ID: 959895827

View in Genome Browser
Species Human (GRCh38)
Location 3:111604758-111604780
Sequence ATCTAGCTCTTTACAGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 1, 1: 0, 2: 5, 3: 37, 4: 221}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959895827_959895828 -6 Left 959895827 3:111604758-111604780 CCTTCTTCTGTAAAGAGCTAGAT 0: 1
1: 0
2: 5
3: 37
4: 221
Right 959895828 3:111604775-111604797 CTAGATAGTAAATATATTTTAGG 0: 1
1: 0
2: 10
3: 93
4: 518

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959895827 Original CRISPR ATCTAGCTCTTTACAGAAGA AGG (reversed) Intronic
902855664 1:19202687-19202709 CTCTAGATTTTTTCAGAAGAGGG - Intronic
903127368 1:21257142-21257164 GTCTTGCCTTTTACAGAAGAGGG - Intronic
903695603 1:25204283-25204305 ATCTGGCTCTTTACAGAAAAAGG - Intergenic
905567064 1:38973934-38973956 AACTAGCTCTTAACAGATGTGGG - Intergenic
906776828 1:48537353-48537375 CTCTAGATCTTTTCTGAAGAGGG + Intronic
908489097 1:64625074-64625096 ATCTGGCCCATTACAGAAGTTGG + Intronic
912487543 1:110041036-110041058 ATCAAGCTGTGTACACAAGAAGG - Intronic
915891244 1:159775922-159775944 ATATAGGTCTTTCCACAAGATGG - Intergenic
916308464 1:163366869-163366891 ATCTGGCCCTTTACAAAGGAAGG + Intergenic
918672574 1:187238295-187238317 TTTTAGCTCTTTAAGGAAGACGG - Intergenic
918758413 1:188368364-188368386 ATCTAGTTCTTAACAGAATTTGG + Intergenic
918988415 1:191663589-191663611 ATCTAGGTATTTACAAAAGGTGG - Intergenic
922246682 1:223805928-223805950 ATGTAGCCCTTTACAGAGAAAGG + Intronic
922914194 1:229242011-229242033 GTCTTGCTCTTTACAGACAAAGG + Intergenic
922996489 1:229966423-229966445 TTCTAGCTATTTACAGATGGAGG - Intergenic
923492598 1:234497631-234497653 ATCTAGCCCTTTATAGGAAAAGG - Intergenic
924352972 1:243136995-243137017 CTCTGGCTCTTTACAGAGGTTGG - Intronic
1063207226 10:3844689-3844711 ATCTAGCACTTTGCAGAAGAAGG - Intergenic
1065638100 10:27751875-27751897 ATCCGGCCCTTTACAGAAAAAGG - Intergenic
1066044908 10:31586481-31586503 ATTTAGCCTTTTACAGTAGAAGG + Intergenic
1066570976 10:36771529-36771551 ATCTTCCTCTTTAGAAAAGATGG + Intergenic
1072441326 10:95458489-95458511 ATCTAGCTATCTAGAGAAAAGGG + Intronic
1078184915 11:9043708-9043730 ATATAGATGTTTTCAGAAGAAGG + Intronic
1078197281 11:9146477-9146499 GTCTCTCTATTTACAGAAGAGGG - Intronic
1080509955 11:32959292-32959314 CTATAGCCCTTTACAGAAAAAGG + Intronic
1081028648 11:38049003-38049025 ATCTGGCCCTTTAGAGAAAATGG + Intergenic
1081372340 11:42319503-42319525 ATCTTTCTCTTTACACAAAATGG + Intergenic
1081554449 11:44145056-44145078 ATCTAGTTTTTTTCTGAAGATGG - Intronic
1083049584 11:59765328-59765350 TTCTGGCTCTTTAAAGAAGAGGG + Intronic
1083595029 11:63915103-63915125 AGCTAGCTCTTCTCAGAAGGGGG - Intronic
