ID: 959884624

View in Genome Browser
Species Human (GRCh38)
Location 3:111485059-111485081
Sequence TAATAGGAATAAATGTGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 318
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 294}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959884624_959884627 8 Left 959884624 3:111485059-111485081 CCTCTCCACATTTATTCCTATTA 0: 1
1: 0
2: 3
3: 20
4: 294
Right 959884627 3:111485090-111485112 TTATTATCATCATTTCAAAATGG 0: 1
1: 1
2: 6
3: 99
4: 1045
959884624_959884628 22 Left 959884624 3:111485059-111485081 CCTCTCCACATTTATTCCTATTA 0: 1
1: 0
2: 3
3: 20
4: 294
Right 959884628 3:111485104-111485126 TCAAAATGGTAATTTCCAGAAGG 0: 1
1: 0
2: 3
3: 30
4: 272
959884624_959884629 25 Left 959884624 3:111485059-111485081 CCTCTCCACATTTATTCCTATTA 0: 1
1: 0
2: 3
3: 20
4: 294
Right 959884629 3:111485107-111485129 AAATGGTAATTTCCAGAAGGTGG 0: 1
1: 0
2: 4
3: 32
4: 368

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959884624 Original CRISPR TAATAGGAATAAATGTGGAG AGG (reversed) Intronic
901332545 1:8422651-8422673 TCATAAGATCAAATGTGGAGAGG + Intronic
901540379 1:9911329-9911351 GAAGGGGAAGAAATGTGGAGTGG - Intergenic
903133717 1:21295434-21295456 TAATAATAATAAATGTCAAGTGG - Intronic
904363061 1:29990982-29991004 TAATTGGAAAATACGTGGAGGGG - Intergenic
904631542 1:31846485-31846507 TACTAGGGATAAGTGTGGATGGG - Intergenic
905183664 1:36181136-36181158 CAATGGGAATAGATGTTGAGTGG - Intergenic
908205289 1:61841821-61841843 TAATAAAAATAAATGTGGATAGG - Intronic
908253725 1:62285413-62285435 TAAAAGGCGTAAGTGTGGAGAGG - Intronic
908358904 1:63348515-63348537 CAAAAGGAATGAATGTGGGGTGG - Intergenic
909586550 1:77295895-77295917 GAATAGAAAGAAATGTGAAGTGG - Intronic
910009891 1:82448617-82448639 TAATAAGAGTATATCTGGAGGGG + Intergenic
910081445 1:83347345-83347367 TAAAAGGAATAAAAGTAAAGTGG + Intergenic
911689195 1:100812164-100812186 TAATAGGATGAAATGAGAAGAGG + Intergenic
912638733 1:111323232-111323254 AAATAGGAAGAAAAATGGAGGGG - Intergenic
912696254 1:111844317-111844339 TAAAAGGAATAATTCTGAAGTGG - Intronic
913119957 1:115730894-115730916 GAAAAGTAATAAATGTGAAGTGG - Intronic
913395877 1:118371511-118371533 TAAAAGGAGTAAATGGGGAAAGG - Intergenic
913678172 1:121162463-121162485 TAATAGGAAAAGATGTGTACAGG + Intergenic
914030012 1:143950092-143950114 TAATAGGAAAAGATGTGTACAGG + Intronic
914159437 1:145117858-145117880 TAATAGGAAAAGATGTGTACAGG - Intergenic
914215849 1:145627293-145627315 TAAAAGGAATAAAGGTAGAGGGG + Intronic
914464403 1:147913358-147913380 TAAGGGAAATAAATTTGGAGGGG + Intergenic
914467792 1:147947678-147947700 TAAAAGGAATAAAGGTAGAGGGG + Intronic
915797590 1:158752988-158753010 GAAAATGAATAAAAGTGGAGAGG + Intergenic
915883910 1:159702703-159702725 TAAGAGGAATAACAGTGTAGCGG - Intergenic
916826677 1:168448578-168448600 TAATATGACTCAATGTAGAGAGG - Intergenic
917249727 1:173045024-173045046 TAAGAGGAATAAATGGGGAGGGG + Intronic
