ID: 959898049

View in Genome Browser
Species Human (GRCh38)
Location 3:111627472-111627494
Sequence TGTTGGCCATAGAACATGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 2, 2: 3, 3: 19, 4: 122}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959898049_959898054 -2 Left 959898049 3:111627472-111627494 CCACCCATGTTCTATGGCCAACA 0: 1
1: 2
2: 3
3: 19
4: 122
Right 959898054 3:111627493-111627515 CAGAGTTCTAATTTCTTCCTGGG 0: 2
1: 10
2: 33
3: 64
4: 395
959898049_959898058 20 Left 959898049 3:111627472-111627494 CCACCCATGTTCTATGGCCAACA 0: 1
1: 2
2: 3
3: 19
4: 122
Right 959898058 3:111627515-111627537 GACAGAGTGCCCAGTGGGTGAGG 0: 1
1: 2
2: 10
3: 43
4: 390
959898049_959898055 14 Left 959898049 3:111627472-111627494 CCACCCATGTTCTATGGCCAACA 0: 1
1: 2
2: 3
3: 19
4: 122
Right 959898055 3:111627509-111627531 TCCTGGGACAGAGTGCCCAGTGG 0: 1
1: 5
2: 30
3: 137
4: 692
959898049_959898053 -3 Left 959898049 3:111627472-111627494 CCACCCATGTTCTATGGCCAACA 0: 1
1: 2
2: 3
3: 19
4: 122
Right 959898053 3:111627492-111627514 ACAGAGTTCTAATTTCTTCCTGG 0: 2
1: 15
2: 35
3: 92
4: 888
959898049_959898057 15 Left 959898049 3:111627472-111627494 CCACCCATGTTCTATGGCCAACA 0: 1
1: 2
2: 3
3: 19
4: 122
Right 959898057 3:111627510-111627532 CCTGGGACAGAGTGCCCAGTGGG 0: 1
1: 4
2: 21
3: 112
4: 484

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959898049 Original CRISPR TGTTGGCCATAGAACATGGG TGG (reversed) Intronic
903008327 1:20312959-20312981 TGTTGGGGATCGAACATGGGAGG - Exonic
904454663 1:30640206-30640228 CGTGGGCCATGGGACATGGGGGG + Intergenic
906692175 1:47799746-47799768 AGTTGGCCATAGACAAGGGGAGG - Intronic
906913070 1:49977289-49977311 TGAAGCCCATAGAAGATGGGAGG - Intronic
908230887 1:62103884-62103906 TGTTGGCCGTGGGACTTGGGGGG - Intronic
909679633 1:78277503-78277525 TGGTGGCCAGAGAACATGGAGGG - Intergenic
910218724 1:84867603-84867625 TTTTGGCCATAGCAAATGGGAGG + Intronic
912489909 1:110056905-110056927 TGCTGGCTATAAAACAAGGGAGG + Intronic
915053136 1:153097846-153097868 TTTTGGCCAGAGACCAAGGGTGG + Intronic
916018261 1:160769877-160769899 TCTTGGCCATAGCACATAGTTGG - Intergenic
917289842 1:173460917-173460939 TGTTGGCCACAGAACATGGGCGG - Intergenic
917834946 1:178934013-178934035 TGTGGGCAATTGAACATGGAGGG - Intergenic
1074270063 10:111944945-111944967 TGTCTGCCAGAGAATATGGGTGG - Intergenic
1074457182 10:113605147-113605169 TTTTGGCCATAGGACATGTAAGG - Intronic
1076263807 10:129093390-129093412 AGCTGACCATAGAACATGGAAGG - Intergenic
1076460198 10:130638041-130638063 TGTTGGGCAGAGATCATGGAAGG + Intergenic
1078033628 11:7780315-7780337 TGTTAGCCAGAGAATATGGGTGG - Intergenic
1078430370 11:11283513-11283535 TGTTGGGCACAGAGCATTGGAGG + Intronic
1085077060 11:73600526-73600548 TGTTGGCCAGAGATCACGGTGGG + Intergenic
1085123361 11:73981577-73981599 GGTTTTCCATAGAAAATGGGTGG + Exonic
1086921930 11:92597248-92597270 TGTTGGCCAAAAAACAAGGTAGG - Intronic
