ID: 959900453

View in Genome Browser
Species Human (GRCh38)
Location 3:111655015-111655037
Sequence GGCTGAATGGGAAGATGATC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 188}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959900449_959900453 24 Left 959900449 3:111654968-111654990 CCTCTCTATTCTGCATTTTCTCT 0: 1
1: 0
2: 4
3: 89
4: 719
Right 959900453 3:111655015-111655037 GGCTGAATGGGAAGATGATCAGG 0: 1
1: 0
2: 2
3: 13
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959900453 Original CRISPR GGCTGAATGGGAAGATGATC AGG Intronic
900702896 1:4058988-4059010 GGCTGGATGGGAAGAAGGGCTGG + Intergenic
901772735 1:11538900-11538922 TGTTGGATGGGAAGATGCTCAGG - Intergenic
902715575 1:18270361-18270383 GGGTGAATGGGCAGAGGATGGGG + Intronic
903005892 1:20298516-20298538 GGCTGACTGTGAAGGTGAGCTGG - Intronic
904824016 1:33263005-33263027 GGGAGAATGTGCAGATGATCAGG - Intronic
906946365 1:50297826-50297848 GGATGTTTGGGAAGATGTTCTGG - Intergenic
907638018 1:56156441-56156463 GGATGATTGGGAAGATGATCTGG + Intergenic
907664905 1:56426185-56426207 GGCTGAGTGGGTAGGTGAACTGG - Intergenic
907844359 1:58190369-58190391 GCCTGGATGGGAAGGTGAGCTGG - Intronic
910456712 1:87405527-87405549 GACTCAATGTGAAGATGATGAGG + Intergenic
911049637 1:93659777-93659799 GGATGAATGAGAAGAGGATGGGG - Intronic
913426997 1:118743697-118743719 GGCTGAATGGGAAGGGAATGGGG + Intergenic
914225851 1:145719014-145719036 GGCTGAAAGGGAAGAAGGTCAGG - Intergenic
917782901 1:178418399-178418421 GGCTCAATGTGAAGATGATGAGG - Intronic
918588984 1:186220129-186220151 GGCTGAGTGGGACAATGTTCAGG + Intergenic
919979488 1:202633487-202633509 GGCTGAGTGGGATGAAGATGGGG - Intronic
920538544 1:206759117-206759139 GTTTGAAGGGGAAGGTGATCTGG - Intergenic
921213137 1:212916657-212916679 GCCTGACTGGAAAGATGACCCGG + Intergenic
922557230 1:226541773-226541795 GGCGGAATGGACAGATGGTCTGG - Intergenic
924110048 1:240690150-240690172 AACTGATTGGGAAGATGAACAGG - Intergenic
924400621 1:243676658-243676680 GGGTGATTAGGAAGATGATATGG - Intronic
1063879184 10:10513297-10513319 GACTAGATGGGAAGATGATGTGG - Intergenic
1064695853 10:17964539-17964561 GTCTGAATGGGAATATGAATGGG + Intronic
1064978383 10:21142388-21142410 GACTGAGTGGTAAGGTGATCTGG - Intronic
1067317455 10:45181441-45181463 GGCTGCATGGGAGGTTGGTCTGG + Intergenic
1067386100 10:45818806-45818828 GGCTGTAGGGGAGGATCATCAGG + Intergenic
1067990701 10:51208678-51208700 GGATGAAAGGGAAGAAAATCAGG + Intronic
1068365582 10:56045140-56045162 GACTCAATGTGAAGATGATGAGG + Intergenic
1068742381 10:60488313-60488335 GGAAGAATGGGAAGGTGAACAGG + Intronic
1069835650 10:71306419-71306441 GGCTGAATGGGTTGTTGAACTGG - Intergenic
1070712133 10:78690461-78690483 TGCTGAATAGGAAGAAGAGCTGG + Intergenic
1088137062 11:106568486-106568508 GTCTGAATGGGAAGCTGAAGGGG - Intergenic
1088548455 11:110985823-110985845 GGCTGAATGGTGAGATGAAATGG + Intergenic