918587187 1:186201765-186201787 TAATAGAAAGACATGTGGACAGG + Intergenic
920465477 1:206180977-206180999 TAATAGGAAAAGATGTGTACAGG + Intergenic
922136933 1:222838004-222838026 TAATAGGAAAAACTATCGAGAGG - Intergenic
923080206 1:230646076-230646098 CAATGGGAAGAAGTGTGGAGAGG - Intronic
923178083 1:231487888-231487910 TAATAGGACAAACTATGGAGGGG - Intergenic
923178184 1:231489532-231489554 TCATAGCAATAAATGTGAATAGG + Intergenic
923631596 1:235652189-235652211 TAATAGTAAGAAATCTGCAGTGG - Intergenic
923825992 1:237501370-237501392 TAAAGAGAATAAAGGTGGAGAGG - Intronic
923985475 1:239377151-239377173 GAATACGGATAAATGTGTAGGGG + Intergenic
1062800090 10:372561-372583 AAATATGAATAAATGTACAGTGG - Intronic
1063916912 10:10892573-10892595 TAATGAGAATGAATGTGGAATGG - Intergenic
1064847356 10:19670237-19670259 TAATTCGCAGAAATGTGGAGTGG - Intronic
1065877229 10:30007932-30007954 TAATAGGGATACATGAGAAGAGG - Intergenic
1066268778 10:33801622-33801644 TAATAGAAATGAATGAGGTGTGG + Intergenic
1066282179 10:33928123-33928145 AAACAGGAATACATTTGGAGGGG - Intergenic
1067180071 10:43978691-43978713 TAATAGGAATGAAATAGGAGTGG + Intergenic
1067358601 10:45555260-45555282 TAATAAGAATAACTGTGGCTGGG + Intronic
1068316602 10:55351932-55351954 TAATACTAATAAATTTTGAGAGG + Intronic
1070619717 10:77999842-77999864 TAAAAGGAAAAAATGTAGAAAGG - Intronic
1071254045 10:83851038-83851060 AAATAGAAATTAATGTGTAGGGG + Intergenic
1071580024 10:86760614-86760636 TAAAAGGAATAAATGGGGAAAGG + Intronic
1072060726 10:91808152-91808174 AGATAGGAAAAAATGTGGATGGG + Intronic
1072078671 10:92005538-92005560 AAATAGGAATAAATGTAAGGAGG - Intronic
1072820713 10:98554265-98554287 TAATAGGAACAAAGATTGAGAGG - Intronic
1074633384 10:115284898-115284920 AAACAGAAATAATTGTGGAGAGG + Intronic
1074657199 10:115604601-115604623 TAAGAGGTCTAAGTGTGGAGAGG - Intronic
1075132422 10:119751452-119751474 TAGTAGGAATAAAGCTGGAGAGG + Intronic
1075487158 10:122832183-122832205 TATTATGAATAAATGAGGAAGGG - Exonic
1077990344 11:7404083-7404105 TAATAAAAATATATCTGGAGTGG - Intronic
1078472235 11:11599412-11599434 TAATTGTAAGAAATCTGGAGGGG - Intronic
1078837312 11:15043246-15043268 GAGAAGGAAGAAATGTGGAGGGG + Intronic
1080350859 11:31384162-31384184 GAATAGGAAGAAATGAGAAGAGG - Intronic
1081321960 11:41702386-41702408 GAGTAGAAATAGATGTGGAGAGG - Intergenic
1083800214 11:65042042-65042064 TCTCAGGAATAAAAGTGGAGGGG + Intronic
1085070919 11:73544328-73544350 TGGTAGGAATGAATGTGAAGTGG + Intronic
1085364175 11:75923205-75923227 TAATATTAATAAATGTGGAAAGG - Intronic
1086778332 11:90868828-90868850 GAATAGAAAGACATGTGGAGAGG - Intergenic
1088056904 11:105593927-105593949 TAATAGAAAAAAATGTGTAAGGG - Intergenic
1090126056 11:124085884-124085906 TAATATGAATCAGTGTGGACAGG + Intergenic
1090563240 11:127956688-127956710 TAATAAAAATAAAAGTGAAGTGG + Intergenic
1093501840 12:19822292-19822314 TGATAGGAATTAATGAGGACAGG + Intergenic
