ID: 959892967

View in Genome Browser
Species Human (GRCh38)
Location 3:111577349-111577371
Sequence CTGGAGGTCAATAATTAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 157}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959892967 Original CRISPR CTGGAGGTCAATAATTAAGA AGG (reversed) Intronic
900850011 1:5135401-5135423 CAGGAGGTGAATAATGAGGAGGG - Intergenic
901364158 1:8731199-8731221 CTGGAGGTCCAGACTTAAGAGGG + Intronic
904460601 1:30677397-30677419 CTGGAGTGCAATAATGAACAAGG + Intergenic
913082804 1:115404672-115404694 CTGTAGGTCAAGAAGCAAGAGGG + Intergenic
913883795 1:124191064-124191086 TTTGAGGTCAATAATTGAAAAGG + Intergenic
921705559 1:218318995-218319017 CTGGAAGACCATAATTAAAAGGG - Intronic
922451191 1:225738759-225738781 TTGGAGTTTTATAATTAAGAGGG - Intergenic
924453959 1:244203216-244203238 CTGGCAGTCAGTAATTGAGATGG + Intergenic
1063920804 10:10930993-10931015 GTGGAAGCCAATATTTAAGAAGG - Intergenic
1066296957 10:34062488-34062510 CTGGATGTAAATCTTTAAGAAGG - Intergenic
1068731000 10:60357740-60357762 CTGGAAGTGAAAAATGAAGAGGG - Intronic
1068834525 10:61539307-61539329 CTGGAGCTCAGAAATCAAGATGG + Intergenic
1070344034 10:75524267-75524289 CTGAAGGTCAATTATTTACATGG - Intronic
1071022141 10:81070034-81070056 CTAGAGGACAATAATTTTGAGGG + Intergenic
1072521424 10:96233139-96233161 CTGAAGATCAACACTTAAGATGG + Intronic
1073894732 10:108142255-108142277 CTGAAGGTAAAGAAATAAGATGG - Intergenic
1074092901 10:110279392-110279414 CTTGAGGTCAGTTATTAAGGAGG - Intronic
1081269631 11:41067503-41067525 CTTGAGACCAATAATTAACAAGG + Intronic
1082597710 11:55105469-55105491 ATGGAGGTCAACAATGAAAAAGG + Intergenic
1082697791 11:56391351-56391373 CTAGAGGTAAGTAATTAAAATGG + Intergenic
1085726339 11:78958265-78958287 TTGGTGGTTAATATTTAAGAGGG - Intronic
1086367725 11:86124702-86124724 TTGGAGCTGAATAATTAAGGTGG + Intergenic
1086817804 11:91394782-91394804 CTGGAGATGATTAATAAAGATGG + Intergenic
1086945648 11:92841519-92841541 CTGGCAGTCATTAATTTAGAAGG - Intronic
1087268236 11:96084088-96084110 CTGGAGGACATTTATTATGAAGG + Intronic
1087646144 11:100810809-100810831 CTAGATGTCAATAATTAATTAGG - Intronic
1088052651 11:105536657-105536679 CTGGAGAAAAATAATTAAGAGGG - Intergenic
1094867216 12:34550131-34550153 ATTGAGGCCTATAATTAAGAAGG - Intergenic
1095143361 12:38694235-38694257 ATGGACTTCAATAATTATGAAGG + Intronic
1095472139 12:42548709-42548731 ATGGAGGTCATTATTTCAGATGG + Intronic
1096227452 12:49875521-49875543 CTGGATGTCAAAAATTTAGATGG + Intronic
1097358513 12:58630597-58630619 CTAGAGTTCAATATTTAATAGGG - Intronic
1097469042 12:59965861-59965883 ATGCAGGTAAATAATTAAAACGG - Intergenic
1098306625 12:69108976-69108998 CTGGAGGTCTATAAAAAAGTGGG + Intergenic
1098377673 12:69835217-69835239 CTTGAGGTCAGTGATTAACAAGG - Intronic
1101808918 12:108091017-108091039 CTTGAGGTCAAGCATTAAGCTGG - Intergenic
1103883012 12:124180856-124180878 CTGGAAGTCCACAATCAAGATGG - Intronic
1107182419 13:37476585-37476607 CAGAATTTCAATAATTAAGAAGG + Intergenic