1084343719 11:68528368-68528390 ATATATTTCTTTAGAGAAGAGGG - Intronic
1084953042 11:72677197-72677219 AGCTACCTCTTTGCCGAAGAAGG + Intergenic
1085729517 11:78984325-78984347 ATCTAGCCCTTCAGAGAAGGGGG - Intronic
1086546343 11:87972022-87972044 ATGTAGCTGTACACAGAAGATGG + Intergenic
1087794919 11:102445675-102445697 ATTTAGATTTCTACAGAAGAAGG - Intronic
1088205860 11:107391525-107391547 ATAAAGCTGTTTACAGAACAAGG - Intronic
1088324567 11:108588386-108588408 ATCTAGCTCATAACAGAACCAGG - Intronic
1088758313 11:112905841-112905863 ACCTGGCCCTTTACAGAAAAAGG - Intergenic
1091611331 12:2012486-2012508 ATCTAGTCCTTTACAGAAAAAGG + Intronic
1095310664 12:40693125-40693147 ATCTAGCTCCCTTCAGGAGATGG + Intronic
1095614705 12:44174401-44174423 ATCCAGTTATTTACAGAAAAAGG + Intronic
1095631677 12:44384200-44384222 ATTTATCTGTTTACAGAGGAAGG - Intronic
1095658911 12:44705543-44705565 ATTTAGCTATTTAAAGAAGAAGG - Intronic
1096165075 12:49415713-49415735 ATCTGGCCCTTTACAGAAAAAGG - Intronic
1097303633 12:58045078-58045100 ATCTAGGTTTTCTCAGAAGAAGG + Intergenic
1097591921 12:61585216-61585238 ATCAAGATCATTACAGAACAAGG - Intergenic
1098999630 12:77164034-77164056 ATATAGGGCTTTGCAGAAGAGGG + Intergenic
1100303648 12:93330626-93330648 AGCTGGTTCTTTACAGAAAAAGG + Intergenic
1103036170 12:117658586-117658608 ATCTGGCCTTTTACAGAAAAAGG + Intronic
1103877270 12:124137941-124137963 ATCTAGTTCTTTAGGTAAGAAGG - Intronic
1104204078 12:126619457-126619479 ATCTAGCTCTATCTAGCAGATGG + Intergenic
1104538394 12:129640185-129640207 ATCTGGCTCTTTCCAGAAAAAGG - Intronic
1105382144 13:19897322-19897344 ATCTATCTCTTTTTAGAAGTGGG - Intergenic
1106061751 13:26299845-26299867 ATCTGGCCCTTTACAGAAAAGGG - Intronic
1106878049 13:34097530-34097552 ATGTAGATCTTTTCAAAAGATGG + Intergenic
1107038548 13:35924988-35925010 ATCTTGCTTTTTCCAGAAAAAGG + Intronic
1108272645 13:48777134-48777156 ATTTAACTCTTTCCAGAACATGG - Intergenic
1112117647 13:96374583-96374605 CTCAAGGTCTTTGCAGAAGATGG - Intronic
1112976265 13:105322252-105322274 ATCTTGCAATTTACAGAAGAGGG + Intergenic
1113220255 13:108092690-108092712 ATCTAGCTCTTTTGAGAACAAGG + Intergenic
1113356700 13:109587995-109588017 ATCTGGCCCTTTACAGAAAAAGG + Intergenic
1115491718 14:33964654-33964676 ATCCAGCTCTTCTCAGTAGAGGG + Intronic
1116975999 14:51116690-51116712 ATCTGGCTCTTGATAGATGAGGG - Intergenic
1120010793 14:79412088-79412110 ATCATGGTCTTTACAGAAGCAGG + Intronic
1120449320 14:84646335-84646357 ATATAGCCCTTAACAGAAGCTGG - Intergenic
1122446687 14:101774833-101774855 ATCTGGCCCTTTACAGAAAAAGG - Intronic
1127570562 15:60237220-60237242 ATCGAGATTTATACAGAAGATGG + Intergenic
1127621075 15:60735357-60735379 CTGTAGCTCTTTTAAGAAGAGGG + Intronic
1128373222 15:67056235-67056257 ATCATGCCCTTTTCAGAAGAGGG - Intergenic