1093815187 12:23537208-23537230 TAATATTAATAAACATGGAGTGG + Intronic
1094304840 12:29007110-29007132 TAATAGAAATAACTGTGCTGAGG + Intergenic
1094803167 12:34061767-34061789 TAATAGGAAAAAATGAGTATGGG + Intergenic
1094833816 12:34312955-34312977 TAAGAGGAACAAATATGGTGCGG - Intergenic
1095493170 12:42757414-42757436 TAATAGGTAGAAAGCTGGAGTGG + Intergenic
1096879321 12:54654671-54654693 TACTGGGAATTAATCTGGAGAGG + Intergenic
1098310690 12:69146257-69146279 ACATAGGAATAGATGTGGACAGG - Intergenic
1101522378 12:105495845-105495867 TAAGAAGAATAAAGCTGGAGAGG + Intergenic
1103353124 12:120299254-120299276 TAATAATAATAAAAGTGGCGGGG + Intergenic
1104765156 12:131325687-131325709 TAATAGGAATAGATGTGTGAGGG - Intergenic
1106206277 13:27598470-27598492 TAAAAGGAATAGATTGGGAGAGG + Intronic
1109012115 13:56963728-56963750 TCAAAGGCATAAATGTGCAGGGG + Intergenic
1109150501 13:58841992-58842014 TGATTTGAATAAATGGGGAGTGG - Intergenic
1109696518 13:65967263-65967285 AAATGGAAATAAAAGTGGAGTGG + Intergenic
1109812208 13:67528229-67528251 TTATAGGAAGAAGTGTTGAGAGG + Intergenic
1109855539 13:68122405-68122427 AAATAGGGAAACATGTGGAGAGG - Intergenic
1110851265 13:80247521-80247543 TGATAGGAGAAAATGTGAAGAGG - Intergenic
1110900584 13:80818276-80818298 TAATTTGAAAAAAGGTGGAGAGG + Intergenic
1110947138 13:81436370-81436392 TACTTGGAATAAATGTGGCATGG - Intergenic
1111061597 13:83026160-83026182 TAATAGGAGTTAATAAGGAGAGG + Intergenic
1111854020 13:93613332-93613354 TATTAGGACTAAAGGTGGTGGGG + Intronic
1112051951 13:95651583-95651605 TAATAAAAAGAAATCTGGAGTGG + Intergenic
1112583034 13:100692877-100692899 TAATAGGGATAATTGTGAAAGGG - Intergenic
1113209020 13:107953099-107953121 TAATAGGTATATATGTGTATGGG - Intergenic
1113570776 13:111355551-111355573 TCATAGGCATAAACGTGGAAAGG - Intergenic
1114930238 14:27458782-27458804 TAATAAAAATAAATTTGGAATGG + Intergenic
1117200284 14:53383091-53383113 TAATAGAAAAAAATGAGAAGGGG + Intergenic
1117864684 14:60134198-60134220 TAATACAAATGTATGTGGAGAGG - Exonic
1117966371 14:61210696-61210718 TCATTGGAATAAATGTATAGGGG + Intronic
1118354042 14:64996920-64996942 TAAAAGGATTAAAAGTGAAGTGG - Intronic
1119604455 14:76002612-76002634 TAATGAGAATAGTTGTGGAGAGG + Intronic
1121997869 14:98618146-98618168 TAATTGCAATAAATGTGAATGGG + Intergenic
1122961158 14:105094100-105094122 TTACAGGAATAAATGGGGTGGGG - Intergenic
1124470101 15:29976759-29976781 TGCCAGGAATAAAAGTGGAGAGG - Intergenic
1125322595 15:38504531-38504553 CAATAGGATAAGATGTGGAGTGG - Intronic
1125495773 15:40192310-40192332 TAATAGGAAAAACTGTGTACAGG - Intronic
1128564272 15:68689811-68689833 TTAAAGTAATAAATGTGCAGAGG + Intronic
1128663542 15:69521539-69521561 TTATAGGAAGATATGTTGAGAGG + Intergenic
1129852998 15:78805503-78805525 TACTGGGAATGAATATGGAGTGG - Intronic
1130373113 15:83304312-83304334 TAATAGGGATAAATATTGAGAGG - Intergenic
1131988370 15:98067553-98067575 TAATAGGAAATAAAGTGGAATGG + Intergenic
