACAGCATACCATTGG + Intergenic
912235561 1:107846493-107846515 TCCTGAATACAGCACACCAATGG - Intronic
913219977 1:116651553-116651575 TGTTAAATGCAGCCTACCATAGG + Intronic
913720160 1:121585081-121585103 TCCTGAATACAGCACACCAATGG + Intergenic
914458283 1:147857071-147857093 TCCTGAATACAGCACACCAATGG - Intergenic
914458934 1:147863847-147863869 TCCTGAATACAGCACACCAATGG - Intergenic
915053736 1:153105243-153105265 TCTTGAACACAGCACACCAATGG - Intronic
915688679 1:157663846-157663868 TCTTGAATACAGCACACCAATGG - Intergenic
915990835 1:160514095-160514117 TCTTGAATACAGCACACCAATGG - Intronic
916140793 1:161695357-161695379 TCCCAAATACAGCACACCAATGG - Intergenic
916848806 1:168682153-168682175 TCCTGAATACAGCACACCAGCGG + Intergenic
916973684 1:170051069-170051091 TCCTGAATACAGCACACCAATGG - Intronic
917060343 1:171031198-171031220 TCCTGAATACAGCACACCAATGG + Intronic
917582094 1:176389633-176389655 TCCTGAATACAGCACACCAATGG + Intergenic
917699542 1:177566381-177566403 TGTGAAATACAGTACTCCTGTGG + Intergenic
918032878 1:180833405-180833427 TCTTGAAAACAGCACACCAATGG - Intronic
918105550 1:181412874-181412896 TGTTAAATTCTGGACACCTGGGG + Intergenic
918156452 1:181851324-181851346 TCCTGAATACAGCACACCAATGG - Intergenic
918160244 1:181891604-181891626 TCCTGAATACAGCACACCAATGG - Intergenic
918814547 1:189166194-189166216 TCCTGAATACAGCACACCAGTGG + Intergenic
919063722 1:192666864-192666886 TCCTGAATACAGCACACCAATGG + Intergenic
919445324 1:197697647-197697669 TCCTGAATATAGCACACCAGTGG - Intronic
919568246 1:199216504-199216526 TCTTGAAGACAGCACACCAATGG + Intergenic
919718030 1:200800579-200800601 TTCTGAATAGAGCACACCAGTGG + Intronic
920625248 1:207590689-207590711 TCCTGAATACAGCACACCAATGG - Intronic
922406004 1:225314350-225314372 TCCTGAATACAGCACACCAGTGG + Intronic
922679220 1:227577649-227577671 TCTTGAAGACAGCATACCAGTGG + Intronic
922692135 1:227701862-227701884 TACAGAATACAGCACACCAGTGG - Intergenic
923066729 1:230525179-230525201 TCCTGAATACAGCACACCAATGG + Intergenic
923195239 1:231660384-231660406 TCTTGAAGACAGCACACCAGTGG + Intronic
924331930 1:242948385-242948407 TCTTAAAGACAGCATACCAGTGG - Intergenic
924493774 1:244566760-244566782 TCTTGCATACAGCACACCAATGG + Intronic
924863008 1:247945909-247945931 TCTCGAATACAGCACACCAATGG + Intronic
924872012 1:248057549-248057571 TCTTGAATACAGCACATCAATGG + Intronic
924883908 1:248191177-248191199 TCCTGAATACAGCACACCAATGG - Intergenic
1062810645 10:461276-461298 TCCTGAATACAGCACACCAACGG - Intronic
1064310629 10:14208913-14208935 TGTTAAATACTGAAGACCACAGG - Intronic
1064563406 10:16615110-16615132 TCCTGAATACAGCACACCAATGG - Intronic
1065077121 10:22091498-22091520 TCCTGAATACAGCACACCAATGG - Intergenic
1065651965 10:27901540-27901562 TCCTGAATACAGCACACCGGTGG - Intronic
1065907867 10:30274337-30274359 TCCTGAATACAGCACACCAATGG - Intergenic
1066031342 10:31428976-31428998 TCTTGAATACAGCATACCATTGG + Intronic
1066159901 10:32716625-32716647 TCCTGAATACAGCACACCAATGG - Intronic
1066706824 10:38189040-38189062 TCTTGAATACAGCACACCAATGG - Intergenic
1067124783 10:43506906-43506928 AGTTAATTACAGCTCACCAGGGG - Intergenic
1067161973 10:43834493-43834515 TTCTGAATACAGCACACCAATGG + Intergenic
1068126606 10:52849171-52849193 TCCTGAATACAGCACATCAGTGG + Intergenic
1068495552 10:57781059-57781081 TCCTAAGTACAGCACACCAATGG - Intergenic
1070349511 10:75578116-75578138 TCCTGAATACAGCACACCAATGG - Intronic
1070709463 10:78668557-78668579 TCTTGAATACAGCACACCGATGG - Intergenic
1070870780 10:79750210-79750232 TCTTAAAGACAGCATACCATTGG - Intergenic
1071076998 10:81767045-81767067 TCCTGAATACAGCACACCAATGG + Intergenic
1071272634 10:84022134-84022156 TCCTGAATACAGCACACCAATGG - Intergenic
1071401552 10:85278301-85278323 TTCTGAATACAGCACACCAATGG + Intergenic
1071637704 10:87272422-87272444 TCTTAAAGACAGCATACCATTGG - Intergenic
1071657540 10:87465529-87465551 TCTTAAAGACAGCATACCATTGG + Intergenic
1072017403 10:91362398-91362420 TCCTGAATACAGCACACCAATGG + Intergenic
1072024552 10:91441995-91442017 TCCTGAATACAGCACACCAATGG + Intronic
1072025145 10:91447600-91447622 TCCTGAATACAGCACACCAATGG - Intronic
1072493478 10:95932293-95932315 TCCTGAATACAGCACACCAATGG + Intronic
1072556417 10:96517788-96517810 TTTTAAATACATCATTCCAGGGG + Intergenic
1072835068 10:98702035-98702057 TCCTGAATACAGCACACCAATGG - Intronic
1073716840 10:106116819-106116841 TCTTGAATACAGCATACCAACGG - Intergenic
1073962596 10:108950757-108950779 TCCTGAATACAGCACACCAATGG - Intergenic
1075860577 10:125673040-125673062 TCTTGAATACAGCACACCAGTGG + Intronic
1075899280 10:126026076-126026098 TCTTGAAGACAGCACACCAATGG - Intronic
1075983683 10:126764961-126764983 TCCTGAATACAGCACACCAACGG + Intergenic
1077696660 11:4399082-4399104 TCCTGAATACAGCACACCAATGG - Intergenic
1077762222 11:5114656-5114678 TCTCGAATACAGCACACCAATGG + Intergenic
1078685965 11:13532583-13532605 TCCTGAATACAGCACACCAATGG + Intergenic
1078691527 11:13584862-13584884 TCTTGAATACAGTACACCAATGG - Intergenic
1078834731 11:15016426-15016448 TCTTGAATACAGCACACCAATGG - Intronic
1079257041 11:18839851-18839873 TCTTGAGTACAGCACACCAACGG - Intergenic
1079274191 11:19018480-19018502 AGTAAAATACAGCCTACCAGTGG + Intergenic
1079278615 11:19066700-19066722 TCCTGAATACAGCACACCAATGG + Intergenic
1079587835 11:22148282-22148304 TCTTGAATATAGCACACCAATGG + Intergenic
1079690552 11:23411720-23411742 TTCTGAATACAGCACACCAATGG + Intergenic
1079738105 11:24023239-24023261 TCTTGAAGACAGCACACCAATGG - Intergenic
1079966158 11:26982823-26982845 TCCTGAATACAGCACACCAATGG + Intergenic
1080200584 11:29664877-29664899 TCCTGAATACAGCACACCAATGG - Intergenic
1080782890 11:35447557-35447579 TCTTGAACACAGCACACCAATGG + Intronic
1080866295 11:36198441-36198463 TGGTAAAGACAGCACATTAGTGG - Intronic
1081166281 11:39812199-39812221 TCCTGAATACAGCACACCAAGGG - Intergenic
1081169994 11:39856094-39856116 AGTTTAACACAGAACACCAGAGG + Intergenic
1081317509 11:41648963-41648985 TCCTGAATACAGCACACCAATGG + Intergenic
1081425106 11:42917785-42917807 TCTTGAATACAGCACACCAATGG - Intergenic
1081882218 11:46463224-46463246 TTTAAAATTCAGCCCACCAGGGG + Intronic
1081891652 11:46547550-46547572 TGTGTGATACAGCTCACCAGTGG - Intronic
1082674453 11:56078876-56078898 TCTTGAATACAGCACACCAATGG + Intergenic
1082860421 11:57850067-57850089 TGCTGAATACAGCACACTGGTGG - Intergenic
1082994166 11:59235801-59235823 TCTTGAATACAGCACACCAATGG - Intergenic
1083138139 11:60699437-60699459 AGCTAAATACAGCACACCCTGGG + Intergenic
1083507245 11:63169394-63169416 TCCTGAATACAGCACACCAGTGG - Intronic
1083509298 11:63192566-63192588 TCTTAAAGACAGCACACCAATGG - Intronic
1085066593 11:73500916-73500938 TCCTGAATACAGCACACCAATGG - Intronic
1085334939 11:75686045-75686067 TCTTGAATACAGCACACTAATGG + Intergenic
1085738477 11:79059774-79059796 TTTTAAAAAGAGCACATCAGTGG - Intronic
1086129440 11:83385202-83385224 TCCTGAATACAGCACACCAGTGG - Intergenic
1086132592 11:83416897-83416919 TTCTGAATACAGCACACCAATGG + Intergenic
1086279971 11:85173701-85173723 TCTTAAAGACAGCACGCCAATGG - Intronic
1086312065 11:85546918-85546940 TGCTGAATACAGCACATCAATGG + Intronic
1086410946 11:86543382-86543404 TCCTGAATACAGCACACCAATGG - Intronic
1086505531 11:87499923-87499945 TCCTGAATACAGCACACCAATGG - Intergenic
1086522538 11:87686997-87687019 TCTTGAATACAGTACACCAATGG - Intergenic
1087152080 11:94868346-94868368 TTTTAAATACAGCACACACGCGG - Intronic
1087378157 11:97369712-97369734 TGTTGAAGACAGCATACCAATGG - Intergenic
1087482204 11:98716362-98716384 TCCTGAATACAGCACACCAATGG + Intergenic
1087718741 11:101638176-101638198 TCTTAAATACAGCACACCTGTGG - Intronic
1088005060 11:104929289-104929311 TCCTGAATACAGCACACCAATGG - Intergenic
1088806315 11:113356351-113356373 TCTTGAAGACAGCATACCAGTGG + Intronic
1089882222 11:121785737-121785759 TCCTGAATACAGCACACCAATGG + Intergenic