1107687910 13:42922559-42922581 CTGGAGGTCAGCAATAAAAATGG - Intronic
1110490839 13:76104375-76104397 CTAGAGGTCATTAAATAATAAGG + Intergenic
1114949670 14:27733767-27733789 CTGGAGCTCAATAACAAAGAAGG + Intergenic
1116602383 14:46942548-46942570 GTGGAGGTGACTAATTACGAAGG - Intronic
1116785739 14:49286734-49286756 CTAGAGGTTAATTATTAAGCAGG + Intergenic
1117020227 14:51562879-51562901 CTGCTGGTCAAGAATTCAGACGG + Intronic
1118333192 14:64830229-64830251 CTGGAGTACAATAATGAAAAAGG - Intronic
1120113743 14:80589242-80589264 CTGGAGGTCAGGAATGAAAATGG - Intronic
1122030817 14:98910371-98910393 CTGGAGGTCATTATTCAAGCAGG + Intergenic
1124181812 15:27483180-27483202 CTGGAAGTCTAAAATCAAGATGG + Intronic
1128162437 15:65432556-65432578 CTGGAGGTAAATAATAGTGATGG + Intergenic
1131205638 15:90443641-90443663 CTGAAGATAAATAATTAAAACGG - Intronic
1131917753 15:97289240-97289262 AGGGATGTCAATAATGAAGAGGG - Intergenic
1133210856 16:4262738-4262760 CTGGAGATGAATGATGAAGAGGG - Intronic
1135794266 16:25426238-25426260 CTGGGGATCAACAATTAAGGAGG + Intergenic
1138488467 16:57361845-57361867 CTGCAGGTGAATAATAAAAAAGG + Intronic
1142638107 17:1270347-1270369 CTGGAGGCCGATAATAAAGCAGG + Intergenic
1143673197 17:8411231-8411253 GTGGGGGTCAATCCTTAAGAAGG + Intergenic
1143843362 17:9752733-9752755 CAGGAGGTGAATAATTAAGCAGG + Intergenic
1146991040 17:37272587-37272609 TAGGAGGTCAGTAAGTAAGAAGG + Intronic
1148661554 17:49337668-49337690 CTAGAGGTAAATAATAAACAAGG + Intronic
1149060953 17:52421097-52421119 CTGGTGGATAATAATGAAGACGG + Intergenic
1155040968 18:22065536-22065558 ATGGAGGTGAAGAAGTAAGAGGG + Intergenic
1155193119 18:23448946-23448968 CTGGAGCTAAAGAATTAAGTTGG - Intergenic
1156549399 18:37999745-37999767 CTGGAGCTCAGGAATTAATATGG - Intergenic
1159268944 18:66123749-66123771 GTGGAGCTTAATAATTATGAAGG - Intergenic
1159594948 18:70373933-70373955 CTGGAGATAAACAATCAAGACGG + Intergenic
1159863459 18:73676089-73676111 CTTGAGGACAAGAATTAAGCTGG + Intergenic
1161511094 19:4671478-4671500 TGGGGGGTCAATAATTAAGCTGG + Intergenic
925823979 2:7828724-7828746 ATGGAGGTCAAGAATTCAGCAGG - Intergenic
926388879 2:12366917-12366939 CTGAAGGTCAATGATTCAGAAGG + Intergenic
928523975 2:32120898-32120920 CTGGATGTCAAGATTTAAGTTGG + Intronic
931931679 2:67144447-67144469 ATGGAAGTCAATAATTATGGTGG + Intergenic
937339511 2:121082224-121082246 CTGGAAGTCCAAAATCAAGATGG + Intergenic
939915748 2:148041113-148041135 CTGGACTTCAATAAATAAGCTGG - Intronic
943017835 2:182535772-182535794 CTTGAGGGCTATTATTAAGAGGG + Intergenic
944214085 2:197236467-197236489 CTGTAGGCCAATAAAAAAGAGGG + Intronic
946984989 2:225261589-225261611 CAGTAGGTCAATGAATAAGAAGG + Intergenic
1169806933 20:9569066-9569088 CTGTAGGTCACAAATTGAGAGGG - Intronic
1170062938 20:12278161-12278183 TTAAAGGTCAAGAATTAAGAAGG + Intergenic
1175019679 20:55831533-55831555 ATGCAGGTAAATAATTAAAATGG - Intergenic
1175680132 20:60980913-60980935 CTGGAGGTCATTATTTCAGTGGG + Intergenic
1176926180 21:14752155-14752177 CTGGAGGAGTATAATTTAGAGGG - Intergenic
1177429149 21:20967501-20967523 CTGGAGATGAATATTTAATATGG + Intergenic