1095835804 12:46637752-46637774 TGTTAGCCAGAGAACACTGGTGG - Intergenic
1096184741 12:49571306-49571328 TTTTGGCCTAAGAACCTGGGTGG + Intronic
1097582977 12:61481158-61481180 TGTTGGCTAGAGAACACTGGTGG - Intergenic
1101022491 12:100567378-100567400 TTTTGGCAATAGCACGTGGGTGG + Intergenic
1101920107 12:108925470-108925492 TGTTGGAAATAGACCATGGCTGG - Intronic
1103014979 12:117487310-117487332 TGTTAGTCAAAGATCATGGGTGG - Intronic
1107119256 13:36779143-36779165 TGTCGGCCGTAGAACATGGGAGG - Intergenic
1108733628 13:53259941-53259963 AGTAGTCCATAGAAGATGGGAGG + Intergenic
1109885451 13:68536577-68536599 TGTTAGTCATAGTACAGGGGAGG + Intergenic
1111235230 13:85400581-85400603 TGTTGGTCATAGAACACAGGAGG + Intergenic
1111878037 13:93920906-93920928 AGTTGGCTATAGAACATGGAGGG - Intronic
1113205501 13:107911424-107911446 TGTTGGCCTTAGGAGATGGATGG + Intergenic
1115967788 14:38911788-38911810 TGTAGGCCAGAGAACACTGGTGG - Intergenic
1118913880 14:70084850-70084872 TGTTTGACATTGGACATGGGAGG + Intronic
1120484617 14:85096890-85096912 TATTTGCCATAGAAAATGAGGGG - Intergenic
1120821613 14:88916484-88916506 TGTTGACCATGAAACATTGGTGG - Intergenic
1121583212 14:95045992-95046014 TGCTGGCCACAGCACAGGGGTGG - Intergenic
1122109233 14:99484361-99484383 TGATGTGCATAGCACATGGGAGG - Intronic
1125494835 15:40182725-40182747 TGAAGGCCAAAGAATATGGGAGG - Intronic
1129971416 15:79780832-79780854 TGTTGACTGTAGAACATGGCTGG - Intergenic
1131866540 15:96717354-96717376 TGTTGGCCAGAGGAGCTGGGAGG - Intergenic
1134430609 16:14201313-14201335 TGTGATCCATAGAACATAGGAGG + Intronic
1137540259 16:49356959-49356981 AGTTGGCCATAGGTCCTGGGTGG - Intergenic
1139180952 16:64747872-64747894 TGTTGGACATTAAACATGAGAGG - Intergenic
1140247241 16:73262630-73262652 ATTTGGCCCTAGAACATAGGAGG + Intergenic
1144833232 17:18143377-18143399 GGTTGGCCAGAGAAAAGGGGAGG - Intronic
1153374883 18:4364520-4364542 TAATGGCAATAAAACATGGGAGG + Intronic
1153711787 18:7807495-7807517 TGTGGGACACACAACATGGGCGG - Intronic
1155854294 18:30813384-30813406 TGTTGAACATAGAATATGGAGGG - Intergenic
1158249289 18:55468888-55468910 GGGTGGCAATAGAACAAGGGGGG - Intronic
1158424990 18:57330884-57330906 AGTTAGCCATAGAGGATGGGAGG + Intergenic
1164232429 19:23302189-23302211 TGTTGCCCAGAGAACATCAGTGG + Intergenic
1164232468 19:23302458-23302480 TGTCTGCCAGAGAATATGGGAGG + Intergenic
1164391093 19:27822086-27822108 TGTTGGCCAGAGAACATCAGTGG + Intergenic
1168592354 19:57647824-57647846 TGTTGGCCATGGTAGAGGGGTGG - Intergenic
1168599854 19:57708879-57708901 TGATGGCTTTAGAACGTGGGTGG + Intronic
926218653 2:10920920-10920942 AGATGGGCATAGAACATGTGGGG + Intergenic
931665678 2:64608423-64608445 TGCTGGGGATAGAACACGGGTGG + Intergenic
931944406 2:67288888-67288910 CGTTGGACATAAAACAGGGGAGG + Intergenic
932400329 2:71476088-71476110 TGTTGTACATGGAACTTGGGGGG + Intronic
937836285 2:126473187-126473209 TGTTGGCCACAGAAGATGCCTGG - Intergenic
939976178 2:148719910-148719932 TTCGGCCCATAGAACATGGGTGG + Intronic