1090928240 11:131271667-131271689 TCCTGAGTACAGCACACCAGTGG + Intergenic
1091616951 12:2056921-2056943 TTTTAAATAGATCACACGAGAGG + Intronic
1092325342 12:7525772-7525794 TCTTGAATACAGCACACCAATGG + Intergenic
1092398330 12:8148239-8148261 TGTTGAATACAGCACACCAATGG - Intronic
1092581438 12:9847450-9847472 TCCTGAATACAGCACACCAATGG + Intergenic
1093208765 12:16282787-16282809 TGTTAAAAATGGCACATCAGAGG + Intergenic
1093340249 12:17965488-17965510 TCTTGAATACAGCACACTAATGG + Intergenic
1093595457 12:20953332-20953354 TCCTGAATACAGCACACCAATGG - Intergenic
1093595803 12:20957589-20957611 TCTTGAATACAGGACACCAATGG - Intergenic
1093714730 12:22368165-22368187 TCCTGAATACAGCACACCAATGG - Intronic
1093902581 12:24653001-24653023 TCCTGAATACAGCACACCAATGG + Intergenic
1094656788 12:32427976-32427998 TCCTGAATACAGCACACCAATGG + Intronic
1094694756 12:32807441-32807463 TCTTGAAGACAGCACACCAATGG + Intronic
1095356615 12:41282100-41282122 TCCTGAATACAGCACACCAATGG - Intronic
1095442563 12:42252798-42252820 TCCTGAATACAGCACACCAATGG + Intronic
1095488730 12:42710375-42710397 TCCTGAATACAGCACACCAATGG - Intergenic
1095595533 12:43953378-43953400 TCTTGAAGACAGCACACCGGTGG - Intronic
1095931150 12:47626366-47626388 TCCTGAATACAGCACACCAGTGG - Intergenic
1096027818 12:48383018-48383040 TTCTGAATACAGCACACCAATGG + Intergenic
1097340157 12:58428095-58428117 TCCTGAATACAGCACACCAATGG - Intergenic
1097375579 12:58839299-58839321 TCCTGAATACAGCACGCCAGTGG + Intergenic
1097419004 12:59350617-59350639 TCCTGAATACAGCACACCAATGG + Intergenic
1097455929 12:59798115-59798137 TCTTAAATACAGCACACCAATGG - Intergenic
1097460702 12:59858359-59858381 TCCTGAATACAGCACACCAGTGG - Intergenic
1097498703 12:60375528-60375550 TCTTGAATACAGCACACCAATGG - Intergenic
1097517170 12:60619977-60619999 TCTTGAGTACAGCACACCAATGG - Intergenic
1097526844 12:60747669-60747691 TCCTGAATACAGCACACCAATGG - Intergenic
1097598318 12:61662227-61662249 TCTTGAATACAGCACACCAATGG + Intergenic
1097749182 12:63332805-63332827 TCCTGAATACAGCACACCTGTGG - Intergenic
1097824765 12:64163668-64163690 TCTTGAATACAGCACACCTATGG - Intergenic
1098193388 12:67974927-67974949 TCCTGAATACAGCACACCAATGG + Intergenic
1098201612 12:68062385-68062407 TCTTGAATACAGCACACCGATGG + Intergenic
1098496988 12:71147530-71147552 TGATAAACACAGAACACTAGAGG + Intronic
1098764319 12:74467428-74467450 TCTTGAATACAGTACGCCAGTGG + Intergenic
1098788440 12:74788826-74788848 TCCTAAATACAGCACACCAAGGG - Intergenic
1099684087 12:85864113-85864135 TCCTGAATACAGCACACCAATGG + Intergenic
1099699344 12:86063602-86063624 TTCTGAATACAGCACACCAATGG - Intronic
1099793048 12:87361561-87361583 TCCTGAATACAGCACACCAATGG + Intergenic
1099809136 12:87558396-87558418 TCCTGAATACAGCACACCAATGG - Intergenic
1099878664 12:88439198-88439220 TCTTGAATACAGCACACCAATGG - Intergenic
1099897758 12:88669682-88669704 TCCTGAATACAGCACACCAATGG - Intergenic
1100115314 12:91296429-91296451 GCTTAAATACAGCACGCCAATGG - Intergenic
1100374925 12:94006220-94006242 TTCTGAATACAGCACACCAATGG + Intergenic
1100470126 12:94883958-94883980 TCCTGAATACAGCACACCAATGG - Intergenic
1100652163 12:96602870-96602892 TCCTGAATACAGCACACCAATGG + Intronic
1100653162 12:96612616-96612638 TCCTGAATACAGCACACCAATGG - Intronic
1100896487 12:99187920-99187942 TCCTGAATACAGCACACCAATGG - Intronic
1101066763 12:101029406-101029428 TCCTGAATACAGCACACCAATGG - Intronic
1102823229 12:115925682-115925704 TGTTAAATAGATCAAACCATGGG - Intergenic
1103844483 12:123891957-123891979 TGTGAAGTACTGCCCACCAGGGG + Intronic
1104086497 12:125479339-125479361 TCCTAAATACAGCACACTAATGG - Intronic
1106326106 13:28691987-28692009 TCCTGAATACAGCACACCAATGG + Intergenic
1106954957 13:34926984-34927006 TTTTAAATACAGCCCAACAATGG + Intergenic
1107069761 13:36257043-36257065 TGTTAAAGACAGAACACTAGTGG - Intronic
1107243900 13:38269218-38269240 TCTTAAATACAGCACACCGATGG - Intergenic
1107648396 13:42518507-42518529 TCCTGAATACAGCACACCAATGG - Intergenic
1107764733 13:43721968-43721990 TGTTAAACAGACCACACCTGGGG + Intronic
1107968615 13:45620288-45620310 TCCTGAATACAGCACACCAATGG + Intergenic
1108151039 13:47534717-47534739 TCCTGAATACAGCACACCAATGG + Intergenic
1108304838 13:49120568-49120590 TCCTGAATACAGCACACCAATGG - Intronic
1108425761 13:50298267-50298289 TCCTGAATACAGCACACCAATGG + Intronic
1109535853 13:63718424-63718446 TGTTGAAGACAGCATACCACTGG - Intergenic
1109540248 13:63767862-63767884 TGTTGAAGACAGCATACCACTGG + Intergenic
1109635316 13:65107822-65107844 TCCTGAATACAGCACACCAATGG + Intergenic
1109661469 13:65466245-65466267 TCCTGAATACAGCACACCAGTGG + Intergenic
1109894169 13:68660913-68660935 TTTTAAATATATCACACCATGGG + Intergenic
1110020187 13:70459628-70459650 TACTGAATACAGCACACCAATGG - Intergenic
1110135722 13:72064495-72064517 TCCTGAATACAGCACACCAATGG - Intergenic
1110389946 13:74961695-74961717 TCCTGAATACAGCATACCAGTGG - Intergenic
1110631230 13:77710306-77710328 TCCTGAATACAGCACACCAATGG - Intronic
1110790216 13:79579788-79579810 TCCTGAATACAGCACACCAATGG + Intergenic
1110821609 13:79924144-79924166 TCTTGAATACAGCACACCAATGG + Intergenic
1110850021 13:80234174-80234196 TATAAAATACTGCAGACCAGGGG - Intergenic
1110890514 13:80691867-80691889 TCCTAAATACAGCACACCAATGG - Intergenic
1111740562 13:92199848-92199870 TGTTATATACAGCAGTCTAGAGG - Intronic
1112619934 13:101044816-101044838 TCCTAAATACAGCACACCAATGG + Intergenic
1113755779 13:112809682-112809704 TGTGAGAGACTGCACACCAGGGG - Intronic
1114071949 14:19118339-19118361 TTTTAAATACAGCCCAACAGTGG + Intergenic
1114090309 14:19281625-19281647 TTTTAAATACAGCCCAACAGTGG - Intergenic
1114133309 14:19818596-19818618 TCCTGAATACAGCACACCAATGG + Intronic
1114360755 14:21969524-21969546 TGCTGAATACAGCACACCGATGG - Intergenic
1114365040 14:22016718-22016740 TGTTACAGAGACCACACCAGTGG + Intergenic
1114706193 14:24728743-24728765 TCCTGAATACAGCACACCAATGG - Intergenic
1114710297 14:24770667-24770689 TTCTGAATACAGCACACCAATGG - Intergenic
1115018253 14:28642862-28642884 TCCTGAATACAGCACACCAATGG + Intergenic
1115276830 14:31619198-31619220 TCCTGAATACAGCACACCAATGG + Intronic
1115818655 14:37190015-37190037 TCCTGAATACAGCACACCAATGG - Intergenic
1115883615 14:37947036-37947058 TCTTGAAGACAGCATACCAGTGG - Intronic
1116236278 14:42283531-42283553 TCCTGAATACAGCACACCAATGG + Intergenic
1116273136 14:42798182-42798204 TCCTGAATACAGCACACCAATGG + Intergenic
1116765387 14:49064015-49064037 TCCTAAATATAGCACACCAGTGG - Intergenic
1116771231 14:49129685-49129707 TCCTAAATACAGCACACCGATGG + Intergenic
1117172632 14:53115953-53115975 TCTTGAATACAGCACACCAATGG - Intronic
1117299011 14:54405753-54405775 TCCTGAATACAGCACACCAATGG + Intronic
1117856577 14:60040673-60040695 TCCTGAATACAGCACACCAATGG + Intronic
1118479215 14:66146398-66146420 TCTTCAATATAGCACACCAATGG - Intergenic
1118515862 14:66528376-66528398 TCCTGAATACAGCACACCAATGG + Intronic
1118521392 14:66589463-66589485 TCCTAAATACAGCACATCAATGG - Intronic
1118796127 14:69146550-69146572 TATTAAGTATAGCAAACCAGAGG + Intronic
1120121593 14:80686654-80686676 TCTTGAATAGAGCACACCAATGG - Intronic
1120137499 14:80886857-80886879 TCCTGAATACAGTACACCAGTGG - Intronic
1120799397 14:88671629-88671651 TCTTGAATATAGCACACCAGTGG - Intronic
1120842933 14:89102731-89102753 TCCTGAATACAGCACACCAATGG + Intergenic
1121470513 14:94150572-94150594 TCCTGAATACAGCACACCAATGG + Intronic
1121899206 14:97676791-97676813 TCCTGAATACAGCACACCAATGG - Intergenic
1123429013 15:20198742-20198764 TCCTGAATACAGCACACCAATGG + Intergenic
1123496030 15:20827902-20827924 TCCTGAATACAGCACACCAATGG - Intergenic
1123552518 15:21396995-21397017 TCCTGAATACAGCACACCAATGG - Intergenic
1123576395 15:21674405-21674427 TCCTGAATACAGCACACCAATGG + Intergenic
1123588761 15:21834391-21834413 TCCTGAATACAGCACACCAATGG - Intergenic