1090436235 11:126688891-126688913 AGAGGAATGGGAAGATGATGAGG + Intronic
1091674667 12:2480305-2480327 GGCTGAATGGGGAGAGGACCTGG - Intronic
1092111603 12:5968438-5968460 GGATGAATGGGAGGATGTTTGGG + Intronic
1094005229 12:25742048-25742070 GGCTGAATTGCAAGATAAGCTGG - Intergenic
1095384493 12:41634587-41634609 TGTTGAATGGGAAGATGCTATGG - Intergenic
1096622458 12:52873096-52873118 GGCTGAGTGGGAACCTGAGCAGG + Intergenic
1100385898 12:94104441-94104463 GGCAGAATAGGAAGATGGTCAGG + Intergenic
1101149834 12:101874408-101874430 AGCAGAAGGGTAAGATGATCAGG + Intergenic
1101179591 12:102200550-102200572 GACTGAAGGAGAAAATGATCTGG - Intergenic
1101311086 12:103579995-103580017 TGCTGAAAGGGAAGTTGAGCGGG + Intergenic
1101721053 12:107351057-107351079 GGCTGAAAGGGAGGATGAAAGGG + Intronic
1103908547 12:124339686-124339708 GGTTGGATGGGTGGATGATCAGG - Intronic
1103996473 12:124833620-124833642 GGCTGTGTGGGAGGATGCTCTGG - Intronic
1105392195 13:19990829-19990851 GGATGAATGGGAAGTTGAAGTGG - Intronic
1109155945 13:58909550-58909572 GGCTGAATTGGATTATAATCAGG + Intergenic
1112396240 13:99034938-99034960 GGGGTAATGGGAAGATAATCCGG - Intronic
1118858548 14:69643544-69643566 GGTTTAATGGGACCATGATCAGG - Intronic
1123176057 14:106420331-106420353 GGCTGAAGGGGTGGATGATAGGG - Intergenic
1124495095 15:30181459-30181481 GGCTGAGTGGGATGAAGATGGGG - Intergenic
1124748474 15:32357186-32357208 GGCTGAGTGGGATGAAGATGGGG + Intergenic
1128364737 15:66990652-66990674 GGCTGAATGGAAACAAGAACAGG + Intergenic
1131272835 15:90957300-90957322 GGCCGAAGGGGAAGACGATCCGG + Exonic
1132413559 15:101604261-101604283 GGATGGGTGGGAAGATGAGCCGG - Intergenic
1134630718 16:15753879-15753901 GGATGATTGGGAAGATGATGAGG - Intronic
1134886004 16:17792099-17792121 GGCTGAATGTTAGGATCATCTGG - Intergenic
1135875151 16:26191929-26191951 GGCTGAGTGGGAGGATCACCTGG + Intergenic
1139944725 16:70632492-70632514 GAATGAATGGGAAGAGGAGCTGG + Intronic
1140213276 16:72987485-72987507 AGCTGAATGGGAAGAAAATAGGG - Intronic
1142104175 16:88293240-88293262 GGATGAATGGGTAGATGGACAGG + Intergenic
1145240166 17:21236340-21236362 GGGTGAGTGGGTAGATGATTGGG - Intergenic
1145271555 17:21407514-21407536 GGATGGATGGGCAGATGATTGGG - Intronic
1145309769 17:21694962-21694984 GGATGGATGGGCAGATGATTGGG - Intronic
1146322484 17:31858025-31858047 GGCTGGATGGGAAGGTGGTTAGG - Intronic
1148905449 17:50909178-50909200 GGCTGGCTGGGAAGCTGGTCAGG + Intergenic
1150699336 17:67433963-67433985 GGCTGGATGGGAGGGTGGTCAGG + Intronic
1152301705 17:79498722-79498744 GGCTGAATGGGTAGATGGGGTGG - Intronic
1153741793 18:8137665-8137687 GGGTGATTGGGAAGAGGATTTGG - Intronic
1155345395 18:24852525-24852547 GGCTGAGTGGGCAGATCATGAGG + Intergenic
1156239332 18:35237639-35237661 TGCTGAATGAGAAAATGATTTGG + Intergenic
1157303941 18:46502834-46502856 GGCTGACTGGGAAGAGGTTAGGG + Intronic