942945369 2:181666460-181666482 TTTTGTCCATAAAACATTGGAGG + Intronic
943071939 2:183151764-183151786 TGTTAACCATAGAACCTAGGTGG - Intronic
1168980042 20:1996326-1996348 TGGTGGCCAGAGGACATGAGTGG + Intergenic
1174088165 20:48025142-48025164 TGCTGGCCACAGAACATAGGCGG + Intergenic
1174127839 20:48320248-48320270 TGCTGGCCACAGAACATGGGAGG - Intergenic
1174547871 20:51339610-51339632 CGTAGGCTATAGAACTTGGGTGG - Intergenic
1177445506 21:21190390-21190412 AGTTGGGCATTGAAGATGGGTGG - Intronic
1181421294 22:22800845-22800867 TGATGGCCAGAGAGCATGGGTGG - Intronic
1181429255 22:22867990-22868012 TGATGGTCAGAGAGCATGGGTGG - Intronic
950748371 3:15108608-15108630 TCTTGGCCAGAGCACATGGATGG - Intergenic
951075195 3:18382782-18382804 TGTTTGTCATAGAGGATGGGAGG - Intronic
952938166 3:38417545-38417567 TGTTGCCCATAGAAAGTTGGGGG - Intronic
953795463 3:45982399-45982421 ACTTGGCCAAAGATCATGGGTGG + Intronic
955619806 3:60850664-60850686 GGTTGGCCATAGGACATGGCAGG - Intronic
958590648 3:96154529-96154551 TGTCAGCCAAAGAACATTGGTGG - Intergenic
959898049 3:111627472-111627494 TGTTGGCCATAGAACATGGGTGG - Intronic
962407299 3:135111077-135111099 TGGTGGCCATAGAGCATTGTGGG + Intronic
963056965 3:141193835-141193857 TGTTGGCCAGAGAACACTGGTGG - Intergenic
966455190 3:180107038-180107060 TACTGGCCAGAGAACATGGATGG + Intergenic
968381675 4:101751-101773 TTCTGTCCATAGAATATGGGTGG + Intergenic
971148664 4:24007652-24007674 TGGAGCCCAAAGAACATGGGAGG + Intergenic
972990159 4:44814570-44814592 TGTTGGCTATAAAACACAGGTGG + Intergenic
972990206 4:44814834-44814856 TTCTGTCCATAGAATATGGGTGG + Intergenic
978025395 4:103867417-103867439 TGTAGGCCAGAGAACAGTGGTGG + Intergenic
979161799 4:117470883-117470905 TGCTGTCCATAGAAAATGGAAGG + Intergenic
981909040 4:149956495-149956517 TCTTGGAAATAGAACAGGGGAGG + Intergenic
982880828 4:160712614-160712636 TGTTTGCCATAGAATGTGGGAGG + Intergenic
984282576 4:177689713-177689735 TGTTTGCCATGAAAAATGGGAGG - Intergenic
992324819 5:75650376-75650398 TGTGAGCCAAAGAACATAGGAGG + Intronic
993792322 5:92223128-92223150 AGTTGGCCACAGAACACTGGTGG + Intergenic
993793583 5:92237506-92237528 TGCTGGCCATAGCACGTGGATGG + Intergenic
995329680 5:110933368-110933390 TGTCAGCCATAGAACACAGGTGG + Intergenic
995333043 5:110966874-110966896 TGTTGGGCAGAGAGCATGGATGG - Intergenic
996795197 5:127338401-127338423 TATGGGCCTAAGAACATGGGTGG - Intronic
997205041 5:132043279-132043301 TGTTAGCCAGAGAACACTGGTGG + Intergenic
997205150 5:132043821-132043843 TGTTGGCCAGAGAACACCAGTGG + Intergenic
999054621 5:148560957-148560979 TGCTGGCTATAGAAAATGGTAGG + Intronic
999074326 5:148780419-148780441 TGTCAGCCAGAGAACATGGCAGG - Intergenic
1001118598 5:168960044-168960066 TTTTAGCCATATAACATGGCTGG + Intronic
1002092132 5:176811807-176811829 TGCTGCCCCTAGAACCTGGGCGG + Intronic
1006086398 6:31598756-31598778 TGGTGGTCAGAGAGCATGGGAGG + Intergenic
1007394104 6:41567544-41567566 AGCTGGCCATATAAAATGGGTGG - Intronic