1123613019 15:22116873-22116895 TCCTGAATACAGCACACCAATGG + Intergenic
1124046311 15:26153910-26153932 TCTTGAATACAGCACACCCATGG + Intergenic
1125227397 15:37410351-37410373 TCCTGAATACAGCACACCAATGG - Intergenic
1125779283 15:42250180-42250202 TCCTGAATACAGCACACCAATGG + Intronic
1126043278 15:44613672-44613694 TGTAAAATACAACACAAGAGTGG - Intronic
1126554309 15:49968351-49968373 TCCTGAATACAGCACACCAGTGG - Intronic
1126871488 15:52993444-52993466 TCTTGAATACAGCATACCAATGG + Intergenic
1127317636 15:57813041-57813063 TCCTGAATACAGCACACCAATGG + Intergenic
1127511317 15:59644531-59644553 TGCTAAACTCAGCTCACCAGTGG - Intronic
1128852286 15:70971896-70971918 TGCTGAATACAGCACACCAATGG + Intronic
1128856903 15:71025589-71025611 TCTTGAATACAGCACACCGATGG - Intronic
1129971622 15:79782566-79782588 TCTTGAAGACAGCATACCAGTGG - Intergenic
1130532242 15:84756329-84756351 TGTAAACTACAGCAAACCAGGGG - Intronic
1202960864 15_KI270727v1_random:124225-124247 TCCTGAATACAGCACACCAATGG - Intergenic
1202985263 15_KI270727v1_random:408650-408672 TCCTGAATACAGCACACCAATGG + Intergenic
1133956710 16:10450728-10450750 TCCTGAATACAGCACACCAATGG + Intronic
1134767397 16:16772911-16772933 TCCTGAATACAGCACACCAATGG + Intergenic
1135807791 16:25558372-25558394 TCCTGAATACAGCACACCAATGG - Intergenic
1136150586 16:28345711-28345733 GGTTAAAAACAGCACTCCAATGG + Intronic
1136166823 16:28459549-28459571 GGTTAAAAACAGCACTCCAATGG + Intronic
1136196152 16:28655483-28655505 GGTTAAAAACAGCACTCCAATGG - Intronic
1136212492 16:28769606-28769628 GGTTAAAAACAGCACTCCAATGG - Intronic
1136855309 16:33650986-33651008 TCCTGAATACAGCACACCAGTGG - Intergenic
1137231380 16:46570387-46570409 TTTTCAGTACAGCACTCCAGTGG + Intergenic
1137828329 16:51519008-51519030 TCCTGAATACAGCACACCAATGG - Intergenic
1138776708 16:59731653-59731675 TCTTGAAGACAGCACACCATTGG - Intronic
1139617900 16:68111536-68111558 TCTTGAATACAGCACACCAATGG + Intronic
1140182473 16:72734444-72734466 TCTTGAATACAGCACACCAATGG + Intergenic
1203116894 16_KI270728v1_random:1499467-1499489 TCCTGAATACAGCACACCAGTGG - Intergenic
1144432008 17:15200780-15200802 TCTTGAATACAGCACACTGGAGG - Intergenic
1146746096 17:35331848-35331870 TCTTGAATATAGCACACCAATGG + Intergenic
1148967626 17:51449222-51449244 TCCTGAATACAGCACACCAATGG - Intergenic
1149179264 17:53914951-53914973 TCCTGAATACAGCACACCAATGG - Intergenic
1149212406 17:54318591-54318613 TCCTGAATACAGCACACCAATGG - Intergenic
1149225307 17:54463807-54463829 TCCTGAATACAGCACACCAATGG + Intergenic
1149351978 17:55799487-55799509 TCCTGAATACAGCACACCAATGG + Intronic
1149862700 17:60132390-60132412 TGTTAGAGACAGAACTCCAGAGG + Intergenic
1150190253 17:63231180-63231202 TCTTGAATACAGCATACCAAGGG + Intronic
1153796493 18:8627920-8627942 TATTAAATACAGCAAATAAGAGG + Intronic
1153997057 18:10452046-10452068 TGTTAAATCCAGCACAGAATCGG - Intergenic
1154453433 18:14500406-14500428 TCCTGAATACAGCACACCAATGG - Intergenic
1155006922 18:21737606-21737628 TCCTGAATACAGCACACCAATGG - Intronic
1155253817 18:23977277-23977299 TCTTGAATACAGCACAACAGTGG + Intergenic
1156626654 18:38918183-38918205 TCCTGAATACAGCACACCAATGG + Intergenic
1157071976 18:44418446-44418468 TCCTGAATACAGCACACCAATGG - Intergenic
1157955307 18:52090404-52090426 TTTTAATTACAGCACATCAAAGG + Intergenic
1158145508 18:54307996-54308018 TCCTCAATACAGCACACCAATGG + Intronic
1158297447 18:56014462-56014484 TCCTGAATACAGCACACCAGTGG + Intergenic
1158969188 18:62650601-62650623 TGTTTATTACAGCACTTCAGTGG - Intergenic
1158983440 18:62788480-62788502 TGTTATAAACAGCACACAAAAGG - Intronic
1159076883 18:63690296-63690318 TCTTGAATACAGCACACCAACGG - Intronic
1159646372 18:70922899-70922921 TCTTGAATACAGAACACCAACGG - Intergenic
1159984294 18:74823439-74823461 TCCTGAATACAGCACACCAATGG - Intronic
1160466062 18:79077568-79077590 TGTTAAATACAATGTACCAGAGG + Intronic
1162023158 19:7877680-7877702 AGTTACAGACAGCACATCAGTGG + Intergenic
1163963640 19:20722550-20722572 TCCTGAATACAGCACACCAATGG + Intronic
1164002447 19:21114559-21114581 TCTTGAATACAGCACACAAATGG + Intronic
1164058924 19:21648274-21648296 TCTTGAATACAGCACACCAGTGG + Intergenic
1164152155 19:22564267-22564289 TCCTGAATACAGCACACCAATGG + Intergenic
1164232252 19:23300530-23300552 TCTTGAAGACAGCATACCAGTGG + Intergenic
1164599980 19:29554646-29554668 TCTTGAATACAGCACACCAATGG - Intronic
1165239339 19:34451910-34451932 TGTTAAACAGAGCACAGTAGAGG + Intronic
1166263412 19:41659259-41659281 TCCTGAATACAGCACACCAATGG - Intronic
1166904555 19:46098421-46098443 TCTTGAATACAGCACACCAATGG + Intergenic
925245087 2:2375344-2375366 TCCTGAATACAGCACACCAATGG + Intergenic
926483217 2:13425730-13425752 TCCTAAATACGGCACACCAGTGG + Intergenic
926970410 2:18462127-18462149 TGCTGAATACAGCACACCAATGG + Intergenic
927021098 2:19018484-19018506 TCCTGAATACAGCACACCAATGG + Intergenic
928033764 2:27802791-27802813 TGTTAAATTCCTCACTCCAGGGG - Intronic
928480824 2:31681941-31681963 TCCTGAATACAGCACACCAATGG + Intergenic
929062678 2:37939802-37939824 CCCTAAATACAGCACACCAATGG + Intronic
929064517 2:37960555-37960577 TCCTGAATACAGCACACCAATGG + Intronic
929405789 2:41639384-41639406 TCTTGAATACAGCACAACAATGG - Intergenic
929618319 2:43329968-43329990 TGTGAAATAGAGGAGACCAGGGG - Intronic
930040072 2:47115371-47115393 TGATAAATACAGCAAAACAAAGG - Intronic
930223074 2:48765474-48765496 TCATGAATACAGCACACCAATGG + Intronic
930455524 2:51603900-51603922 TCTTGAATATAGCACACCAGTGG + Intergenic
930581263 2:53215379-53215401 TCTTGAATACAGCACACCAGTGG + Intergenic
930622983 2:53663753-53663775 TCCTGAATACAGCACACCAATGG - Intronic
930860114 2:56063463-56063485 TCCTGAATACAGCACACCAGTGG + Intergenic
930933164 2:56914414-56914436 TCCTGAATACAGCACACCAATGG + Intergenic
931886486 2:66623904-66623926 TCCTGAATACAGCACACCAATGG + Intergenic
931889814 2:66659707-66659729 TCTTAAAGACAGCATACCAATGG + Intergenic
932129645 2:69176336-69176358 TTGTAAATACAACACTCCAGAGG - Intronic
932646551 2:73509162-73509184 TCCTGAATACAGCACACCAATGG + Intronic
932826970 2:74949929-74949951 TCCTGAATACAGCACACCAATGG - Intergenic
932938737 2:76137697-76137719 TCCTTAATACAGCACACCAACGG + Intergenic
933318119 2:80739049-80739071 TGCTGAATACAGCACACCAGTGG - Intergenic
933412971 2:81949132-81949154 TCCTGAATACAGCACACCAATGG + Intergenic
933534570 2:83556218-83556240 TCTTGAATACAGCACACCAATGG + Intergenic
935003373 2:99044252-99044274 TCCTGAATACAGCACACCAGTGG - Intronic
935711232 2:105900986-105901008 TCTTGAATACAGCATACCAATGG + Intergenic
935952428 2:108343272-108343294 TCTTGAATACAGCACACCTATGG + Intergenic
936519141 2:113200896-113200918 TGTTAGTTACAGCACTCCAAGGG + Intronic
936775130 2:115963929-115963951 TCCTGAATACAGCACACCAATGG + Intergenic
938486199 2:131711760-131711782 TTTTAAATACAGCCCAACAATGG + Intergenic
938549255 2:132365010-132365032 TCCCAAATACAGCACACCACTGG - Intergenic
939193179 2:138940870-138940892 TCTTGAATACAGCACACCGATGG + Intergenic
939365169 2:141221130-141221152 TCTTGAATACAGCACATCAATGG - Intronic
939391357 2:141572658-141572680 TCCTCAATACAGCACACCAATGG - Intronic
939640613 2:144636577-144636599 TCCTGAATACAGCACACCAATGG + Intergenic
939876468 2:147584354-147584376 TCCTGAATACAGCACACCATGGG + Intergenic
940030325 2:149255589-149255611 TCCTGAATACAGCACACCAATGG + Intergenic
940273097 2:151913081-151913103 TCCTGAATACAGCACACCAATGG + Intronic
940437523 2:153671779-153671801 TCCTGAATACAGCACACCAACGG - Intergenic
940602826 2:155882434-155882456 TCCTGAATACAGCACACCAATGG - Intergenic
940731070 2:157392595-157392617 TCTTAAAGACAGCATACCACTGG + Intergenic
940808060 2:158210039-158210061 TCTTGAATAGAGCACACCAATGG - Intronic
940925395 2:159358191-159358213 TCCTGAATACAGCACACCAAAGG - Intronic
940946746 2:159625902-159625924 TCCTGAATACAGCACACCAATGG - Intergenic
941149020 2:161890704-161890726 TCCTGAATACAGCACACCAATGG + Intronic