1132966241 16:2656548-2656570 TAATAGAAAAAAATTTGGGGAGG + Intergenic
1133849101 16:9485310-9485332 TAAGAGAAATAAATCAGGAGGGG + Intergenic
1134403229 16:13931717-13931739 TTATAGGAAAATATGTGGATTGG - Intronic
1136379167 16:29884020-29884042 GAAGAGGAATGAATGTGAAGGGG - Intronic
1140356161 16:74308598-74308620 GACTGGGGATAAATGTGGAGAGG + Intergenic
1140647746 16:77051677-77051699 TGATAGGAATAATTGTTGAAAGG + Intergenic
1142554924 17:768696-768718 TTAGAGGAAGAAATCTGGAGAGG + Intronic
1143139940 17:4736113-4736135 TAATGGCAATAAATGGGGGGTGG + Intronic
1143773780 17:9184773-9184795 AAATGGGGAAAAATGTGGAGGGG + Intronic
1144097518 17:11914992-11915014 CAATAGAACTAAATGTGGTGTGG - Intronic
1144334015 17:14253046-14253068 TAAGGGAAATAAATGTGGAGTGG + Intergenic
1146435529 17:32842544-32842566 TTATAGGAACAGATGAGGAGTGG - Intronic
1146549268 17:33765915-33765937 TAATAGGAGTCAAGGTGGAAAGG - Intronic
1146637741 17:34518713-34518735 TAATCTGAATAAAGGTGGAGTGG + Intergenic
1147354861 17:39886863-39886885 TGATAGGAATCAAGGTGGAAAGG - Intergenic
1149157759 17:53653479-53653501 TAAAATTAATAAGTGTGGAGAGG + Intergenic
1150700379 17:67442129-67442151 ACATAGCAATAAATGAGGAGAGG - Intronic
1153287554 18:3470439-3470461 TAATAGGAATTGATGTGAAGAGG + Intergenic
1155323570 18:24643544-24643566 TCATAGTAATATATGTGTAGGGG + Intergenic
1156057924 18:33033187-33033209 CAAAAGGAATGAATTTGGAGAGG + Intronic
1156435416 18:37122619-37122641 TAATAGGAGGGAATGTGGAAAGG + Intronic
1157437787 18:47685942-47685964 TAATACAAATAAATTTTGAGGGG + Intergenic
1157549754 18:48573330-48573352 TGACTGGAATAAATGGGGAGGGG - Intronic
1158567233 18:58564939-58564961 TGATAGGATTAACTCTGGAGAGG - Intronic
1159023663 18:63163606-63163628 TAGTAGGAAGTTATGTGGAGAGG + Intronic
1159401796 18:67947153-67947175 TATTAGGCATATATGTGGATTGG - Intergenic
1164585639 19:29473095-29473117 TCATGGAAATAAAGGTGGAGTGG - Intergenic
1165717649 19:38056759-38056781 TAATATGAAAAAATATGGAAAGG + Intronic
1167485436 19:49760181-49760203 TAAAAAGAATAAATGTGGCTGGG + Intronic
1167736115 19:51295558-51295580 TCAGAGGCATAGATGTGGAGGGG + Intergenic
925537414 2:4932484-4932506 TAAAAGGAAGGAATGTGCAGAGG - Intergenic
925651017 2:6089379-6089401 TAATAATAATAAATGAGGGGTGG + Intergenic
925796244 2:7546317-7546339 TAATAGGGAAAATTGTGGGGAGG - Intergenic
926012039 2:9416178-9416200 AAATAGGCATAAATGAGGAAGGG - Intronic
926755197 2:16228757-16228779 TAATAGGAATAAGTTTGGGATGG - Intergenic
932557136 2:72834383-72834405 AAATAGGAAGAAAAGGGGAGTGG + Intergenic
932828309 2:74961616-74961638 TACTAGGAATAGAAGTGGGGTGG + Intronic
933215241 2:79622296-79622318 TAAAAGGAAGAAATATAGAGGGG - Intronic
933528111 2:83469479-83469501 TTATAGAAATAAATGAGCAGAGG - Intergenic
935022271 2:99243153-99243175 TAATAGGAATTGATGTGGTTGGG + Intronic
935793638 2:106617985-106618007 TGAGGGGAATAAATGTGGAGAGG + Intergenic
936231981 2:110710831-110710853 TAAGAAGAATAGAAGTGGAGAGG + Intergenic