1157794419 18:50560664-50560686 GGCTGGAGGGGAGGATAATCGGG - Intronic
1159128780 18:64256290-64256312 GACTGAATGGTCAGATGGTCAGG + Intergenic
1160488223 18:79312633-79312655 GGCTGTGTGGGAAGATGGTGCGG + Intronic
1161641146 19:5424028-5424050 GGCTGAGTGGGAAGATGGATGGG - Intergenic
1163171628 19:15535497-15535519 GGCTGAATGGGCAGAGGCCCAGG - Intronic
1163286615 19:16352367-16352389 TACTCAATGGGAAGATGATGAGG + Intergenic
1164230403 19:23282406-23282428 GGCTGAATGGAAAGACCACCAGG + Intergenic
1164922407 19:32098548-32098570 TACTCAATGGGAAGATGATGAGG + Intergenic
1165160269 19:33811903-33811925 GGCTGAGTGGAAAGGTGGTCTGG + Intronic
1165281643 19:34803133-34803155 GGCTTACTGGGAAGGGGATCAGG - Intergenic
1166991605 19:46696168-46696190 AGCAAAATGGGAAGATGATAAGG + Intronic
1167053473 19:47094565-47094587 AGGTGAATTGGAAGATGATGGGG - Exonic
926089649 2:10042050-10042072 TGCTGAGTGGGAAGAGGCTCTGG + Intergenic
929417829 2:41761602-41761624 GGCAGAAGGGGAAGAGGAGCTGG - Intergenic
930102976 2:47617483-47617505 GGCTGAGTGGGAAGCTGTGCAGG - Intergenic
932812471 2:74835879-74835901 GCCAGAATGGGAATATGAGCAGG - Intronic
934300009 2:91771447-91771469 GGGTGACTGGGAAGATGACAGGG - Intergenic
936373152 2:111919663-111919685 GGCTGAAAGGGATGATGAGAGGG + Intronic
936446904 2:112603293-112603315 TGTGGAATGGCAAGATGATCAGG - Intergenic
938225404 2:129611586-129611608 GGCTGAATGGAATCATGACCAGG - Intergenic
938730209 2:134141518-134141540 GGCTGGATGGGTAGATGAATGGG + Intronic
939858190 2:147386268-147386290 TGCTGAATGGGAAGAAGACAAGG + Intergenic
940558688 2:155265843-155265865 GACTGAATGGGTAGATGACAAGG - Intergenic
940735445 2:157446203-157446225 GGCTGAAGGGGAAGAGAGTCTGG - Intronic
941539610 2:166766247-166766269 GGCAGAATGGGAAGTTTAACTGG - Intergenic
942803253 2:179900140-179900162 TGCAGAATTGGAAGTTGATCTGG + Intergenic
944066880 2:195628648-195628670 GGGTGAATGGGAAGGTGCTCAGG + Intronic
944366849 2:198930900-198930922 GTGTGGATGGGAAGATCATCAGG - Intergenic
948818772 2:240527743-240527765 GGCTGGATGGGTAGATGAATAGG + Intronic
1168782237 20:502925-502947 GGCTGAATGGGAGGAGGATTTGG - Intronic
1169193846 20:3673189-3673211 GGCTTAAAGGGAAGAAGCTCAGG - Intronic
1170349908 20:15427571-15427593 GGCTGAAGGAGAAGGTGAGCTGG + Intronic
1171055541 20:21903135-21903157 GGCTCAATGGGAAGAAGCCCAGG - Intergenic
1172235485 20:33370116-33370138 GGATGGCTGGGAAGATGACCAGG + Intronic
1174098712 20:48110062-48110084 GGATGAATGGGCAGATGGACGGG - Intergenic
1175731266 20:61355400-61355422 GACTGAAGGGGAAGGTGATTGGG + Intronic
1177501338 21:21960055-21960077 GGTTGAAGGGGAAGAGGATAGGG - Intergenic
1179033317 21:37738919-37738941 GGCTGAAGGGTAAGGTTATCTGG + Intronic
1181556020 22:23672076-23672098 GGGTGACTGGGAAGATGACAGGG + Intergenic
1181588630 22:23868745-23868767 GGCTGGATGAGGAGCTGATCTGG - Intronic
1181698358 22:24606577-24606599 GGGTGACTGGGAAGATGACAGGG - Intronic