941169915 2:162124372-162124394 TTTTGAATAAAGAACACCAGGGG + Intergenic
941559827 2:167031108-167031130 TCCTGAATACAGCACACCAATGG + Intronic
941845535 2:170128136-170128158 TCCTGAATACAGCACACCAATGG - Intergenic
941973471 2:171378164-171378186 TCTTGAGTACAGCACACCAATGG - Intronic
942638411 2:178034124-178034146 TCCTGAATACAGCACACCAATGG - Intronic
942728893 2:179041643-179041665 TCTTAAAGACAGCATACCAATGG - Intronic
943296317 2:186144588-186144610 TCGTGAATACAGCACACCAATGG - Intergenic
943410017 2:187534795-187534817 TCCTGAATACAGCACACCAATGG - Intronic
943837056 2:192526703-192526725 TCCTGAATACAGCACACCAATGG - Intergenic
944385327 2:199157039-199157061 TTCTGAATACAGCACACCAATGG - Intergenic
944439187 2:199725296-199725318 TCTTGAATACAGTACACCAATGG + Intergenic
944918268 2:204383677-204383699 TCTTGAATACAGCACACCAATGG + Intergenic
945161647 2:206898129-206898151 TCCTGAATACAGCACACCAATGG + Intergenic
945211776 2:207390642-207390664 TGGTACATACAACACACCAAGGG + Intergenic
945329508 2:208523474-208523496 TCCTGAATACAGCACACCAATGG + Intronic
945389224 2:209243646-209243668 TCCTGAATACAGCACACCAATGG - Intergenic
945409415 2:209490506-209490528 TCCTGAATGCAGCACACCAGCGG - Intronic
945481341 2:210349462-210349484 TCCTGAATACAGCACACCAGTGG + Intergenic
945524199 2:210867858-210867880 TCTTGAATACAGCACACCGATGG - Intergenic
945666944 2:212755003-212755025 TCCTGAATACAGCACACCAGTGG - Intergenic
945678518 2:212884670-212884692 TCCTGAATACAGCACACCAATGG - Intergenic
945927639 2:215821554-215821576 TCCTGAATACAGCACACCAATGG - Intergenic
946786934 2:223257313-223257335 TCTTGAATACAGCACACTAATGG + Intergenic
947364904 2:229383488-229383510 TCCTGAATACAGCACACCAATGG - Intronic
947479961 2:230490408-230490430 TCCTGAATACAGCACACCAATGG + Intronic
948598470 2:239095391-239095413 TGTTAGATACAGCCCCTCAGGGG - Intronic
1168732600 20:98970-98992 TCCTGAATACAGCACACCAATGG - Intergenic
1169176868 20:3524135-3524157 TCCTAAATACAGCACACCGATGG - Intronic
1169421104 20:5461316-5461338 TCCTAAATACAGCACACCAATGG + Intergenic
1170011690 20:11730223-11730245 TCTTGAATACAGCACACCAGTGG - Intergenic
1170454842 20:16522248-16522270 TCCTGAATACAGCACACCAATGG - Intronic
1170496815 20:16932852-16932874 TCCTGAATACAGCACACCAAAGG - Intergenic
1170530279 20:17284356-17284378 TGTGACATACAGCACACTATTGG + Intronic
1170730211 20:18967640-18967662 TCCTGAATACAGCACACCAATGG - Intergenic
1170796910 20:19555789-19555811 TGACAAATACACCACACCAAGGG + Intronic
1171001087 20:21416048-21416070 TCCTGAATACAGCACACCAATGG - Intergenic
1171195137 20:23191016-23191038 TGTTCAATACAGCTTACCTGGGG - Intergenic
1171397644 20:24848323-24848345 TCCTGAATACAGCACACCAATGG + Intergenic
1172487427 20:35306781-35306803 TGGAACATACAGCACAGCAGTGG + Intronic
1173149612 20:40554963-40554985 TCTTAAATACAGCACACTGGTGG - Intergenic
1173750927 20:45476088-45476110 TCCTGAATACAGCACACCAATGG + Intronic
1173764356 20:45593943-45593965 TCTTGAATACAGCACACAGGTGG + Intergenic
1174608874 20:51782453-51782475 TGTTACAGAAAACACACCAGTGG - Intergenic
1175605194 20:60307083-60307105 TGTTAATCAAAGCAAACCAGAGG + Intergenic
1175619569 20:60431886-60431908 TTTTGAAGACAGTACACCAGTGG + Intergenic
1176589015 21:8622203-8622225 TGTTCAAAACTGCAGACCAGGGG - Intergenic
1176987386 21:15453764-15453786 TCTTGAATATAGCACACCAATGG + Intergenic
1177050503 21:16226837-16226859 TCCTCAATACAGCACACCAATGG - Intergenic
1177129890 21:17242722-17242744 TCCTAAATACAGCACACCAATGG - Intergenic
1177133401 21:17283972-17283994 TCTTGAATACAGCACACCAATGG - Intergenic
1177242135 21:18472721-18472743 TTTTAAGTACAGCAAATCAGTGG + Intronic
1177280318 21:18973540-18973562 TCCTAAAGACAGCACACCAATGG - Intergenic
1177313444 21:19426387-19426409 TCCTGAATACAGCACACCAATGG - Intergenic
1177694802 21:24557051-24557073 TCCTGAATACAGCACACCATTGG - Intergenic
1178033687 21:28556869-28556891 TCTTGAATACAGCACACCAATGG - Intergenic
1178159926 21:29900360-29900382 TCCTGAATACAGCACACCAATGG - Intronic
1178393842 21:32222019-32222041 TCCTGAATACAGCACACCAATGG - Intergenic
1180271839 22:10599200-10599222 TGTTCAAAACTGCAGACCAGGGG - Intergenic
1180490391 22:15840694-15840716 TTTTAAATACAGCCCAACAATGG + Intergenic
1180888380 22:19265553-19265575 TGATAAAAATAGCACAACAGAGG + Intronic
1181143956 22:20830557-20830579 TCTTAAAGACAGCATACCATTGG + Intronic
1181445444 22:22969241-22969263 TCCTGAATACAGCACACCAATGG - Intergenic
1182204752 22:28612054-28612076 TCCTGAATACAGCACACCAATGG - Intronic
1182243235 22:28934152-28934174 TGGTAAAGAAAGCACTCCAGAGG - Intronic
1182938723 22:34253369-34253391 TCCTGAATATAGCACACCAGTGG + Intergenic
949138304 3:599566-599588 TGTTCAAAACTGCAGACCAGGGG + Intergenic
949377859 3:3409561-3409583 TCCTGAATACAGCACACCAATGG - Intergenic
949640210 3:6028210-6028232 TCCTGAATACAGCACACCAATGG + Intergenic
950922869 3:16713443-16713465 TCTTGAAGACAGCATACCAGTGG + Intergenic
950925140 3:16732874-16732896 TCCTGAATACAGCACACCAATGG - Intergenic
951197948 3:19845288-19845310 TCCTGAATACAGCACACCAATGG + Intergenic
951653506 3:24979687-24979709 TCCTGAATACAGCACACCAAAGG + Intergenic
951818773 3:26785188-26785210 TCCTGAATACAGCACACCAATGG - Intergenic
951951648 3:28204931-28204953 TCCTGAATACAGCACACCAATGG - Intergenic
951957548 3:28274002-28274024 TCTTGAATACAGCACACTAATGG + Intronic
952098398 3:29983329-29983351 TCCTGAATACAGCACACCAATGG + Intronic
952574767 3:34761043-34761065 TCTTGAATACAGTACACCAATGG - Intergenic
952694812 3:36252179-36252201 TCTTGAATACAGCACACCAATGG - Intergenic
953047457 3:39306756-39306778 TACTTAATACAGCACACCAATGG - Intergenic
953212994 3:40892872-40892894 TGTTAGATACAGCACAGCCCAGG - Intergenic
953523113 3:43661633-43661655 TCCTAAATACAGCACACCTATGG - Intronic
953526517 3:43694528-43694550 TGTTAAGTAGAGTACACCTGTGG + Intronic
953555003 3:43938352-43938374 TCCTGAATACAGCACACCAATGG + Intergenic
953652465 3:44820159-44820181 TCCTGAATACAGCACACCAATGG + Intronic
953895144 3:46792176-46792198 TCCTGAATACAGCACACCAATGG - Intronic
954529029 3:51302341-51302363 TCTCGAATACAGCACACCAATGG + Intronic
954531366 3:51322880-51322902 TCTTGAATACAGCACACCGATGG - Intronic
955657598 3:61261745-61261767 TCCTGAATACAGCACACCAATGG + Intergenic
956157116 3:66310413-66310435 TCCTGAATACAGCACGCCAGTGG + Intronic
956157678 3:66316026-66316048 TCTTGAATACAGCACAGCAATGG + Intronic
956241903 3:67140318-67140340 TCCTGAATACAGCACACCAATGG + Intergenic
956243642 3:67156505-67156527 TCCTGAATACAGCACACCAATGG - Intergenic
957596384 3:82272318-82272340 TCCTGAATACAGCACACCAATGG + Intergenic
957689898 3:83554160-83554182 TCTTAAACACAGCACACCAAGGG + Intergenic
957696611 3:83648072-83648094 TCTTGAATATAGCACACCAATGG + Intergenic
958515625 3:95111729-95111751 TCTTGAATACAGCACACCAATGG + Intergenic
958520701 3:95182666-95182688 TCCTGAATACAGCACACCAAAGG + Intergenic
959519981 3:107314651-107314673 TCTTAAAGACAGCACACCACTGG + Intergenic
959848308 3:111058895-111058917 TCCTGAATACAGCACACCAATGG - Intergenic
959875896 3:111381461-111381483 TCCTGAATACAGCACACCAATGG - Intronic
959883309 3:111471786-111471808 TGTTAAATACAGCACACCAGTGG + Intronic
960012794 3:112851510-112851532 TCTTGAAGACAGCACACCATTGG - Intergenic
960491350 3:118320196-118320218 TCCTGAATACAGCACACCAAGGG + Intergenic
961420979 3:126803292-126803314 TCCTGAATACAGCACACCAATGG - Intronic
961977756 3:131044324-131044346 TCCTGAATACAGCACACCAATGG - Intronic
962064610 3:131965452-131965474 TCCTGAATACAGCACACCAGTGG - Intronic
962125075 3:132608352-132608374 TCCTGAATACAGCACACCAATGG - Intronic
962180863 3:133205220-133205242 TCCTGAATACAGCACACCAGTGG + Intronic
962513695 3:136128241-136128263 TCCTGAATACAGCACACCAGTGG - Intronic
962656193 3:137545917-137545939 TCCTGAATACAGCACACCAGTGG - Intergenic
963532228 3:146485015-146485037 TCCTGAATACAGCACACCAATGG - Intronic
963689477 3:148480355-148480377 TCCTGAATACAGCACACCAATGG - Intergenic