936953578 2:118002574-118002596 TAATAGAAAAAAATATGGAAGGG + Intronic
939747657 2:145996539-145996561 TAATAGTAGTAAATGTGAATGGG + Intergenic
939783092 2:146473996-146474018 TAATCAGAATAAATCTGCAGTGG - Intergenic
940042192 2:149372216-149372238 TATTAGGAATTAATGAGGATGGG - Intronic
940836876 2:158531907-158531929 TAATAGGCATAAATGGATAGTGG - Intronic
940843231 2:158609305-158609327 TACTCAGAATAAATGAGGAGTGG + Intronic
941325930 2:164114131-164114153 TTATAGGAATAAATAGGCAGAGG + Intergenic
942904914 2:181168410-181168432 TAATAGTGGTAAATCTGGAGAGG + Intergenic
942995654 2:182256929-182256951 TATGAGGAATTAATGTGGAATGG - Intronic
943248767 2:185490162-185490184 AAATAGGAAAAAATGTAGATAGG - Intergenic
943460500 2:188167091-188167113 TAATAGAAATAATTCTAGAGAGG - Intergenic
946083908 2:217151807-217151829 TAATGGGAATTTATGTGGTGTGG + Intergenic
946861930 2:224008522-224008544 CAATAAGAATAAATTTGCAGTGG - Intronic
948601413 2:239109373-239109395 TAATAGGAACACAAGTGGGGAGG - Intronic
1169148637 20:3271524-3271546 AAATAGGAATGAATATGGAAGGG - Intronic
1170481734 20:16772569-16772591 AAATAGGAATAAAGTTGGAAGGG - Intergenic
1170952910 20:20952944-20952966 TGTCAGGAATGAATGTGGAGAGG - Intergenic
1170997022 20:21371930-21371952 TAATATTAATAAAAGTAGAGAGG - Intronic
1172545495 20:35757897-35757919 TAAGTAGAATAAATGTGGAAAGG + Intergenic
1174202201 20:48814555-48814577 GAATAGAAAGAAATGTGGTGGGG + Intronic
1177804323 21:25858820-25858842 TAATAGTCATAACTGGGGAGAGG + Intergenic
1178084624 21:29100271-29100293 TTATACTAAGAAATGTGGAGTGG - Intronic
1178582004 21:33845573-33845595 AAATAGGAATAAATGAGGAGAGG - Intronic
1178954769 21:37012202-37012224 TAATAATAATAAATAAGGAGCGG - Intronic
1180930751 22:19589193-19589215 CAAAAGGAATAAATGTGGCCGGG - Intergenic
1182955007 22:34415883-34415905 GAACAGGAATAAATGTGTTGGGG + Intergenic
1183806967 22:40219776-40219798 TAATAGGACAGAATGTAGAGAGG - Intronic
1184824406 22:46938036-46938058 TAATAATAATAAATGTCGTGTGG + Intronic
949117730 3:348336-348358 TAACAAGAAGAAATATGGAGAGG + Intronic
949233313 3:1777051-1777073 TAACTGGAGTATATGTGGAGTGG + Intergenic
949375698 3:3387639-3387661 TAATAGGCACAAATGAAGAGAGG + Intergenic
951163607 3:19457632-19457654 TAATAGGAATGATTGTTGAAAGG + Intronic
951645915 3:24891206-24891228 AAATAGGAATATATGTAGAAAGG - Intergenic
951839700 3:27021588-27021610 TAAGAGGTAAAAATGTGGAGAGG + Intergenic
952298480 3:32083201-32083223 AAATATGTATAAAAGTGGAGTGG + Intergenic
952697837 3:36290580-36290602 TAAGATGTATAAATGTTGAGGGG + Intergenic
955656122 3:61246793-61246815 TAATAGGTATACATGTGCCGTGG - Intronic
956246962 3:67194589-67194611 CAAAAGGAATTAAAGTGGAGAGG - Intergenic
956298205 3:67737912-67737934 CAATAGGGATAATTTTGGAGGGG + Intergenic
956518948 3:70082620-70082642 TCAGTGGAAAAAATGTGGAGTGG + Intergenic
956853747 3:73255898-73255920 GGATGGGAAAAAATGTGGAGTGG + Intergenic
957553449 3:81735969-81735991 TAGTAGGCTTAGATGTGGAGTGG - Intronic