1182396096 22:30036928-30036950 GCCTGTTAGGGAAGATGATCAGG + Intergenic
1183581008 22:38726770-38726792 GGCTGAATGGGAAGAGGATGTGG - Intronic
1184744030 22:46445855-46445877 GGCTGGGTGGGAGGATGAGCTGG - Intronic
1185215823 22:49599484-49599506 AGATGAATGGGCAGATGAACAGG - Intronic
950108395 3:10403041-10403063 GGCAGGTTGGGAAGATGAGCTGG + Intronic
950504456 3:13385788-13385810 GGATGAATGGGTAGATGAATGGG + Intronic
952885658 3:38009770-38009792 TGCTGAAGGGGAAGAAGCTCGGG - Exonic
955681581 3:61506890-61506912 TGCTCAATGTGAAGATGATAAGG + Intergenic
959900453 3:111655015-111655037 GGCTGAATGGGAAGATGATCAGG + Intronic
960708161 3:120501450-120501472 TGGTGAATGGGAAGATCATAAGG - Intergenic
962925468 3:139989193-139989215 GGCTAAATGGGAAGATAAGGAGG - Intronic
963464913 3:145667219-145667241 TGCTCAATGTGAAGATGATAAGG - Intergenic
964404999 3:156339713-156339735 GGCTGAATGGGTACATCCTCTGG + Intronic
964416956 3:156457760-156457782 GGCTGAAGGGGTATATGACCAGG + Intronic
964544161 3:157815121-157815143 AGCTGCATGGGATGATCATCTGG + Intergenic
964755353 3:160086905-160086927 GGCTGATTGTGAAGGTGAACTGG - Intergenic
967192655 3:186998484-186998506 TGCTCAATGTGAAGATGATGAGG - Intronic
972928259 4:44039374-44039396 GGCAGAAGGGGAAGATGAAGGGG - Intergenic
979567924 4:122177615-122177637 GGGTGGAAGGTAAGATGATCAGG - Intronic
983459662 4:168012482-168012504 AGTAGAATGTGAAGATGATCTGG + Intergenic
985529665 5:426557-426579 GGATGAATGGGAAGATGGATGGG + Intronic
986333209 5:6733269-6733291 GGCTGCAGGGGAGGATGGTCAGG + Intronic
987161824 5:15152709-15152731 GGTTGAATTGGAAGAAGGTCAGG - Intergenic
988538370 5:32088288-32088310 GCCTGGGTGGGAAGATGAGCAGG - Exonic
990331907 5:54735979-54736001 GGCTGAATGGGGATGTGCTCAGG + Intergenic
992324963 5:75651502-75651524 GGCCGAGTAGGAAGATGATGAGG + Intronic
993448398 5:88043153-88043175 GGCTCAATACGAAGATGAACAGG - Intergenic
997844278 5:137272268-137272290 GGGGGAATAGGAAGAAGATCTGG + Intronic
998623892 5:143823948-143823970 GGATGAGTGGGAAGAAGGTCAGG + Intergenic
999879303 5:155843620-155843642 GGCAGAATGAGAAGATCATATGG - Intergenic
1001481057 5:172089468-172089490 GGCTGAATGGGTAGATGAGTGGG + Intronic
1003075978 6:2984034-2984056 GGATGAATGAGAAGACGAACTGG + Intergenic
1004009957 6:11675059-11675081 GGCAGAATGGGTAGATGGACAGG - Intergenic
1006287137 6:33105211-33105233 GGCTTAGTGGGTAGATGAGCGGG + Intergenic
1006896794 6:37476362-37476384 GGCAGGATGGGGAGATGCTCTGG - Intronic
1008408081 6:51141440-51141462 GGAAGAATGGGCAGATGGTCAGG + Intergenic
1008463200 6:51800044-51800066 GGCTGATGGGGGAGCTGATCTGG + Intronic
1011590019 6:88963181-88963203 GGATGAATGGGAACATGAACGGG - Intronic
1013253352 6:108357793-108357815 GGATTAGTGGGAAGATGATATGG + Intronic
1013285386 6:108677072-108677094 GGCTGAATTGGTAGAGGATTTGG - Intronic
1013309312 6:108879012-108879034 GGGTGAATGGGTAGATGGACAGG - Intronic