964165088 3:153694717-153694739 GATGAAATATAGCACACCAGTGG - Intergenic
964332820 3:155622489-155622511 TCCTGAATACAGCACACCAATGG - Intronic
964900789 3:161656438-161656460 TCCTAAATACAGCACACCAATGG + Intergenic
965017132 3:163172576-163172598 TCCTGAATACAGCACACCAATGG + Intergenic
965292964 3:166907805-166907827 TCCTGAATACAGCACACCAATGG + Intergenic
965343081 3:167513688-167513710 TTTTGAAGACAGCACACCAATGG - Intronic
965654817 3:170973224-170973246 TCCTGAATACAGCACACCAATGG + Intergenic
966416526 3:179694979-179695001 TGGAAAATAAAGCCCACCAGCGG + Intronic
966494003 3:180558865-180558887 TCCTGAATACAGCACATCAGTGG - Intergenic
966561227 3:181323147-181323169 CGTGAGATACAGCACACCAATGG + Intergenic
966753422 3:183344654-183344676 TCCTGAATACAGCACACCAATGG - Intronic
967758823 3:193201095-193201117 TCCTGAATACAGCACACCAATGG + Intergenic
967880694 3:194299209-194299231 TGTCATCCACAGCACACCAGCGG + Intergenic
967916435 3:194581998-194582020 TGTTTAATTCTGCACAACAGTGG + Intergenic
968860431 4:3164835-3164857 TCCTGAATACAGCACACCAATGG + Intronic
969123428 4:4926823-4926845 TCCTGAATACAGCACACCAATGG - Intergenic
970107193 4:12597690-12597712 TTTTAAATACAGCACACCAATGG - Intergenic
971481599 4:27119640-27119662 TTTTCACTACAGCACACCACAGG + Intergenic
971673384 4:29593580-29593602 TCCTGAATACAGCACACCAACGG + Intergenic
971975573 4:33681776-33681798 TGTTAAGTAAAGCATTCCAGAGG - Intergenic
971988999 4:33866469-33866491 TCCTGAATACAGCACACCAATGG - Intergenic
972178569 4:36438006-36438028 TCCTGAATACAGCACACCAATGG + Intergenic
972861202 4:43170844-43170866 TCTTGAATACAGCACACCAATGG - Intergenic
973562877 4:52153685-52153707 TCCTGAATACAGCACACCAATGG - Intergenic
973584883 4:52379801-52379823 TCCTGAATACAGCACACCAATGG - Intergenic
973661160 4:53107454-53107476 TCCTGAATACAGCACACCAATGG - Intronic
973714995 4:53667715-53667737 TCCTGAATACAGCACACCAATGG + Intronic
973883759 4:55299355-55299377 TCCTGAATACAGCACACCAATGG - Intergenic
974130305 4:57746639-57746661 TCTTGAATACAGCACACTATTGG + Intergenic
974181000 4:58384867-58384889 TCTTGAATACAGCATACCAATGG + Intergenic
974196569 4:58583531-58583553 TCTTGAATACAGCACACCAATGG + Intergenic
974209402 4:58750048-58750070 TCCTGAATACAGCACACCAATGG - Intergenic
974302294 4:60083511-60083533 TCCTGAATACAGCACACCAGTGG - Intergenic
974306871 4:60154324-60154346 TCTTGAATGCAGCACACCAATGG + Intergenic
974768887 4:66384789-66384811 TCGTGAATACAGCACACCAATGG - Intergenic
974814450 4:66987354-66987376 TCTTGAATACAGCACACCAGTGG + Intergenic
974851547 4:67410641-67410663 TCCTGAATACAGCACACCAATGG + Intergenic
974913023 4:68146807-68146829 TCTTGAATCAAGCACACCAGTGG + Intergenic
975022435 4:69505301-69505323 TCTTAAATACAGCATACCAATGG - Intronic
975123608 4:70756755-70756777 TGGTATATACAGGATACCAGGGG - Intronic
975246098 4:72121979-72122001 TCCTGAATACAGCACACCAGTGG - Intronic
975466113 4:74711878-74711900 TCCTGAATACAGCACACCAATGG + Intergenic
975750898 4:77522623-77522645 TGCTGAATACAGCACACTAATGG + Intronic
976156783 4:82154181-82154203 TCTTGAATACAGCACACCAATGG - Intergenic
976375810 4:84343379-84343401 TCTTGAATACAGCACACCAATGG - Intergenic
976585581 4:86793086-86793108 TCCTGAATACAGCACACCAATGG - Intronic
976769556 4:88636224-88636246 TCTTGAATACAGCAAACCAATGG - Intronic
977040016 4:92003879-92003901 TCTTGAATACAGCATACCAATGG - Intergenic
977326264 4:95578701-95578723 TTCTGAATACAGCACACCAATGG + Intergenic
977467518 4:97401260-97401282 TCCTGAATACAGCATACCAGTGG + Intronic
977524102 4:98124091-98124113 TCTTGAATACAGCACACCGATGG + Intronic
977631254 4:99246134-99246156 TCCTGAATACAGCACACCAATGG + Intergenic
977793224 4:101131323-101131345 TCCTGAATACAGCACACCAATGG - Intronic
978206400 4:106085174-106085196 TCCTGAATACAGCACACCAATGG - Intronic
978940654 4:114432538-114432560 TCTTAAAGACAGCATACCATTGG + Intergenic
978973207 4:114836025-114836047 TCCTGAATACAGCATACCAGTGG + Intronic
979119905 4:116884463-116884485 TCCTAAATACAGCACACCTATGG - Intergenic
979501118 4:121441200-121441222 TCCTAAATACAGCACACCGATGG + Intergenic
979581603 4:122367030-122367052 TTCTGAATACAACACACCAGTGG - Intergenic
979588015 4:122444225-122444247 TCTTGAATACAGCACACCAGTGG + Intergenic
979735270 4:124074817-124074839 TCCTGAATACAGCACACCAATGG - Intergenic
980147928 4:129012923-129012945 TCTTAAAGACAGCATACCAACGG + Intronic
980148973 4:129023374-129023396 TCCTGAATACAGCACACCAATGG - Intronic
980157401 4:129124441-129124463 TCCTGAATACAGCCCACCAGTGG + Intergenic
980184866 4:129448287-129448309 TCCTGAATACAGCACACCAATGG - Intergenic
980200822 4:129653735-129653757 TCCTAAATACAGCACAACAATGG - Intergenic
980330175 4:131401527-131401549 TCCTGAATACAGCACACCAATGG + Intergenic
980512722 4:133814304-133814326 TCTTGAATACAGCAAACCAATGG - Intergenic
980732985 4:136846808-136846830 TCCTGAATACAGCACACCAATGG + Intergenic
980744440 4:136997434-136997456 TCCTGAATACAGCACACCAATGG + Intergenic
981187244 4:141817915-141817937 TCCTGAATACAGCACACCAATGG - Intergenic
981199892 4:141967925-141967947 TCCTGAATACAGCACACCAATGG - Intergenic
981395868 4:144248399-144248421 TCCTGAATACAGCACACCAATGG + Intergenic
981477019 4:145197333-145197355 TGTTAAATTCTGCAAATCAGAGG + Intergenic
981631650 4:146826023-146826045 TCTTGAATACAGCACACCAATGG + Intronic
981662735 4:147186103-147186125 TCCTGAATACAGCACACCAATGG - Intergenic
981794708 4:148583407-148583429 TCCTGAATACAGCACACCAATGG + Intergenic
981846751 4:149178072-149178094 TCCTGAATACAGCACACCAATGG - Intergenic
982298724 4:153857643-153857665 TCCTGAATACAGCACACCAATGG + Intergenic
982393848 4:154894189-154894211 TCCTGAATACAGCACACCAGTGG - Intergenic
982625260 4:157758727-157758749 TCCTGAATACAGCACACCAATGG + Intergenic
983044277 4:162967781-162967803 TTCTGAATACAGCACACCAATGG + Intergenic
983791508 4:171803153-171803175 TCCTGAATACAGCACACCAATGG + Intergenic
983957955 4:173718725-173718747 TCTTGAATACAGCACACCAATGG - Intergenic
984008839 4:174346517-174346539 TCCTGAATACAGCACACCAATGG + Intergenic
984789030 4:183597007-183597029 TGATACATACAGCAAATCAGGGG + Intergenic
985193776 4:187406334-187406356 TCCTGAATACAGCACACCAATGG + Intergenic
985271078 4:188195839-188195861 TGTTAAAAACTGCAATCCAGTGG - Intergenic
985808065 5:2062488-2062510 TCCTGAATACAGCACACCAATGG + Intergenic
986011637 5:3722288-3722310 TCTTGAATACAGTACACCAATGG + Intergenic
986110587 5:4711870-4711892 TCTTGAATACAGCACACCGATGG - Intergenic
986149406 5:5113577-5113599 TCCTGAATACAGCACACCAATGG + Intergenic
986358762 5:6954341-6954363 TCCTGAATACAGCACACCAATGG - Intergenic
986484574 5:8222250-8222272 TCCTGAATACAGCACACCAATGG - Intergenic
986675412 5:10179865-10179887 TCCTGAATACAGCACACCAGTGG - Intergenic
987687820 5:21227488-21227510 TGCTGAATACAGCACACCGATGG - Intergenic
987804069 5:22739767-22739789 TGTTAAATACTTCATAACAGAGG - Intronic
988076336 5:26360477-26360499 TCCTGAGTACAGCACACCAGTGG + Intergenic
988290033 5:29272554-29272576 TCCTGAATACAGCACACCAATGG - Intergenic
988300020 5:29411247-29411269 GATAAAATACAGCACATCAGTGG + Intergenic
988775204 5:34471313-34471335 TCCTGAATACAGCACACCAATGG - Intergenic
989092286 5:37745505-37745527 TCCTGAATACAGCACACCAATGG - Intronic
989140095 5:38193443-38193465 TGTAAAACACACCAAACCAGAGG - Intergenic
989194395 5:38701856-38701878 TCCTAGATACAGCACACCAATGG - Intergenic
989305651 5:39952250-39952272 TCTTGAATACAGCACACCAGTGG - Intergenic
990016243 5:51065610-51065632 TCCTGAATACAGCACACCAATGG - Intergenic
990138852 5:52680586-52680608 CTCTGAATACAGCACACCAGTGG + Intergenic
990607567 5:57425839-57425861 TGTTACAGAAAACACACCAGTGG + Intergenic
990899134 5:60731094-60731116 TCCTGAATACAGCACACCAATGG - Intergenic
990940504 5:61198732-61198754 TCTTGAATACAGCACACTAATGG + Intergenic
991025492 5:62025177-62025199 TCCTGAATACAGCACACCAGGGG + Intergenic