957657861 3:83105272-83105294 TGATATGAATCAGTGTGGAGAGG + Intergenic
957792120 3:84954972-84954994 TAATAATAAGACATGTGGAGTGG + Intergenic
957979462 3:87489971-87489993 AAAGAGGAATTAATGTGGACTGG + Intergenic
958021204 3:87998417-87998439 TATTTGGGATAAATGTGGAAGGG - Intergenic
958759762 3:98292696-98292718 TAAGAAGAATAAATAAGGAGGGG - Intergenic
958809607 3:98845541-98845563 AAGTAAGAATAAATGTAGAGAGG - Intronic
959884624 3:111485059-111485081 TAATAGGAATAAATGTGGAGAGG - Intronic
959961052 3:112298430-112298452 CAATAGCATTATATGTGGAGGGG - Intergenic
960357867 3:116675885-116675907 AAATAGGAATAAATGTATTGAGG - Intronic
961062513 3:123843485-123843507 TAATAGGAATAAAGGTAAGGTGG + Intronic
961855280 3:129864347-129864369 GCATAGGTATAAATGTGGTGTGG - Intronic
962938860 3:140107289-140107311 TATTAGGAGAAAAGGTGGAGAGG - Intronic
963315739 3:143756649-143756671 TTATAGGAATAAATGCAGACTGG + Intronic
964387116 3:156159599-156159621 TATGAAGAATATATGTGGAGGGG - Intronic
964590127 3:158352329-158352351 TAATGGTTATAGATGTGGAGAGG + Intronic
964594286 3:158405758-158405780 GAATAGGAAGAAATGTAGAATGG + Intronic
965091317 3:164166060-164166082 TAATAAAAATAAATTTGGAGTGG + Intergenic
965688627 3:171331931-171331953 TAAAAGTAATAAAAGTGTAGGGG + Intronic
967261368 3:187645837-187645859 TAATAGGAAGAAATGTCAAGGGG + Intergenic
967370375 3:188738044-188738066 TAACAGAAAAAAATGTAGAGGGG - Intronic
967683563 3:192393971-192393993 TGATTGGAATGGATGTGGAGAGG - Intronic
968595873 4:1484127-1484149 TAATCAAAATAAATCTGGAGGGG - Intergenic
968784832 4:2612767-2612789 GAATAGGAATATATGTAAAGTGG - Intronic
969014866 4:4097316-4097338 TAAAAGAAAAAGATGTGGAGAGG + Intergenic
969458817 4:7316707-7316729 TAGTAGAAATAAATGGGGACTGG + Intronic
969495160 4:7522438-7522460 TAATTGGAATAAATGTAGATTGG + Intronic
972524444 4:39894633-39894655 TAATAGATGTATATGTGGAGAGG - Intronic
975198455 4:71554946-71554968 TAATAGAAATAAATGAAGAAGGG - Intronic
975747768 4:77491737-77491759 TAATGGGAATATCTGGGGAGAGG + Intergenic
976270731 4:83227938-83227960 TAATAAGAAGAAATTTGGGGTGG + Intergenic
976943166 4:90731683-90731705 TAATGGGAATAAATTTTAAGAGG + Intronic
977918725 4:102621133-102621155 TAACAGGAAAAAAGGAGGAGGGG + Intergenic
978056851 4:104280645-104280667 GAATAGGAAAAGATGGGGAGAGG - Intergenic
978274078 4:106927733-106927755 TAATGGGTTTAAATGTGAAGGGG - Intronic
979083387 4:116373099-116373121 TAATAGATATAGATGTTGAGGGG - Intergenic
980163850 4:129200370-129200392 AAATGGGAATAAAACTGGAGAGG + Intergenic
980741794 4:136959792-136959814 TAATAAAAATAAAAGTGTAGAGG - Intergenic
981848711 4:149201718-149201740 TAATTGGTACAAATGAGGAGAGG + Intergenic
981924635 4:150125305-150125327 AAATAGGAATAATTATAGAGTGG - Intronic
982412613 4:155096109-155096131 TAATAAGAAGAAATGGGGAAGGG + Intergenic
982930078 4:161393621-161393643 TAATTGGAATAAATCAAGAGGGG + Intronic
984027638 4:174563506-174563528 TAATAGGAAGAGTTGTTGAGAGG - Intergenic