1129041777 15:72693450-72693472 ATCTGGCCCTTTACAAAAAAAGG - Intronic
1130282579 15:82531438-82531460 ATATAGCTATTTATAGAACAGGG + Intergenic
1131334859 15:91539104-91539126 ATCTGGCCCTTTACAGAAAATGG + Intergenic
1131441581 15:92463711-92463733 ATCTAGCCCCTTACAGAAAAAGG + Intronic
1132003368 15:98202755-98202777 AATTATCTCTTTTCAGAAGAGGG - Intergenic
1134252264 16:12582685-12582707 TTCTTGCTCTTTACAGAACCAGG + Intergenic
1134317770 16:13135391-13135413 ATGTAGATCTCTACAGATGAAGG - Intronic
1136612330 16:31373747-31373769 ATCTAGCCCTTTATAGAAAAAGG - Intronic
1139211902 16:65086191-65086213 GTCTAGCCCTTTACAGAAATTGG + Intronic
1139566654 16:67781768-67781790 ATCTAGCTCAAGAGAGAAGAGGG + Intronic
1140761536 16:78113318-78113340 ATCTAGCCCTTTACAGGCAAAGG - Intronic
1140774308 16:78235920-78235942 ATCCAGCCCTTTAGAGAAAAAGG - Intronic
1141011638 16:80405879-80405901 ATCTACTTAATTACAGAAGAAGG + Intergenic
1143005303 17:3828366-3828388 TTCCAGCCCTTTACAGAAAAAGG + Intronic
1144114218 17:12070798-12070820 ATCTGGTTCTTTACAGAAAAAGG + Intronic
1144135440 17:12290707-12290729 ATCTGACCCTTTACAGAAAAAGG + Intergenic
1150663797 17:67110819-67110841 ATCTGGCTTTTTACAGAAGAAGG + Intronic
1151849722 17:76683193-76683215 ATCTGGCTGTTTGCAGAAAAAGG - Intronic
1155605505 18:27601184-27601206 ATCTGACTCTTTACAGACAATGG + Intergenic
1155607064 18:27618871-27618893 ATCTACCTAATTACAGAGGAGGG - Intergenic
1156370336 18:36467106-36467128 CTCCAGCTCTTTACAGCAGGTGG + Intronic
1158256965 18:55562278-55562300 CTCTAGTTCTTTACTGAGGAAGG + Intronic
1160702569 19:515019-515041 ATCTGGCCCCTTACAGAAGAAGG - Intronic
1163142589 19:15360409-15360431 ATCTGACTCTTTACAAAATAAGG + Intronic
1164751998 19:30663564-30663586 ATCTAGAACTTTACAGATGGTGG - Intronic
1165803791 19:38568194-38568216 ATGTAGCTCTGGACAGAGGATGG - Intronic
927456556 2:23255334-23255356 ATCTGGCTCTTTACAAATAATGG + Intergenic
928934503 2:36661232-36661254 ATTTTGCTCTTTATAAAAGATGG - Intergenic
929717419 2:44327125-44327147 ATGTAGCTCTTTAGAGAAAAAGG + Intronic
930895771 2:56444363-56444385 ACCTATCTCTTTACAGATAAAGG - Intergenic
932049126 2:68381447-68381469 ATCTAGCTCCTGACAGAGGTTGG + Intronic
933907770 2:86912613-86912635 ATCTATGTCGTTACAGAAGTAGG + Intronic
933909018 2:86922328-86922350 ATCTATGTCGTTACAGAAGTAGG + Intronic
933928609 2:87124908-87124930 ATCTATGTCATTACAGAAGTAGG + Intergenic
933999944 2:87700694-87700716 ATCTATGTCATTACAGAAGTAGG + Intergenic
934166191 2:89296415-89296437 ATCCAGTTCTTCACAGAAGCTGG - Intergenic
935016545 2:99187939-99187961 ATCTGGTCCTTTACAGAAAACGG + Intronic
935404545 2:102695303-102695325 CTCTGGCTATTTACAGAAGAGGG - Intronic
937543482 2:122988428-122988450 ATCTGGCCCTTTACAAAAAAAGG - Intergenic