991046547 5:62229185-62229207 TCCTGAATACAGCACACCAATGG + Intergenic
991151704 5:63378051-63378073 TCCTGAATACAGCACACCAATGG - Intergenic
991158067 5:63461458-63461480 TGTTGAAGACAGCATACCATCGG - Intergenic
991236925 5:64409111-64409133 TCCTGAATACAGCACACCAATGG - Intergenic
991283002 5:64938018-64938040 TCCTGAATACAGCACACCAATGG + Intronic
992038646 5:72806941-72806963 TCCTCAATACAGCACACCAATGG + Intergenic
992078104 5:73209295-73209317 TCTTGAATACAGCACACCAATGG - Intergenic
992288150 5:75256521-75256543 TCCTGAATACAGCACACCAATGG - Intergenic
992336274 5:75773464-75773486 TCCTAAATACAGCACACCGATGG + Intergenic
992740386 5:79768213-79768235 TCCTGAATACAGCACACCAGTGG + Intronic
993119374 5:83755681-83755703 TCCTGAATACAGCACACCAATGG - Intergenic
993175404 5:84478733-84478755 TGCCACATACAGCTCACCAGAGG + Intergenic
993265709 5:85723542-85723564 TCTTGATTACAGCATACCAGTGG - Intergenic
993420761 5:87698631-87698653 TCTTGAATACAGCACACCAGTGG + Intergenic
993451090 5:88072815-88072837 TCTTGAATACAGCATACCATTGG - Intergenic
993587106 5:89745132-89745154 TGATGATTACAGCACACCAATGG + Intergenic
993829513 5:92737539-92737561 TCCTGAATACAGCACACCATTGG + Intergenic
993895208 5:93525086-93525108 TCCTGAATACAGCACACCAATGG - Intergenic
993984865 5:94585268-94585290 TCCTGAATACAGCACACCAATGG - Intronic
994222650 5:97213948-97213970 TCTTGAATACAGCACACCAATGG - Intergenic
994345595 5:98681977-98681999 TCCTAAATACAGCACACTGGTGG - Intergenic
994437844 5:99761785-99761807 TCCTATATACAGCACACCAATGG + Intergenic
994600036 5:101891132-101891154 TCCTGAATACAGCACACCAATGG + Intergenic
995052451 5:107721454-107721476 TCTTGAAAACAGCACACCAATGG - Intergenic
995255683 5:110043794-110043816 TCTTGAAGACAGCATACCAGTGG + Intergenic
995398470 5:111715120-111715142 TCCTGAATACAGCACACCAATGG + Intronic
995480598 5:112588539-112588561 TCCTGAATACAGCACACCAATGG - Intergenic
995695969 5:114878457-114878479 TCCTGAATACAGCACACCAATGG - Intergenic
995808801 5:116082403-116082425 TCCTGAATACAGCACACCAATGG - Intergenic
995815956 5:116168059-116168081 TCCTGAATACAGCACACCAATGG - Intronic
996639300 5:125732510-125732532 TCTTGAATACAGCACACCAATGG - Intergenic
996958001 5:129208782-129208804 TCCTGAATACAGCACACCAATGG + Intergenic
997010162 5:129867339-129867361 TCTTGAAGACAGCACACCATTGG - Intergenic
997069915 5:130609232-130609254 TCCTGAATACAGCACACCAATGG - Intergenic
997809201 5:136951085-136951107 TCCTGAATACAGCACACCAATGG + Intergenic
1000430205 5:161142689-161142711 TCTTGAATACAGCATACCAATGG - Intergenic
1000737733 5:164926766-164926788 TCTTGAAGACAGCATACCAGTGG + Intergenic
1000738225 5:164932346-164932368 TCCTTAATACAGCACACCTGTGG + Intergenic
1000860201 5:166448439-166448461 TCTTGAAAACAGCACACCAATGG + Intergenic
1001355673 5:171020688-171020710 TCCTGAATACAGCACACCAGTGG + Intronic
1001738901 5:174033491-174033513 TCTTGAATACAGCACACCAATGG + Intergenic
1001839485 5:174862898-174862920 TCCTGAATACAGCACACCAATGG + Intergenic
1001981674 5:176042182-176042204 TGTGAGTAACAGCACACCAGGGG + Intergenic
1002007781 5:176250874-176250896 TCCTGAATACAGCACACCAATGG + Intronic
1002218603 5:177659806-177659828 TCCTGAATACAGCACACCAATGG - Intergenic
1002235793 5:177801877-177801899 TGTGAGTAACAGCACACCAGGGG - Intergenic
1002996345 6:2288758-2288780 TCCTGAATACAGCACACCAATGG - Intergenic
1003248973 6:4407870-4407892 TCCTGAATACAGCACACCAATGG - Intergenic
1003437383 6:6104279-6104301 TCTTAAAGACAGCATACCATTGG + Intergenic
1003713354 6:8618506-8618528 TCCTGAATACAGCACACCAATGG + Intergenic
1005182652 6:23123964-23123986 TGCTGAATACAGCACACCAATGG + Intergenic
1005356905 6:24993495-24993517 TCTTAAAGACAGCATACCATTGG + Intronic
1006278124 6:33022377-33022399 TGTTCAGGACAGAACACCAGTGG + Intergenic
1007134859 6:39510773-39510795 TCCTGAATACAGCACACCAATGG - Intronic
1007672715 6:43569334-43569356 TGTTAAATACATCAGAATAGTGG + Intronic
1007907388 6:45475946-45475968 TATAAAAAACAGAACACCAGAGG - Intronic
1008008095 6:46433913-46433935 TGTTAAATGCTGCACACAATTGG + Intronic
1008532185 6:52473233-52473255 TGACAAATACAGCACTGCAGAGG + Intronic
1008592281 6:53006298-53006320 TTTAAAATACAACTCACCAGGGG + Exonic
1009264336 6:61534023-61534045 TCCTGAATACAGCACACCAATGG - Intergenic
1009329061 6:62392712-62392734 TCTTGAATAAATCACACCAGTGG - Intergenic
1009783746 6:68303522-68303544 TCTTGAATACAGCACACCAATGG + Intergenic
1009897312 6:69768876-69768898 TGTGAAATAGTGGACACCAGAGG - Intronic
1009959267 6:70499395-70499417 TCTTGAATACAGCACACCAATGG + Intronic
1010038913 6:71359255-71359277 TCCTGAATACAGCACACCAATGG + Intergenic
1010331519 6:74628544-74628566 TCCTGAATACAGCACACCAATGG - Intergenic
1010446778 6:75957819-75957841 TCCTGAATACAGCACACCAATGG + Intronic
1010477224 6:76302915-76302937 TCCTGAATACAGCACACCAATGG + Intergenic
1010575148 6:77520653-77520675 TCCTGAATACAGCACACCAATGG - Intergenic
1010936820 6:81871826-81871848 TCCTGAATACAGCACACCAGTGG - Intergenic
1011377421 6:86704903-86704925 TCTTGAATACAGCACACCATTGG + Intergenic
1011472287 6:87719761-87719783 GCTTAAATACAGCAGACTAGAGG + Intergenic
1012063293 6:94513777-94513799 TCCTGAATACAGCACACCAATGG - Intergenic
1012764461 6:103348629-103348651 TTTTAAATAAAGCAAACAAGAGG + Intergenic
1012941207 6:105417236-105417258 TCCTGAATACAGCACACCAATGG - Intergenic
1013302409 6:108817021-108817043 TCTTGAATACAGCACACCGATGG + Intergenic
1013337424 6:109178143-109178165 TATTAAATACATTACACGAGAGG + Intergenic
1013682835 6:112543585-112543607 TCCTGAATACAGCACACCAATGG - Intergenic
1013919937 6:115392516-115392538 TCCTGAATACAGCACACCAATGG + Intergenic
1014176805 6:118340449-118340471 TCCTGAATACAGCACACCAATGG + Intergenic
1014475215 6:121863941-121863963 TCCTGAATACAGCACACCAATGG + Intergenic
1014864234 6:126507762-126507784 TCCTGAATACAGCACACCAATGG - Intergenic
1014872396 6:126612946-126612968 TCCTGAATACAGCACACCAATGG + Intergenic
1014890627 6:126839776-126839798 TCCTTAATACAGCACACCAATGG - Intergenic
1015318682 6:131846628-131846650 AGTTAAAAACAGCACATCAGTGG - Intronic
1015623164 6:135154267-135154289 TCCTGAATACAGCACACCAATGG + Intergenic
1015659915 6:135564153-135564175 TCTTGAATACAGCACACTAATGG + Intergenic
1015912488 6:138182976-138182998 TATAAAATAAAGCACACCATGGG - Intronic
1016242090 6:141942320-141942342 TCCTGAATGCAGCACACCAGTGG - Intergenic
1016499080 6:144698657-144698679 TTTCAAATCCAGCCCACCAGTGG + Intronic
1017197193 6:151714751-151714773 TCCTGAATACAGCACACCAATGG + Intronic
1017304047 6:152895953-152895975 TGTGATCTCCAGCACACCAGAGG - Intergenic
1017528719 6:155266482-155266504 TGCTGGATACAGCTCACCAGGGG + Intronic
1017697742 6:157035271-157035293 TGTTAAAAATAGCACATCAAGGG + Intronic
1017836303 6:158181790-158181812 TCCTGAATACAGCACACCAACGG + Intronic
1018110255 6:160530067-160530089 TCCTGAATACAGCACACCAATGG - Intergenic
1018507623 6:164488867-164488889 TCCTGAATACAGCACACCAATGG + Intergenic
1020619365 7:10499009-10499031 TCTTGAATACAGCACACTAATGG - Intergenic
1020935639 7:14460326-14460348 TCCTGAATACAGCACACCAATGG - Intronic
1021014891 7:15519884-15519906 TCCTGAATACAGCACACCAATGG - Intronic
1021141620 7:17033095-17033117 TGTTACATACAGCAGAACATAGG - Intergenic
1021187213 7:17577910-17577932 TCTTGAATACAGCACACCAATGG - Intergenic
1021188412 7:17592308-17592330 TGATAAATACAGTAGAACAGTGG - Intergenic
1021322536 7:19229091-19229113 TCCTGAATACAGCACACCAATGG - Intergenic
1021347439 7:19546164-19546186 TCCTGAATACAGCACACCAATGG + Intergenic
1021494229 7:21256456-21256478 TTTTAGAAACAGCCCACCAGAGG + Intergenic
1022058602 7:26768373-26768395 TCCTGAATACAGCACACCAATGG + Intronic
1022615855 7:31929012-31929034 TCCTGAATACAGCACACCAATGG - Intronic
1022634877 7:32121948-32121970 TCTTGAATATAGCACACCAATGG - Intronic
1022885116 7:34635115-34635137 TCCTGAATACAGCACACCAGTGG - Intergenic
1023156253 7:37255602-37255624 TGGTAAAGACAGCAAAGCAGGGG - Intronic