1177768824 21:25491760-25491782 CAGGAGGTCAAGAATTGTGATGG - Intergenic
1179081994 21:38179920-38179942 CAGAAGGTCAGAAATTAAGAGGG + Intronic
1181410702 22:22716521-22716543 CTGGATGTCAATGAGGAAGAAGG - Intergenic
1183554179 22:38512357-38512379 ACGGAAGTCAAAAATTAAGATGG + Intergenic
1183877279 22:40794517-40794539 CTGGAGATCATTAAAGAAGAAGG - Exonic
949588591 3:5468503-5468525 GTTGAAGTCAATAATTAACATGG - Intergenic
953759692 3:45676931-45676953 CTGGAGCTCAATGATGAAGATGG + Exonic
955821700 3:62902665-62902687 ATGAAGATCAATAATGAAGAAGG - Intergenic
959750751 3:109831725-109831747 CTGCATGTCTTTAATTAAGAGGG + Intergenic
959892967 3:111577349-111577371 CTGGAGGTCAATAATTAAGAAGG - Intronic
960816280 3:121676557-121676579 CAGGAGGACAATTCTTAAGAGGG + Intronic
962006659 3:131356515-131356537 CTGTAGGTCAGGAATTAAAAGGG - Intergenic
964162167 3:153658670-153658692 TTGGGGTTCAATAATTCAGAGGG + Intergenic
965655415 3:170978179-170978201 TTGGAGGTGAGTAAATAAGAAGG + Intergenic
968952777 4:3703269-3703291 CTGAAGTCCATTAATTAAGAGGG + Intergenic
971743307 4:30547434-30547456 CTGGAGGTTAATCATTAGGAAGG + Intergenic
972679423 4:41290983-41291005 TGGGAGGAAAATAATTAAGATGG - Intergenic
972876618 4:43369746-43369768 ATGAAGTTCAAAAATTAAGAAGG - Intergenic
974335777 4:60542493-60542515 TTGAAGTTCAATAATTAAGGAGG - Intergenic
974813064 4:66970793-66970815 CTTGAGATCAAAAATCAAGAAGG + Intergenic
976572064 4:86623861-86623883 ATGGAGGAAAATAACTAAGAAGG - Intronic
977400330 4:96523612-96523634 GTGGAGGTCTAGAATTGAGATGG - Intergenic
977909057 4:102511098-102511120 CTGGAGGTCAAAAAAAAGGAAGG - Intronic
978574818 4:110179130-110179152 CTGGAGGCCTAGAATTATGAAGG - Intronic
979008963 4:115342266-115342288 CTGGAGGACAAAAAAAAAGAGGG + Intergenic
980380735 4:132011751-132011773 CTGAAGGTCAGAAATTCAGATGG - Intergenic
982435026 4:155375302-155375324 CTGGAGGGTAACAAATAAGAAGG + Intronic
987193480 5:15501505-15501527 CTGCAGTTCAAAAGTTAAGAAGG + Intronic
987270402 5:16302580-16302602 CTGGAGGTCAATCATGAAACTGG + Intergenic
989148051 5:38268356-38268378 CTGGAGGTCCATTTTAAAGATGG - Intronic
990036279 5:51324504-51324526 CTAGAGCTCAAAAATTCAGAAGG + Intergenic
993897028 5:93548091-93548113 CTGAAGGAAAATATTTAAGAAGG - Intergenic
995274684 5:110264756-110264778 CTGGAGGTCTACTATTAAAATGG + Intergenic
996907967 5:128623448-128623470 CTGTAGGTAAGCAATTAAGAAGG - Intronic
998241342 5:140447968-140447990 CTGGAGTTCTATTATTAAAAAGG + Intronic
999590114 5:153135758-153135780 CTGGAGGTGAGGAATAAAGAGGG + Intergenic
1004790980 6:19026180-19026202 CTGCAGCTCAAAAATTGAGAAGG + Intergenic
1005180661 6:23102015-23102037 CTGGAGGTAAACAATTAACGAGG + Intergenic
1007286569 6:40752102-40752124 CTGAAGGTCAGTAGTGAAGAGGG - Intergenic
1008096358 6:47343415-47343437 CTGGATTTCTATAATGAAGAAGG - Intergenic
1011186792 6:84686126-84686148 CTGGAGGAGTATAACTAAGAAGG - Intergenic
1012385053 6:98671029-98671051 CTGGATGTCAATTATTTAGGTGG + Intergenic
1012618856 6:101314493-101314515 CAGGCTGTCAATAATTGAGATGG + Intergenic