984499057 4:180535362-180535384 TAAGTGGAATCAATGTGGAATGG + Intergenic
984548693 4:181135605-181135627 TGAAAGGAATAAATGATGAGAGG + Intergenic
989600343 5:43194423-43194445 TGTTAGGAAAAAATGTGGATTGG + Intronic
989757504 5:44973629-44973651 TAATTCTAATAAATGTGTAGTGG + Intergenic
990215764 5:53530283-53530305 TGATAGAAATAAAGGTGGATGGG + Intergenic
990226218 5:53657626-53657648 TTATAAGAATAAAAGTGGGGTGG + Intronic
991442932 5:66669969-66669991 TAGTAGGAATAAATGACAAGAGG + Intronic
993190895 5:84679007-84679029 TAATAGTAAGAAATGTGGTCTGG - Intergenic
993804919 5:92394050-92394072 TAAAAAGAATAAATGTGGCCAGG + Intergenic
994454099 5:99983419-99983441 AAAAAGGAAGAAGTGTGGAGAGG + Intergenic
994875081 5:105411545-105411567 TAAAAGGAAGAAAAGTTGAGTGG + Intergenic
994885794 5:105559785-105559807 GAATCAGAAGAAATGTGGAGTGG - Intergenic
996781321 5:127189724-127189746 TAATTGGAAGGAATCTGGAGGGG - Intergenic
998245441 5:140498459-140498481 TAATAGGTATCATTGTGCAGAGG + Intronic
998485748 5:142500408-142500430 GGCTAGGAATGAATGTGGAGTGG - Intergenic
1000132016 5:158309376-158309398 TAATAGGACAAGAAGTGGAGGGG - Intergenic
1000507465 5:162139228-162139250 TAGGAGGAATAAATCTGAAGTGG + Intronic
1002892671 6:1349401-1349423 TTTTGGGAATAAATGGGGAGAGG - Intergenic
1003964009 6:11236111-11236133 TGATAGTAATAAATGAGGAAGGG - Intronic
1007808724 6:44471550-44471572 TAAAAGGAAAAAATGGGGTGGGG - Intergenic
1008050477 6:46895661-46895683 TTAAAGGAATAACTGAGGAGAGG - Intronic
1009557091 6:65184980-65185002 TAATAAAAATAAATTTGAAGTGG + Intronic
1010173802 6:73002613-73002635 AACAAGGAATAAATGTGGTGGGG + Intronic
1011530416 6:88314892-88314914 TCAAAGGAATAAATGTTGAATGG - Intergenic
1012515923 6:100058998-100059020 TAATACAAAAAAATTTGGAGAGG - Intergenic
1013141349 6:107338802-107338824 TGAGAGAAATAAATCTGGAGGGG + Intronic
1014352308 6:120360703-120360725 CAACAGCAATAAATGTAGAGTGG + Intergenic
1015698957 6:136013520-136013542 TGTTAGGAATGAATGTGGGGTGG + Intronic
1017698402 6:157042504-157042526 TATTAAAAATACATGTGGAGAGG + Intronic
1018542495 6:164897729-164897751 TCAAAGGAATAAATGTGGAGTGG - Intergenic
1020476218 7:8598128-8598150 GAATAGCAATAAAGATGGAGAGG - Intronic
1020968391 7:14902171-14902193 GATTAGGAATAAATCTGGACTGG + Intronic
1022004733 7:26257094-26257116 AGATAGGAATGAATGTGGACAGG + Intergenic
1022135396 7:27442810-27442832 TAATAGTAATAGATGGAGAGGGG - Intergenic
1022758150 7:33317289-33317311 AAAGAGGAATAGATATGGAGGGG - Intronic
1023811376 7:43914942-43914964 TAAGGGAAATCAATGTGGAGTGG + Intronic
1024459017 7:49640554-49640576 TAATAGGAAAAACTGTGGGGTGG - Intergenic
1024747357 7:52423719-52423741 AAGGAGGAATGAATGTGGAGTGG - Intergenic
1025038280 7:55616284-55616306 TAAAAGGAATAAATTTCAAGAGG - Intergenic
1027498367 7:78917247-78917269 TAAGAGGAGTAAATCTGGAGAGG + Intronic
1029904181 7:104073524-104073546 TAATAATAATAAATATGTAGAGG + Intergenic