939381063 2:141436863-141436885 ATATAGTTCTTAACAGAACATGG + Intronic
940930284 2:159421015-159421037 ATCAAGATTTTTACAGAAGCTGG + Intronic
941107589 2:161375680-161375702 AACTAGCATTTTACAAAAGATGG + Intronic
941318378 2:164023685-164023707 CTCTAGCTTTTTAAAGAAAAAGG - Intergenic
941469422 2:165865911-165865933 TTCTAGATCCTTTCAGAAGATGG - Intronic
941618498 2:167750948-167750970 ATCTGGCCCTTTATAGAAAAAGG - Intergenic
941970751 2:171348272-171348294 ATCTGGCCCATTACAGAAAAAGG - Intronic
943858705 2:192832265-192832287 TTCTAGCCCTTTGCAGAAGATGG + Intergenic
945377473 2:209096308-209096330 ATCATGCTCTTTGCAGAACATGG - Intergenic
946449916 2:219771101-219771123 ATCTGGCTCCTACCAGAAGAAGG - Intergenic
946718056 2:222574206-222574228 ATCTACCTCTCTCCAGAAGTTGG + Intronic
948497203 2:238358923-238358945 ATCTGGCCCTTTACAGAAAGTGG - Intronic
1169240994 20:3980836-3980858 TTCCAGCTCTATACAGAAAAAGG + Intronic
1173987561 20:47273858-47273880 ATCTAGCCCCTGACAGAAAAGGG + Intronic
1174654045 20:52154899-52154921 ATCTGGCCCTTTTCAGAAAAAGG + Intronic
1174772777 20:53316800-53316822 ATCTGGCACTTTGCAGAAAAAGG + Intronic
1175190564 20:57209856-57209878 ATCTAGCTTTTTCCAGAAATAGG - Intronic
1175593515 20:60212678-60212700 ATCTGGGTGTTTGCAGAAGAAGG + Intergenic
1176697528 21:9997807-9997829 TTCTAGCTGTTTATAGAGGATGG + Intergenic
1177519682 21:22203198-22203220 AAATAGCACTTTATAGAAGAAGG - Intergenic
1179164335 21:38924187-38924209 ATCTTGCTCTTTACAGCCAAGGG - Intergenic
1179228313 21:39476245-39476267 GCTTGGCTCTTTACAGAAGAGGG + Intronic
1181349740 22:22246372-22246394 ACCTGGCTCTTTATAGAAAATGG - Intergenic
1184986916 22:48141990-48142012 ATCCTTCTCTTTGCAGAAGATGG + Intergenic
950159367 3:10748095-10748117 ATCTGGCTCTTTACAGAAAAAGG - Intergenic
951571590 3:24069375-24069397 ACCTGTCTCTTTACAGAAAAAGG + Intergenic
951865728 3:27305099-27305121 ATCGGGCTCCTTACAGAAAATGG - Intronic
952065019 3:29559047-29559069 ATTAAGCTCTTTACAGAAAGTGG + Intronic
953854470 3:46490220-46490242 ATCTGGCTCTTTACAGAAAGAGG - Intergenic
954728838 3:52639975-52639997 GTTTAGCTCTTGAGAGAAGAGGG + Intronic
955752048 3:62193297-62193319 ATTTCGCTCTGAACAGAAGATGG + Intronic
956245955 3:67183373-67183395 ATCTAGCCCTTTAGAGAAAAAGG - Intergenic
956797675 3:72731243-72731265 ATCTGGACCTTTACAGAAAAAGG - Intergenic
956798412 3:72736348-72736370 ATCTGGACCTTTACAGAAAAAGG - Intergenic
957315178 3:78567384-78567406 CTCTAGCTCTTAAGAGTAGAAGG + Intergenic
957608615 3:82437329-82437351 ATCTGGCACTTTACAGAAAAAGG - Intergenic
957962098 3:87269354-87269376 GTCTGGTTCTTTACAGAAAAGGG + Intronic
958528650 3:95294414-95294436 ATCTAATCCTTTAGAGAAGAAGG + Intergenic
959573862 3:107912978-107913000 CTCTGGCCCTTTACAGAAAAAGG - Intergenic