1014251716 6:119122187-119122209 CTGGAGGTCCAGAATGGAGAGGG - Intronic
1014509530 6:122304071-122304093 GTGAAGATCAACAATTAAGAGGG - Intergenic
1016545494 6:145218666-145218688 CAGGAGGGCAGTAGTTAAGAGGG - Intergenic
1018291544 6:162296740-162296762 CTTGAGGACAAAAATTAAAAAGG + Intronic
1019200238 6:170307841-170307863 CTGGAGGTAAAGAAGTGAGAGGG + Intronic
1019959240 7:4444571-4444593 ATGAAGATCAACAATTAAGAGGG - Intergenic
1020585849 7:10065694-10065716 CTGGAGTTCAATAAATCAGCAGG + Intergenic
1021389526 7:20074430-20074452 CTGGAAGTGATTAATCAAGAGGG - Intergenic
1022180163 7:27911231-27911253 CTGGATGTTAATATTAAAGAAGG + Intronic
1022252959 7:28627111-28627133 CTGGTTTTCCATAATTAAGATGG + Intronic
1024438739 7:49389826-49389848 CTGGACATCAATATTTAAAAAGG + Intergenic
1025599779 7:62981660-62981682 ATGGAGGTCTATGGTTAAGAAGG + Intergenic
1028071394 7:86455357-86455379 ATGGAGGTAAATAACTTAGAAGG + Intergenic
1028220229 7:88188629-88188651 GTGGTGGTAAATAATTGAGATGG + Intronic
1028977659 7:96932085-96932107 CTGGGAGTCAAGAATGAAGAGGG - Intergenic
1030068992 7:105682309-105682331 CTGTACGTTAAAAATTAAGATGG + Intronic
1032645296 7:133817302-133817324 CTGGAGGACAAACAGTAAGAAGG - Intronic
1040728671 8:50414964-50414986 CTAGAGGTGAACAATAAAGATGG + Intronic
1042013916 8:64285374-64285396 CTGGAGGTGAATAATTCAGTTGG + Intergenic
1044463197 8:92471629-92471651 CTATTGGTTAATAATTAAGAGGG - Intergenic
1044756222 8:95464447-95464469 CTGTAGGTGAAGATTTAAGAAGG + Intergenic
1045382312 8:101639587-101639609 CCACAGGTCAAGAATTAAGAGGG - Intronic
1045459839 8:102415855-102415877 CTAGAAGTTAATAATTTAGAAGG + Intergenic
1045477654 8:102567004-102567026 CTGTAGGTCAGAAATTCAGATGG + Intergenic
1045758739 8:105576754-105576776 CTTGAAGTTAATCATTAAGAAGG + Intronic
1046034964 8:108829650-108829672 CTGGAGATCAAAAACTAACATGG + Intergenic
1046564186 8:115877751-115877773 CTGAAAGTCTATAATTAGGATGG + Intergenic
1050084083 9:1946188-1946210 CTGGCGAACAATAATAAAGATGG - Intergenic
1052112317 9:24601996-24602018 CTGGAGGAAAATACTTAGGAAGG - Intergenic
1054818325 9:69497152-69497174 ATGGTGGTGAATAATTAAGTAGG - Intronic
1185923197 X:4116761-4116783 ATTTAGGTCAATAATTAACAAGG - Intergenic
1186759689 X:12710482-12710504 CAGGAGGTCGATATTTAACATGG + Exonic
1187789069 X:22928317-22928339 CTGGAAGGCAATTATCAAGAAGG + Intergenic
1188243247 X:27813184-27813206 TTGGAGATCACTAAATAAGATGG - Intronic
1190980699 X:55454730-55454752 CTGGATGTCAAGAAGGAAGAAGG - Intergenic
1190987998 X:55518450-55518472 CTGGATGTCAAGAAGGAAGAAGG + Intergenic
1192962051 X:76141659-76141681 CTGGATATAAATAAATAAGAAGG + Intergenic
1194008448 X:88527734-88527756 CTTAAGGCCAATAATTATGATGG - Intergenic
1197200767 X:123746736-123746758 CTGGAGCCCATTGATTAAGAGGG - Intergenic
1197966737 X:132071571-132071593 CTGGAGGTCAGTTCTTTAGAGGG - Intergenic
1199165440 X:144668060-144668082 CTGGGGTGCAATATTTAAGATGG - Intergenic
1199388552 X:147251870-147251892 TTGGAGGTAAGTAAGTAAGATGG + Intergenic
1201942792 Y:19477794-19477816 CTGGAGGCCAAGAATTATGAGGG - Intergenic