1030639459 7:111987804-111987826 AAACAGGTACAAATGTGGAGGGG - Intronic
1030652785 7:112133314-112133336 TAATAAGAACATTTGTGGAGTGG - Intronic
1030717252 7:112823856-112823878 TAATTGTAATAGATGTGTAGTGG + Intronic
1030743793 7:113140774-113140796 CAATAAGAAGAAAAGTGGAGCGG - Intergenic
1031393359 7:121243264-121243286 TCATATGAACAAATATGGAGTGG - Intronic
1033101600 7:138478148-138478170 TAATAGAAATAAATGTCAGGAGG + Intronic
1034038969 7:147856417-147856439 TAGAATGAATAAATGTGGACGGG + Intronic
1034070290 7:148178079-148178101 TGATAGGAATACATGTGAATTGG + Intronic
1036947720 8:13110389-13110411 TCAGAGGAATAAATGGGGGGTGG - Intronic
1038512591 8:28153383-28153405 TGATAGGGACAAATGTGGACAGG - Intronic
1038567590 8:28632847-28632869 TATTAAGAATAAATGTGGCTGGG - Intronic
1040933556 8:52760525-52760547 TCAGAGGCATAAATGTGGAGTGG + Intergenic
1042327490 8:67543766-67543788 TAATAATAATAATAGTGGAGGGG - Intronic
1042711686 8:71724310-71724332 AAATATAAATAAATGTGCAGAGG - Intergenic
1043005653 8:74814996-74815018 TGAAAGAAATAAATGTGGAAGGG - Intronic
1043025161 8:75057862-75057884 AAATATGAATAAATATGGAAAGG + Intergenic
1043179267 8:77064863-77064885 TAATAGGAATATATATTTAGGGG + Intergenic
1044163633 8:88952532-88952554 TTATATGAATTAAAGTGGAGTGG - Intergenic
1046443311 8:114284571-114284593 GAAAAGGAAGTAATGTGGAGTGG - Intergenic
1046990623 8:120448890-120448912 TAATTGGGATAAGGGTGGAGAGG + Intronic
1048454041 8:134561867-134561889 TAAAAGGAAGAAAAGTGGGGGGG + Intronic
1048718474 8:137296240-137296262 CATTACGAATAAATATGGAGTGG + Intergenic
1049930916 9:455662-455684 TAATAGGGAGAAATGTGAAAGGG - Intronic
1050334320 9:4575935-4575957 TAAAAGGATTAAGTGTGGGGAGG + Intronic
1051208577 9:14716224-14716246 GAATATGAATAAATGAGTAGAGG - Intergenic
1055436644 9:76298287-76298309 TGATAGTAGAAAATGTGGAGGGG - Intronic
1055603319 9:77942635-77942657 TATGAGGAATATATGTGGTGGGG - Intronic
1057930363 9:99187973-99187995 TAATAGGAGTTAAAGTGGTGGGG + Intergenic
1058174122 9:101718490-101718512 TATGAAGAATAAATGAGGAGAGG + Intronic
1059031368 9:110700953-110700975 TAATAGGAAGAAAAGAGAAGAGG + Intronic
1059582023 9:115560147-115560169 TAATAGGAAGAAATTTTGAGTGG + Intergenic
1187187711 X:17002960-17002982 TAAAAGTAATAAAAATGGAGGGG + Intronic
1189139896 X:38592252-38592274 AAATAGGTTTAAATTTGGAGTGG - Intronic
1190778665 X:53576373-53576395 AACTAGGAATAAAGGTGGATGGG + Intronic
1192574619 X:72233322-72233344 TCATAGAAATAAAAGTGGAGGGG + Intronic
1193709074 X:84857270-84857292 AGATAGGAATAGATGTGGACAGG + Intergenic
1193710465 X:84873160-84873182 ATATAGGAATAGATGTGGACAGG - Intergenic
1195934279 X:110110189-110110211 TGACAGGAATATTTGTGGAGAGG - Intronic
1198136879 X:133761850-133761872 TTCTAGTAATAAATGTGAAGAGG - Intronic
1198791499 X:140351862-140351884 TAATAGAAGAAAATGTAGAGAGG + Intergenic
1199353768 X:146836156-146836178 TATGAGGAATAAATGAGAAGGGG - Intergenic
1200560725 Y:4699550-4699572 GAATAGAAACAAATGTGGTGAGG - Intergenic