959895827 3:111604758-111604780 ATCTAGCTCTTTACAGAAGAAGG - Intronic
960661100 3:120059878-120059900 TTCTAAGTGTTTACAGAAGAAGG - Intronic
962646039 3:137441253-137441275 TTCTATCTCTTTTCAGAGGAGGG - Intergenic
962917547 3:139918115-139918137 AGCTAGGTGCTTACAGAAGAAGG - Intergenic
964855312 3:161140053-161140075 ATACAGATTTTTACAGAAGACGG + Intronic
965213737 3:165831163-165831185 ATGTAGGCCTTTACAGAAGCAGG - Intronic
965724992 3:171705995-171706017 CTCTTGCTCTTTAAAGAAAAAGG + Intronic
967582389 3:191174758-191174780 AGATAGCTCTTTACAGAATTGGG - Intergenic
971638560 4:29098038-29098060 CTCTTGTTCTTTACAGAAAAGGG + Intergenic
971809778 4:31409624-31409646 ATTTAGCTTTTTAGAGAACAAGG - Intergenic
972245341 4:37241296-37241318 AGCTAGCTCTTTATAAAACAAGG - Intergenic
972623207 4:40769328-40769350 TTCTAGTTGTTTACAGTAGAAGG - Intronic
973147916 4:46851692-46851714 ATCTAGGTCATTAAAGAAAAGGG - Intronic
973278683 4:48336599-48336621 ATATAACTGTTTACATAAGAAGG + Intergenic
973314514 4:48746191-48746213 ATCCAGATCCTTAGAGAAGAGGG - Intronic
974121203 4:57640964-57640986 ATGTGGCCCTTTACAGAAGAAGG + Intergenic
974195733 4:58572423-58572445 ATCTATCTATCTAAAGAAGAGGG + Intergenic
974447739 4:62007983-62008005 ATCTAGCTTTTCAAATAAGATGG + Intronic
979153790 4:117356243-117356265 ATTTCTCTCTTTACATAAGATGG + Intergenic
979169147 4:117577622-117577644 ATCTAGCTCTTTATTTAAAAGGG + Intergenic
979248975 4:118543532-118543554 CTCTGGCTCTTTACAGAGGTTGG + Intergenic
980131291 4:128818587-128818609 ACCTGGCTCTTTACAGAGAAAGG - Intronic
980521422 4:133940719-133940741 ATCTTGCTCTTTACAGTCAAAGG - Intergenic
982957502 4:161790982-161791004 ATCTAGATCTTTCAAAAAGATGG - Intronic
984059355 4:174973173-174973195 ATCTAGCTTTCTGCAGAGGATGG - Intronic
984729859 4:183057834-183057856 ATCTAGCTCTTTACATACTTTGG + Intergenic
984868529 4:184306757-184306779 CTCTGGCTCTTCACAGAAAAAGG + Intergenic
985980549 5:3458810-3458832 CTTTTGCTCTTGACAGAAGAGGG - Intergenic
986100070 5:4600042-4600064 ATCCAGCTCTCTTCAGAAAACGG + Intergenic
986112050 5:4729086-4729108 ATCCAGCTCTTTACATCTGATGG - Intergenic
987841358 5:23226111-23226133 ATCTAGCTATTTGCAGAGAAAGG - Intergenic
990204914 5:53418133-53418155 GTCTGGCCCTTTACAGAAAAAGG + Intergenic
990432087 5:55745879-55745901 ATCAAACTCTTTACAGAATCAGG + Intronic
991497735 5:67244088-67244110 ATCTTGCCCTTTACAGAAAAAGG - Intergenic
991615529 5:68493422-68493444 ACATAACTCTTTACATAAGATGG + Intergenic
993557657 5:89361619-89361641 ATTTGGCTCTTTACAGAAAAGGG + Intergenic
993658990 5:90607059-90607081 ATATAGCACTTTACAGAAAAGGG + Intronic
994890191 5:105623491-105623513 ATCTCGCTCTCTACAGAGGAGGG - Intergenic
996445199 5:123540409-123540431 CTCTAGCTATTTTAAGAAGAAGG + Intronic