1023661227 7:42473003-42473025 TGTTAAATAGATCAGAACAGTGG + Intergenic
1024149970 7:46561420-46561442 TCCTAAAGACAGCACACCAATGG + Intergenic
1024495745 7:50043404-50043426 TCCTGAATACAGCACACCAATGG - Intronic
1024998288 7:55292834-55292856 TCCTGAATACAGCACACCAATGG + Intergenic
1025042096 7:55655290-55655312 TCCTGAATACAGCACACCAATGG - Intergenic
1026384805 7:69835820-69835842 TGCTATATACAACACCCCAGAGG + Intronic
1027843585 7:83343855-83343877 TCCTGAATACAGCACACCAATGG - Intergenic
1028077187 7:86531540-86531562 TCTTAAAGACAGCATACCAATGG + Intergenic
1028518263 7:91701113-91701135 TCTTGAATACAGCACACCGATGG - Intronic
1028644374 7:93078590-93078612 TCTTTAATATAGCACACCAATGG - Intergenic
1028723025 7:94055724-94055746 TCCTGAATACAGCACACCAATGG - Intergenic
1028991943 7:97058411-97058433 TCCTGAATACAGCACACCAACGG - Intergenic
1029041676 7:97582255-97582277 TCTTGAACACAGCACACCAATGG - Intergenic
1029850881 7:103460665-103460687 TTCTGAATACAGCACACCAATGG + Intergenic
1029919640 7:104249181-104249203 TCCTGAATACAGCATACCAGTGG - Intergenic
1029992290 7:104973331-104973353 TGTCAAAAACAGCACACCAGTGG - Intergenic
1030526282 7:110659041-110659063 TCCTGAATACAGCACACCATTGG + Intergenic
1030534265 7:110745979-110746001 TCCTGAATACAGCACACCATTGG - Intronic
1030612403 7:111704133-111704155 TCCTGAATACAGCACACCAATGG + Intergenic
1030759507 7:113332886-113332908 TCCTGAATACAGCACACCAATGG - Intergenic
1031032232 7:116747354-116747376 TCCTGAATACAGCACACCAATGG - Intronic
1031157289 7:118124448-118124470 TCCTGAATACAGCACACCAATGG - Intergenic
1031613530 7:123855116-123855138 TCCTGAATACAGCACACCAATGG + Intronic
1031865053 7:127029748-127029770 TCCTGAATACAGCACACCAGTGG + Intronic
1032659512 7:133968255-133968277 TCCTGAATACAGCACACCAATGG + Intronic
1033525850 7:142212431-142212453 TTCTGAATACAGCACACCAGTGG - Intronic
1033617885 7:143034248-143034270 TCCTGAATACAGCACACCAATGG - Intergenic
1034714878 7:153232918-153232940 TCCTGAATACAGCACACCAATGG + Intergenic
1034792179 7:153981456-153981478 TCCTGAATACAGCATACCAGTGG + Intronic
1035794293 8:2339115-2339137 TCCTGAATACAGCACACCAACGG - Intergenic
1038243108 8:25829078-25829100 TCTGGAATACAGCACACCAATGG + Intergenic
1038936202 8:32255106-32255128 TCCTGAATACAGCACACCAATGG + Intronic
1039302654 8:36225936-36225958 TCCTGAATACAGCACACCAATGG - Intergenic
1039402465 8:37281461-37281483 TCTTGAATACAGCACACCAATGG - Intergenic
1039658410 8:39435279-39435301 TCTTGAATACAGCACACCAATGG - Intergenic
1039764881 8:40618114-40618136 TGTTAAAACATGCACACCAGTGG - Intronic
1040668745 8:49660887-49660909 TCTTGAAGACAGCACACCAATGG - Intergenic
1040736769 8:50517518-50517540 TCCTGAATACAGCACACCAGTGG - Intronic
1040814649 8:51494507-51494529 TGCTAAATACAGCACACTGATGG - Intronic
1040942810 8:52850585-52850607 TCCTGAATACAGCACACCAATGG + Intergenic
1041287641 8:56276863-56276885 TGATGAATACAGCACAGCAATGG - Intergenic
1041418859 8:57644900-57644922 TCCTGAATACAGCACACCAATGG + Intergenic
1041615513 8:59901446-59901468 TCTTAAAGACAGCATAACAGTGG - Intergenic
1041675733 8:60537596-60537618 TCTAAAAAACATCACACCAGAGG + Intronic
1041743304 8:61179074-61179096 TCTAAAACACAGCACACCAATGG - Intronic
1041754635 8:61300418-61300440 TTTTGAAGACAGCACACCTGTGG - Intronic
1042333739 8:67608912-67608934 TGTGAAATACAGCACCCATGTGG + Intronic
1042479038 8:69282405-69282427 TCCTAAATACAGCACACTGGTGG - Intergenic
1042536381 8:69862744-69862766 TCCTGAATACAGTACACCAGTGG - Intergenic
1042633628 8:70848664-70848686 TTTTGAATACAGCACACCGATGG - Intergenic
1042812676 8:72843850-72843872 TCCTGAATACAGCACACCAATGG + Intronic
1042946418 8:74158730-74158752 TCCTGAATACAGCACACCTGTGG - Intergenic
1043025175 8:75058079-75058101 TCTTGAATACAGCACACCTATGG - Intergenic
1043304759 8:78781130-78781152 TCTTAAATACAGCTCACTAGTGG + Intronic
1043366109 8:79535386-79535408 TCCTGAATACAGCACACCAATGG + Intergenic
1043703817 8:83323834-83323856 TCCTAAATACAGCACACCAATGG - Intergenic
1043748686 8:83908392-83908414 TCCTGAATACAGCACACCAATGG + Intergenic
1044038423 8:87335618-87335640 TCTTGAATATAGCACACCAATGG + Intronic
1044113512 8:88305026-88305048 TGTTGAATACAGCATGCCAGTGG - Intronic
1044315615 8:90747419-90747441 TCTTGAATACAGCACACCAACGG + Intronic
1044509236 8:93056413-93056435 TCCTGAATACAGCACACCAATGG + Intergenic
1044940021 8:97333057-97333079 TCTTGAATACAGCACACCAATGG + Intergenic
1045595329 8:103648853-103648875 TCTTGAAGACAGCATACCAGTGG + Intronic
1045783912 8:105899240-105899262 TCCTGAATACAGCACACCAATGG - Intergenic
1045839576 8:106563197-106563219 TCCTAAATACAGCACACCAATGG - Intronic
1045973606 8:108106368-108106390 TCCCAAATACAGCACACCAATGG - Intergenic
1045978028 8:108151289-108151311 TCTTGAATACAGCACACCAATGG - Intergenic
1046153114 8:110254719-110254741 TCCTGAATACAGCACACCAATGG + Intergenic
1046342243 8:112874831-112874853 TCCTGAATACAGCACACCAATGG + Intronic
1046525027 8:115372549-115372571 TCCTGAATACAGCACACCAATGG - Intergenic
1046972300 8:120236532-120236554 TCCTGAATACAGCACACCAGTGG + Intronic
1047369346 8:124243477-124243499 TCCTGAATACAGCACACCAATGG + Intergenic
1048429086 8:134352151-134352173 CTTTGAATACAGCACACCAATGG + Intergenic
1048587474 8:135788751-135788773 TCCTGAATACAGCACACCAATGG + Intergenic
1050031995 9:1395580-1395602 TCCTGAATACAGCACACCAAAGG - Intergenic
1050141332 9:2519487-2519509 TCCTGAATACAGCACACCAATGG + Intergenic
1050393366 9:5169599-5169621 TCTTGAATTCAGCACACCAATGG - Intronic
1050407939 9:5329484-5329506 TCCTGAATACAGCACACCAAGGG - Intergenic
1050660975 9:7882089-7882111 TCATGAATACAGCACACCAATGG - Intronic
1051003409 9:12313440-12313462 TCCTGAATACAGCACACCAATGG + Intergenic
1051309031 9:15749044-15749066 TCCTGAATACAGCACACCAATGG - Intronic
1051338324 9:16087659-16087681 TGTTGAATACAGCACACTGATGG + Intergenic
1051444338 9:17124631-17124653 TGGAAAATACAAAACACCAGAGG + Intergenic
1051444522 9:17126252-17126274 TGGAAAATACAAAACACCAGAGG - Intergenic
1052063976 9:23993923-23993945 TCCTGAATACAGCACACCAATGG - Intergenic
1052096358 9:24389395-24389417 TCCTGAATACAGCACACCAATGG + Intergenic
1052199979 9:25766109-25766131 TCTTGAATACAGCACATCAGTGG - Intergenic
1052489845 9:29151485-29151507 TGTTGAAGACAGCAGACCATTGG - Intergenic
1052546874 9:29890843-29890865 TCCTAAATACAGCACACCGATGG - Intergenic
1052752972 9:32510815-32510837 TCCTGAATACAGCACACCAATGG - Intronic
1053542697 9:38991585-38991607 TTTTAAAGACAGCATACCATTGG + Intergenic
1053807148 9:41815104-41815126 TTTTAAAGACAGCATACCATTGG + Intergenic
1054623444 9:67372323-67372345 TTTTAAAGACAGCATACCATTGG - Intergenic
1055125475 9:72714679-72714701 TCCTGAATACAGCACACCAATGG + Intronic
1055572003 9:77625963-77625985 TCCTGAATACAGCACACCAAGGG - Intronic
1055794700 9:79963093-79963115 TGTTAGATTCAGCAAGCCAGTGG + Intergenic
1055894542 9:81160058-81160080 GGTTAAATTCAGCTCACAAGTGG + Intergenic
1057018108 9:91672483-91672505 TCCTGAATACAGCACACCAGTGG + Intronic
1057760748 9:97872418-97872440 GGTTAAATATGGCACATCAGTGG + Intergenic
1058072643 9:100617525-100617547 TCCTGAATACAGCACACCAATGG + Intergenic
1058074353 9:100635795-100635817 TCCTAAATACAGCACACCCATGG + Intergenic
1058260037 9:102816603-102816625 TCCTGAATACAGCACACCAGTGG - Intergenic
1058487280 9:105454699-105454721 AGGAAAATAAAGCACACCAGAGG - Intronic
1058530128 9:105898333-105898355 TCTTAAATACAGCACACCAATGG + Intergenic
1058558824 9:106202254-106202276 TCCTGAATACAGCACACCAATGG + Intergenic
1058591251 9:106567360-106567382 TCCTGAATACAGCACACCAATGG - Intergenic
1059047171 9:110881487-110881509 TGTTAAGGAGAGTACACCAGAGG - Intronic
1060026801 9:120179185-120179207 TCCTGAATACAGCACACCAATGG - Intergenic
1060038019 9:120275078-120275100 TCCTGAATACAGCACACCAATGG + Intergenic
1203619022 Un_KI270749v1:100783-100805 TGTTCAAAACTGCAGACCAGGGG - Intergenic
1185958400 X:4518434-4518456 TCTTAAATACAGTACACAACTGG - Intergenic