1007573153 6:42907692-42907714 TGTTGGCCTGAGCACCTGGGAGG + Intergenic
1011137769 6:84118159-84118181 TGCAGGCTGTAGAACATGGGTGG + Intergenic
1012869434 6:104656520-104656542 TGGTGGCCATAGAACATGGGTGG - Intergenic
1013451808 6:110288961-110288983 TGCTGGCCTAAGAAGATGGGAGG + Intronic
1015466435 6:133553386-133553408 TATTGACCATAGTCCATGGGAGG - Intergenic
1015805670 6:137105990-137106012 TTTTGACAATAGAACAAGGGTGG + Intergenic
1018335734 6:162786434-162786456 TGTAGCCAATAGAACATGTGTGG + Intronic
1018478996 6:164171319-164171341 TGTTGACCATAAAGCAGGGGTGG + Intergenic
1019787804 7:2989613-2989635 TATTGGCCACATAAAATGGGTGG - Intronic
1021521003 7:21538806-21538828 TGTCGGCTATAGAACATGGGTGG + Intergenic
1022421604 7:30228616-30228638 TGGTGGCCACAGGACATGTGTGG + Intergenic
1024104887 7:46073078-46073100 TGTTGACCTTATAAGATGGGTGG - Intergenic
1024502388 7:50124524-50124546 TGTTGGCTAGAGAACATATGTGG - Intronic
1025709784 7:63898699-63898721 TGTTGGGTATAAAACTTGGGCGG - Intergenic
1025870035 7:65422770-65422792 TGTTGGCCAGAGAACATCAGTGG - Intergenic
1032158360 7:129489586-129489608 AGTTGGCAATAGCTCATGGGTGG + Intergenic
1033051197 7:138005959-138005981 TGTTGGCCAAAGAATGTGTGTGG + Intronic
1040087702 8:43363724-43363746 TGTTGGCCAGGGAACACTGGTGG - Intergenic
1041623455 8:59999534-59999556 TGTCAGCCAAAGAACATGAGTGG - Intergenic
1044125796 8:88457049-88457071 TGTTGGCTAGAGAGCTTGGGTGG - Intergenic
1051071262 9:13170705-13170727 TGTTGGCCATAGCTCATGATAGG - Intronic
1051527119 9:18057681-18057703 TGGAGCCCAGAGAACATGGGTGG - Intergenic
1052702866 9:31959636-31959658 TGTTGGCTGGAGAACATGAGAGG - Intergenic
1053582211 9:39417204-39417226 TTTTGGCCATAGGACCTGGCTGG - Intergenic
1054103789 9:60975943-60975965 TTTTGGCCATAGGACCTGGCTGG - Intergenic
1054582563 9:66930903-66930925 TTTTGGCCATAGGACCTGGCTGG + Intronic
1055224886 9:73984197-73984219 TGTTGGCCAGAGAACACTGGTGG - Intergenic
1056203858 9:84301554-84301576 TGAGGATCATAGAACATGGGAGG - Intronic
1056907563 9:90666506-90666528 TGTTGGCCAGAGAACACTGGTGG + Intergenic
1058200037 9:102027921-102027943 TGTCAGCTATAGAACATGGATGG + Intergenic
1059023284 9:110598882-110598904 TGTTAGCCTTAGAACATGAGCGG + Intergenic
1188723523 X:33551862-33551884 TGTGGGCCAGAGAACACTGGTGG + Intergenic
1191876950 X:65807084-65807106 TGTCTGCCAGAGAATATGGGTGG - Intergenic
1193274490 X:79570168-79570190 TGTTGGCCAGAGAACATCAGTGG + Intergenic
1193712332 X:84894580-84894602 TGTTGGCCAGAAAACATTGGTGG + Intergenic
1193964551 X:87969197-87969219 TCTTGGGCATTGAACATGGAGGG - Intergenic
1194854776 X:98915415-98915437 TGTTGGCTGGAGAACATGGGTGG + Intergenic
1195822865 X:108965994-108966016 TGTTGTCTGTAGAACATGGTGGG - Intergenic
1197122152 X:122905918-122905940 TGTTTGCCAGAGAACACTGGTGG - Intergenic
1198961037 X:142183525-142183547 TGTTGACCATCCAACAAGGGTGG + Intergenic
1201327986 Y:12786308-12786330 TGTTAGGTATAGAACTTGGGAGG - Exonic
1201967564 Y:19754757-19754779 TCTTGGCCAGAGAACATCAGTGG + Intergenic