998025493 5:138812121-138812143 ATGTAGGTCTGTAAAGAAGATGG - Intronic
998536387 5:142935338-142935360 ATCTGGCCCATTACAGAAAAAGG - Intronic
999454898 5:151707062-151707084 TTCTCCCACTTTACAGAAGAAGG - Intergenic
1000263790 5:159615693-159615715 ATAAAGCTCTTTACAGTTGAGGG - Intergenic
1003880926 6:10478994-10479016 ATCTAGCCCTTCACAGAAAAAGG + Intergenic
1005175337 6:23038273-23038295 ATCTAGCTTTTTCCAGAAAAAGG + Intergenic
1007170214 6:39857387-39857409 ATCCAGCTCTTTAAATAACAGGG + Intronic
1007264185 6:40585055-40585077 AACTGGCACTTCACAGAAGAAGG + Intronic
1007363711 6:41375528-41375550 GTCTTGCTCTCTGCAGAAGAAGG + Intergenic
1010664888 6:78617474-78617496 ATCTAGCCTCTTATAGAAGAGGG + Intergenic
1011840834 6:91496471-91496493 ATCTAGATATTTCCAGAATAAGG + Intergenic
1011955018 6:93015863-93015885 AACAGGCTCTTTACAGAGGAAGG - Intergenic
1012168991 6:95994888-95994910 TTCTAGATCTTTAAAGAATAAGG - Intergenic
1012391583 6:98747099-98747121 CTCTACCTCATTCCAGAAGAAGG + Intergenic
1013545061 6:111148643-111148665 CTGTAGTTCTTTACAGAAGTTGG + Intronic
1014114166 6:117653831-117653853 ATCTAGCCTTTTACAGATAAAGG + Intergenic
1014203995 6:118635985-118636007 ATCTGGCTCTTGACAGAAAAAGG - Intronic
1014534199 6:122596654-122596676 ATCTAGTTATCTGCAGAAGATGG + Intronic
1015346357 6:132164112-132164134 ATGTGCCTCTTTTCAGAAGAGGG - Intergenic
1015633975 6:135257869-135257891 ATCTTGCTCTTTACAGAGAAAGG - Intergenic
1015710350 6:136132385-136132407 ATCCTGCTCTTTACAGGAAAGGG - Intronic
1016494782 6:144648479-144648501 TTCTAGCTCATTTCACAAGAGGG + Intronic
1016795982 6:148117985-148118007 ATCTAGCTCATAACATAAGCTGG + Intergenic
1017211174 6:151858284-151858306 ATCTAGGTCTTTACAGCTGCTGG + Intronic
1017699932 6:157058892-157058914 ACTTAGCTCTTTGCAGAGGAGGG + Intronic
1018247870 6:161839606-161839628 ATCTAGAGCTTTGCAGACGAGGG - Intronic
1018789489 6:167135864-167135886 ATCTGGCCCTTTACAGAAAGAGG + Intronic
1022528994 7:31055399-31055421 ATCTGGCACTTTACAGAAAAAGG - Intronic
1022792224 7:33700441-33700463 ACTTTGCTCCTTACAGAAGAGGG - Intergenic
1022830569 7:34061650-34061672 ATCTAGCCCTTTAGAGACCAAGG - Intronic
1023535557 7:41205321-41205343 CTCTGGCTCTTTACAGAAAAAGG - Intergenic
1023536244 7:41214828-41214850 TTCTAGCTCTTTTCAGCAGGAGG + Intergenic
1023610576 7:41966716-41966738 AGCTGGCCCTTTACAGAAAAGGG - Intronic
1024215530 7:47245329-47245351 AACTAGCTCTTTTCTGAAGATGG + Intergenic
1027770151 7:82396429-82396451 ATCTGGCTCTTTAAAAATGAAGG + Intronic
1028084766 7:86623073-86623095 GTCTAGATCTTGACAAAAGATGG + Intergenic
1028169817 7:87582588-87582610 ATCTGGCCCTTTATAGAAAAAGG - Intronic
1028773319 7:94652278-94652300 ATTTAGGTGTTTACAGAATATGG + Intronic
1031063845 7:117082706-117082728 GTCTGGCTCTTTACAGAAAAGGG - Intronic