1186181086 X:6974117-6974139 TGTTGAATACAGCACACTGATGG + Intergenic
1186369861 X:8936064-8936086 TCCTGAATACAGCACACCAATGG + Intergenic
1186391157 X:9160870-9160892 TTCTAAACACAGCACAACAGGGG + Intronic
1186810569 X:13183854-13183876 TCCTAAATACAGCACACCAGTGG - Intergenic
1186832712 X:13406162-13406184 TCCTGAATACAGCACACCAGTGG - Intergenic
1187548361 X:20275771-20275793 TCCTGAATGCAGCACACCAGTGG - Intergenic
1187839721 X:23474919-23474941 TCCTGAATACAGCACACCAATGG + Intergenic
1188145276 X:26604349-26604371 TTCTAATTACAGCACACCTGGGG + Intergenic
1188153703 X:26714088-26714110 TGTCAGATACAGGATACCAGTGG - Intergenic
1188884575 X:35533304-35533326 TCCTGAATACAGCACACCAATGG - Intergenic
1189189052 X:39080998-39081020 TCTTAAAGACAGCATACCAATGG + Intergenic
1189243615 X:39544631-39544653 TCCTGAATACAGCACAGCAGTGG - Intergenic
1189652107 X:43201721-43201743 TCTTGAAGACAGCATACCAGTGG + Intergenic
1190494844 X:51018969-51018991 TCCTGAATACAGCACACCAATGG + Intergenic
1190972022 X:55358698-55358720 TCTTGAATAGAGCACACCAATGG - Intergenic
1191034593 X:56010689-56010711 TCTTGAATTCAGCACACCATGGG - Intergenic
1191111795 X:56809668-56809690 TCCTGAATACAGCACACCAATGG + Intergenic
1191133079 X:57035949-57035971 TCCTGAATACAGCACCCCAGTGG + Intergenic
1191147200 X:57179350-57179372 TCTTGAAGACAGCACACCAATGG - Intergenic
1191153478 X:57244957-57244979 TCCTGAATACAGCACACCAATGG - Intergenic
1191154227 X:57254013-57254035 TCCTGAATACAGCACACCAATGG - Intergenic
1191632168 X:63333258-63333280 TACTGAATACAGCACACCAATGG - Intergenic
1191705326 X:64087844-64087866 TCTTGAATACAGCACACCGATGG - Intergenic
1191725560 X:64277160-64277182 TCCTGAATACAGCACACCAATGG + Intronic
1191762393 X:64660129-64660151 TCCTGAATACAGCACACTAGTGG + Intergenic
1191766347 X:64703123-64703145 TCTTGAATACAGCACACCAATGG + Intergenic
1191785224 X:64909812-64909834 TGGTGAATACAGCACAGCAATGG - Intergenic
1191933647 X:66402866-66402888 TCTTAAAGACAGCATACCAATGG + Intergenic
1192026566 X:67458651-67458673 TCCTGAATACAGCACACCAATGG - Intergenic
1192064055 X:67862642-67862664 TCCTGAATACAGCACACCAATGG + Intergenic
1192598784 X:72439541-72439563 TCCTGAATACAGCACACCAATGG - Intronic
1192679029 X:73231815-73231837 TCCTGAATACAGCACACCAATGG - Intergenic
1192701943 X:73483341-73483363 TCCTGAATACAGCACACCACTGG - Intergenic
1192707965 X:73547173-73547195 TCCTGAATACAGCACACCAATGG - Intergenic
1192883409 X:75312042-75312064 TCCTGAATACAGCACACCAATGG + Intergenic
1192997287 X:76525743-76525765 TCTTGAATACAGCACACCAATGG + Intergenic
1192997829 X:76531190-76531212 TCTTGAATACAGCACACTAATGG + Intergenic
1193001763 X:76570260-76570282 TCCTGAATACAGCACACCAATGG - Intergenic
1193043631 X:77029938-77029960 TCCTGAATACAGCACACCAATGG + Intergenic
1193065609 X:77256253-77256275 TCCTCAATACAGCACACCAATGG - Intergenic
1193091368 X:77496699-77496721 TCCTGAATACAGCACACCAATGG - Intergenic
1193095169 X:77540043-77540065 TCTTGAATACAGCACACCAATGG - Intronic
1193113519 X:77754252-77754274 TTCTGAATACAGCACACCAATGG + Intronic
1193174140 X:78372239-78372261 TCTTGAATACAGCACACTGGTGG + Intergenic
1193201361 X:78695234-78695256 TCCTGAATACAGCACACCAATGG + Intergenic
1193355759 X:80519108-80519130 TTCTAAATGCAGCACACCAATGG + Intergenic
1193434181 X:81451483-81451505 TCCTGAATACAGCACACCAATGG - Intergenic
1193494581 X:82195506-82195528 TCTTAAACACAGCATACCATTGG + Intergenic
1193555332 X:82946774-82946796 TCCTGAATACAGCACACCAATGG - Intergenic
1193719288 X:84969571-84969593 TCCTGAATACAGCACACCAATGG + Intergenic
1193727948 X:85065292-85065314 TCTTGAATACAGCACACCAATGG + Intronic
1193949553 X:87780643-87780665 TCCTGAATACAGCACACCAATGG - Intergenic
1194021784 X:88700478-88700500 TCCTGAATACAGCACACCAATGG + Intergenic
1194060901 X:89196404-89196426 TCTTAAAGACAGCATACCATTGG - Intergenic
1194183313 X:90739481-90739503 TGTTGAATACAGCACACTAATGG - Intergenic
1194193740 X:90867198-90867220 TCTTGAATACAGCACACCAATGG - Intergenic
1194202905 X:90977041-90977063 TCCTGAATACAGCACACCAATGG + Intergenic
1194315057 X:92367409-92367431 TCTTGAATACAGCACACCAATGG + Intronic
1194375855 X:93132765-93132787 TCCTGAATACAGCACACCAATGG - Intergenic
1194444751 X:93974076-93974098 TCTTGAATACAGCACATCAATGG + Intergenic
1194515124 X:94843122-94843144 TCCTGAATACAGCACACCAATGG + Intergenic
1194576115 X:95616839-95616861 TCCTGAATACAGCACACCAATGG + Intergenic
1194901175 X:99513909-99513931 TCCTGAATACAGCACACCAATGG + Intergenic
1195232777 X:102868095-102868117 TCCTGAATACAGCACACCAATGG + Intergenic
1195519012 X:105810348-105810370 TCCTGAATACAGCACACCAATGG + Intergenic
1195622260 X:106968543-106968565 TCCTGAATACAGCACACCAGTGG - Intronic
1195661149 X:107379938-107379960 TCCTGAATACAGCACACCAAAGG + Intergenic
1195842977 X:109194253-109194275 TCTTGAATACAGCAGACCAATGG - Intergenic
1195979125 X:110559348-110559370 TCCTGAATACAGCACACCAATGG + Intergenic
1195988554 X:110659113-110659135 TCCTGAATACAGCACACCAATGG - Intergenic
1196159232 X:112464051-112464073 TCCTGAATACAGCACACCACTGG - Intergenic
1196269577 X:113695825-113695847 TCCTGAATACAGCACACCAAAGG + Intergenic
1196284237 X:113861659-113861681 TCTTGAATACAGCAAACCAATGG + Intergenic
1196467289 X:115985229-115985251 TCCTGAATACAGCACACCAGTGG - Intergenic
1196555664 X:117082172-117082194 TCTTTAACACAGCACACCATTGG + Intergenic
1196600116 X:117591701-117591723 TCTTGAATACAGCACACCAATGG - Intergenic
1196602720 X:117621004-117621026 TCCTGAATACAGCACACCAATGG + Intergenic
1196607076 X:117669611-117669633 TCCTGAATACAGCACACCAATGG + Intergenic
1196982459 X:121230132-121230154 TGTTGAAGACAGCACACCAATGG + Intergenic
1197046252 X:122002254-122002276 TCCTGAATACAGCACACCACTGG + Intergenic
1197319335 X:125008109-125008131 TCCTGAATACAGCACACCAATGG - Intergenic
1197399463 X:125972694-125972716 TGTTGAATACAGCATACAAATGG + Intergenic
1198085866 X:133281167-133281189 TCCTGAATACAGCACACCAATGG - Intergenic
1198578826 X:138040737-138040759 TCTTCAATACAGCACACCAATGG - Intergenic
1198687299 X:139240062-139240084 TCTTTAATACAGCACACCGATGG - Intergenic
1198725618 X:139674235-139674257 TCCTGAATACAGCACACCAATGG + Intronic
1199007526 X:142719433-142719455 TCCTCAATACAGCACACCAATGG - Intergenic
1199306817 X:146277224-146277246 TCTTAAAGACAGCATACCACTGG + Intergenic
1199436838 X:147821622-147821644 TCTTGAATACAGCACACCAATGG - Intergenic
1199801450 X:151254920-151254942 TCCTGAATACAGCACACCAATGG - Intergenic
1200321383 X:155193907-155193929 TCTTGAATACAGCACACCACTGG + Intergenic
1200529929 Y:4321437-4321459 TGTTGAATACAGCACACTAATGG - Intergenic
1200540348 Y:4449581-4449603 TCTTGAATACAGCACACCAATGG - Intergenic
1200548741 Y:4552468-4552490 TCCTGAATACAGCACACCAATGG + Intergenic
1200623111 Y:5478946-5478968 TCTTGAATACAGCACACCAATGG + Intronic
1200732355 Y:6756582-6756604 TCCTGAATACAGCACACCAATGG + Intergenic
1200740054 Y:6844780-6844802 TCCTGAATACAGCACACCAATGG + Intergenic
1201595721 Y:15666655-15666677 TCTTGAATACAGCACACAAGTGG + Intergenic
1201707365 Y:16951682-16951704 TCTTAAATACAGCACACTGATGG - Intergenic
1201786220 Y:17783806-17783828 TGTTAAATTCAACACCCTAGGGG - Intergenic
1201815333 Y:18122182-18122204 TGTTAAATTCAACACCCTAGGGG + Intergenic
1201851798 Y:18491892-18491914 TGTTAAATTCAACACCCTAGGGG + Intergenic
1201881522 Y:18828488-18828510 TGTTAAATTCAACACCCTAGGGG - Intronic
1202173522 Y:22076210-22076232 TCCTGAATACAGCACACCAAAGG + Intronic
1202217838 Y:22510172-22510194 TCCTGAATACAGCACACCAAAGG - Intronic
1202325347 Y:23685887-23685909 TCCTGAATACAGCACACCAAAGG + Intergenic
1202329692 Y:23735240-23735262 TGTTAAATTCAACACCCTAGGGG - Intergenic
1202341986 Y:23879541-23879563 TCCTGAATATAGCACACCAGAGG + Intergenic
1202528783 Y:25790544-25790566 TCCTGAATATAGCACACCAGAGG - Intergenic
1202541079 Y:25934814-25934836 TGTTAAATTCAACACCCTAGGGG + Intergenic
1202545424 Y:25984167-25984189 TCCTGAATACAGCACACCAAAGG - Intergenic