ID: 959889833

View in Genome Browser
Species Human (GRCh38)
Location 3:111542127-111542149
Sequence GAACTCTACCACACACGCCT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 74}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959889833_959889837 -2 Left 959889833 3:111542127-111542149 CCCAGGCGTGTGTGGTAGAGTTC 0: 1
1: 0
2: 0
3: 2
4: 74
Right 959889837 3:111542148-111542170 TCGGGTTTTTTAGCACGAAGTGG 0: 1
1: 0
2: 0
3: 6
4: 124
959889833_959889840 6 Left 959889833 3:111542127-111542149 CCCAGGCGTGTGTGGTAGAGTTC 0: 1
1: 0
2: 0
3: 2
4: 74
Right 959889840 3:111542156-111542178 TTTAGCACGAAGTGGGTGGCTGG 0: 1
1: 0
2: 1
3: 5
4: 123
959889833_959889839 2 Left 959889833 3:111542127-111542149 CCCAGGCGTGTGTGGTAGAGTTC 0: 1
1: 0
2: 0
3: 2
4: 74
Right 959889839 3:111542152-111542174 GTTTTTTAGCACGAAGTGGGTGG 0: 1
1: 0
2: 0
3: 8
4: 82
959889833_959889838 -1 Left 959889833 3:111542127-111542149 CCCAGGCGTGTGTGGTAGAGTTC 0: 1
1: 0
2: 0
3: 2
4: 74
Right 959889838 3:111542149-111542171 CGGGTTTTTTAGCACGAAGTGGG 0: 1
1: 0
2: 0
3: 0
4: 26

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959889833 Original CRISPR GAACTCTACCACACACGCCT GGG (reversed) Exonic
902408331 1:16198674-16198696 GATCTCTTCCACATAGGCCTGGG + Exonic
906729407 1:48068444-48068466 GAGCTCTACCATACAGGCCATGG + Intergenic
907406094 1:54254342-54254364 GAGCTCTCCCACACACATCTCGG - Intronic
913557302 1:119980817-119980839 GAACTCAACTCCACATGCCTTGG - Intronic
914939931 1:152013801-152013823 CAAATCGACCACACAAGCCTTGG - Intergenic
924059869 1:240162087-240162109 GTACTCTAGCACTCAAGCCTGGG + Intronic
1068893930 10:62179134-62179156 GAACTCACTCACACACCCCTGGG - Intergenic
1072391835 10:94995081-94995103 GAACTACATCACACATGCCTTGG + Intergenic
1077245611 11:1535880-1535902 GAACTCTACCACACACTGTTTGG - Intergenic
1078433301 11:11303909-11303931 GTAATCTAGCACACACCCCTTGG + Intronic
1079097980 11:17523127-17523149 GATCTCTGCCACACACTCCCAGG - Intronic
1083313950 11:61802681-61802703 GAACTCCATCCCACACGACTGGG + Intronic
1087004330 11:93454214-93454236 CAACTCTACCCCTCACCCCTAGG + Intergenic
1100288672 12:93192406-93192428 GAACCCTGCCACACCAGCCTGGG + Intergenic
1105332318 13:19429399-19429421 GCATTCTTCCACTCACGCCTTGG - Intronic
1105879362 13:24590370-24590392 GCATTCTTCCACTCACGCCTTGG + Intergenic
1105920472 13:24958663-24958685 GCATTCTTCCACTCACGCCTTGG - Intergenic
1114010055 14:18357031-18357053 GAACTCTGTCACACATGGCTTGG - Intergenic
1120187230 14:81406288-81406310 GAACCCTAACACACAGGGCTTGG + Intronic
1125182028 15:36888513-36888535 TAACTCTAACACACGCGCCCAGG + Intergenic
1125719221 15:41837169-41837191 GAACACCACCAAGCACGCCTCGG + Exonic
1127753679 15:62068966-62068988 CATATGTACCACACACGCCTAGG + Exonic
1127775299 15:62259968-62259990 CAACTCTCCCACACACTGCTGGG + Intergenic
1130284034 15:82540733-82540755 CATCTCTTCCACACACGCCAGGG + Intronic
1132657581 16:1047839-1047861 GACCTGTGCCACACAAGCCTGGG - Intergenic
1133022295 16:2972101-2972123 GACCTCTTCCACCCACGCCGTGG + Exonic
1142001986 16:87669423-87669445 GGTCTCTGCAACACACGCCTGGG + Intronic
1146711562 17:35046411-35046433 GACCTCTACCAGACACACCCAGG + Intronic
1147340485 17:39750728-39750750 GAACTCTGGCACCCACACCTCGG - Intergenic
1152566357 17:81102114-81102136 GGCCTCTTCCACACACGCCCGGG - Intronic