1031369894 7:120951671-120951693 ATATAGCTCTTTAGAGACCATGG + Intronic
1032332178 7:130990792-130990814 GTCTAGATATTTACAGCAGAGGG - Intergenic
1033339046 7:140478269-140478291 ACCTAGCTCTACGCAGAAGAGGG - Intronic
1034083843 7:148305488-148305510 ATGTAGTTCTTTATAGCAGAAGG - Intronic
1035132813 7:156671374-156671396 CATAAGCTCTTTACAGAAGAAGG + Intronic
1036480350 8:9133829-9133851 ACCTAGTTCTTTACAGGAAAAGG + Intergenic
1038945043 8:32349871-32349893 ATCCAGCTCTTTGCAGCAGCAGG + Intronic
1039278292 8:35955661-35955683 ATCTAGTTGTTTAGAGAAGTAGG - Intergenic
1039994160 8:42517171-42517193 ATCCAGGTCTTTACAGAAAGAGG + Intronic
1040555026 8:48470700-48470722 CTGAAGTTCTTTACAGAAGAGGG + Intergenic
1040656575 8:49517070-49517092 ATCCAGATCTTTTCAGAAGTTGG - Intergenic
1040716379 8:50257751-50257773 AGCTTGCTCTTAACTGAAGAGGG - Intronic
1043724992 8:83600195-83600217 TTCTAGCTCTTTACAGTGGGAGG - Intergenic
1043996391 8:86822774-86822796 CTCTGGCTCTTTACAGAAAGAGG - Intergenic
1046210429 8:111066210-111066232 ATCTAACTCTTTGCAAAACAAGG - Intergenic
1046287206 8:112109734-112109756 ATGTGGCAATTTACAGAAGATGG + Intergenic
1050235079 9:3569349-3569371 ATCTGGCCCTTTACAGAAAAAGG + Intergenic
1052395648 9:27934919-27934941 ATCTGGCACTTTACAAAAGCTGG - Intergenic
1052809682 9:33046283-33046305 AACTAGTTCTATCCAGAAGATGG + Exonic
1055513594 9:77017212-77017234 ATCTAGCTCCTGACTAAAGATGG + Intergenic
1056039459 9:82647339-82647361 ATATAGCTATTTTAAGAAGAGGG - Intergenic
1056508223 9:87277711-87277733 CTCTCTCTCTTTGCAGAAGAAGG + Intergenic
1057116037 9:92523292-92523314 ATCTGGCCCTTTATAGAAAAAGG - Intronic
1058548215 9:106084122-106084144 ATCTGGCCCTTTACAGAAAAAGG + Intergenic
1060047097 9:120349685-120349707 CTCAAGCTCTTTACAGTAGCAGG + Intergenic
1186281737 X:8000397-8000419 ATTTAGATCTTTATTGAAGAGGG - Intergenic
1189660658 X:43294488-43294510 TTCTAGGTCTTTTCAGTAGATGG - Intergenic
1190008912 X:46766185-46766207 AACTAACACTTTACAAAAGACGG + Intergenic
1190291255 X:48993924-48993946 ATCCAGCCCTCCACAGAAGAGGG - Intronic
1190314968 X:49144827-49144849 ATCTAGCTCTTTGGAGAGGTAGG + Intergenic
1194656015 X:96574521-96574543 ATCCAGCTCTTTAATGAAAATGG + Intergenic
1196421245 X:115524139-115524161 ATTTAGTTTGTTACAGAAGAAGG - Intergenic
1197610356 X:128631446-128631468 ATCTGGCCCTTTACAGAAAAAGG - Intergenic
1197657307 X:129131009-129131031 ATCTAACCCTTTAGAGAAAAAGG + Intergenic
1198817247 X:140604905-140604927 ATCTGGCCCTTTACAGAAGAAGG - Intergenic
1199803981 X:151279631-151279653 TCCTAGCTCCTTAAAGAAGAGGG - Intergenic
1200699166 Y:6387397-6387419 ATCTAGCTGTTTGGAGAAGTAGG - Intergenic
1201034945 Y:9777301-9777323 ATCTAGCTGTTTGGAGAAGTAGG + Intergenic
1201279876 Y:12332455-12332477 ATGTAGCTCTTTCCTGGAGAAGG + Intergenic