1160504398 18:79418892-79418914 CAGCCCTTCCACACACGCCTGGG - Intronic
1164590960 19:29506680-29506702 AATCTCTACCACACACCCCAGGG + Intergenic
927719554 2:25373888-25373910 GAACTCAAGGACACACCCCTGGG + Intergenic
928271102 2:29855456-29855478 GATCACTACCTCACACCCCTGGG + Intronic
929688932 2:44058748-44058770 GAACTGGACCACACACTCCTGGG - Intergenic
931299262 2:60960474-60960496 GGAATCTACCACAAACTCCTTGG - Exonic
938957640 2:136314288-136314310 GATCTCTACCACAGAAGCTTGGG + Intergenic
942486110 2:176441648-176441670 AAACTTTACCACACATGCCAAGG - Intergenic
944423208 2:199553257-199553279 GAACACTATCACCCACCCCTCGG - Intergenic
948326995 2:237132322-237132344 GAACTCGACCTCACACAGCTGGG + Intergenic
1176376768 21:6090631-6090653 GCACTCGACCACAACCGCCTGGG - Intergenic
1179746707 21:43447613-43447635 GCACTCGACCACAACCGCCTGGG + Intergenic
1180434553 22:15287840-15287862 GAACTCTGTCACACATGGCTTGG - Intergenic
1182675888 22:32039540-32039562 GAAAAGTACTACACACGCCTGGG + Intergenic
1185243569 22:49760675-49760697 GGGCACTACCACACACTCCTGGG + Intergenic
950525656 3:13521272-13521294 GAACCCTTCCACTCAGGCCTTGG + Intergenic
953393703 3:42549587-42549609 CAACTCTCCCACCCATGCCTGGG - Intronic
957204722 3:77181543-77181565 GTACTGTCTCACACACGCCTAGG + Intronic
957386595 3:79503386-79503408 GAACTGTACCACTCACCGCTAGG + Intronic
958265951 3:91437048-91437070 GCACTCTCCAACACCCGCCTTGG + Intergenic
959889833 3:111542127-111542149 GAACTCTACCACACACGCCTGGG - Exonic
960294882 3:115930826-115930848 GATCTCCACCAAACAAGCCTGGG - Intronic
962671519 3:137713740-137713762 GAACTCTAACACTCACCGCTAGG - Intergenic
977303477 4:95295322-95295344 GAAAACTACCAGACCCGCCTAGG + Intronic
977423320 4:96831559-96831581 GAAATCTACCCAACACTCCTAGG + Intergenic
983549027 4:168995507-168995529 GACCTCTACCACACAGACATGGG + Intronic
986451676 5:7871295-7871317 GAACTCTAACACGCACGGCAAGG - Intronic
989590065 5:43104875-43104897 CAACCCCACCACACACCCCTTGG + Intronic
990521975 5:56589301-56589323 GAGCTCTTCCTGACACGCCTGGG + Intronic
1008954142 6:57196581-57196603 GAACACGAGCACACAAGCCTGGG + Exonic
1008989402 6:57585582-57585604 GCACTCTCCAACACCCGCCTTGG - Intronic
1009177990 6:60484139-60484161 GCACTCTCCAACACCCGCCTTGG - Intergenic
1014273503 6:119361107-119361129 TAACTCTACCACCCATGCGTTGG + Intergenic
1023173698 7:37414784-37414806 AAAATCTACCACACATCCCTGGG + Intronic
1024417332 7:49121965-49121987 GAACTCTCCCAATCCCGCCTGGG - Intergenic
1028018207 7:85740967-85740989 GAACTGCATCACACATGCCTTGG + Intergenic
1034925183 7:155115479-155115501 GATCTGTCCCACCCACGCCTGGG - Intergenic
1037739848 8:21599790-21599812 GAACTCTACCACAGTCATCTCGG - Intergenic
1040794329 8:51272418-51272440 GAACTCTAACACTCACCCCGAGG + Intergenic
1044742186 8:95339437-95339459 GAACTCTATCACATCTGCCTGGG + Intergenic
1046793229 8:118343712-118343734 CATCTCTACCACAGACCCCTTGG + Intronic
1048226232 8:132588932-132588954 GAACTCTATCACACAGCACTAGG + Intronic
1051903186 9:22064653-22064675 GAACCCACCCACACACGACTGGG - Intergenic
1058152800 9:101480653-101480675 GCAATCTACCACACCCACCTAGG + Intronic
1058768393 9:108206019-108206041 AAAGTCTACCACAGATGCCTGGG + Intergenic
1193865587 X:86726489-86726511 GAATGCTCCCACACACCCCTAGG - Intronic
1202101868 Y:21317823-21317845 GATCTCTACCACAGCCCCCTTGG - Intergenic