1015603783 6:134935816-134935838 GGCTGTATGGGAGAATGTTCTGG - Intronic
1019931744 7:4228091-4228113 GCCTCAATGGGAAGCTGAACTGG + Intronic
1020135089 7:5582996-5583018 GGCTGAGTGGGCAGATCATGAGG + Intergenic
1021931664 7:25586954-25586976 GGAGGAGAGGGAAGATGATCAGG - Intergenic
1024194632 7:47047101-47047123 GGCTGAGTGGGAACATGGGCAGG + Intergenic
1024364393 7:48504504-48504526 GGGTGACTGGGAAGATGATGGGG + Intronic
1026873446 7:73866923-73866945 GGATGAATGGGTAGATGAATGGG - Intergenic
1026873531 7:73867295-73867317 GGATGAATGGGTAGATGAATGGG - Intergenic
1027122440 7:75531566-75531588 TGCTCAGTGGGAAGGTGATCTGG - Intergenic
1027147007 7:75702660-75702682 GGCTGAAGGGGAAGGGGACCTGG + Intronic
1027542974 7:79491758-79491780 GGCTGAGGGGGAAGAGGATGAGG + Intergenic
1028475482 7:91248955-91248977 GGCAGGAGGGGAAGATGCTCTGG + Intergenic
1029633993 7:101771691-101771713 GGCTGAGTGGGCAGATCATGAGG - Intergenic
1029818544 7:103122496-103122518 GTCTGAATGGGAAGAAGGCCTGG + Intronic
1030879666 7:114861717-114861739 CCCTGAAGGTGAAGATGATCTGG + Intergenic
1031989074 7:128184388-128184410 GGAGGAATGGGCAGATGACCAGG + Intergenic
1033599059 7:142876150-142876172 GGCTGAAAGGGAAGGTGGGCTGG + Intronic
1034469642 7:151248417-151248439 GGCTGAATGGAGGGCTGATCGGG - Intronic
1035713990 8:1739832-1739854 GGCGGAATGGGAAGCGGAGCAGG - Intergenic
1036476317 8:9096532-9096554 GGCTCACTGTGAGGATGATCAGG + Intronic
1040805999 8:51396813-51396835 GGCTGATTGGAAAGAATATCTGG - Intronic
1044784461 8:95779874-95779896 GGTTGAAGGGGAAGGTGCTCAGG + Intergenic
1045516400 8:102864032-102864054 GGCTGGGTGGGAAGAGGATTCGG + Exonic
1047074155 8:121380919-121380941 GCCTGTCTGGGAAGATGAACTGG - Intergenic
1048789644 8:138088117-138088139 TGCTGAATTGGAAGTTGGTCTGG + Intergenic
1049582362 8:143418432-143418454 GGGTGAGTGGGAAGATGAGTGGG - Intergenic
1050579689 9:7039793-7039815 GGCTGAAAAGGAAGAGGATGAGG + Intronic
1051137275 9:13936452-13936474 GGGTGTATGGGAAGCTGATGAGG - Intergenic
1053046397 9:34922855-34922877 GGCTGAGTGGTATGATGATATGG - Intergenic
1056075642 9:83036085-83036107 GGCTAAATCAGAAGATAATCAGG + Intronic
1056286561 9:85093162-85093184 GACTGAATGGCAACATGAACAGG + Intergenic
1057206920 9:93179032-93179054 GGCTTAAAGGGCAGATGATGGGG - Intergenic
1057437885 9:95058891-95058913 GGCTGAAGGGTGAGATGAACTGG + Intronic
1057969651 9:99542216-99542238 GGATGAATGGGAAGGTGAACTGG + Intergenic
1061244941 9:129396743-129396765 GGATGAATGGGAGGATGGACAGG + Intergenic
1061439111 9:130587501-130587523 GGCAGAATGCTAAGATGATCAGG - Intronic
1062681516 9:137784644-137784666 GACTGAATGAGATGATGATGGGG + Intronic
1185777488 X:2816425-2816447 TACTCAATGGGAAGATGATAAGG + Intergenic
1188060191 X:25591251-25591273 GGATCAATGGCAAGATGGTCTGG + Intergenic
1188245410 X:27831299-27831321 GGCTGGGTGGGAGGGTGATCGGG + Intergenic
1188317459 X:28692004-28692026 GGCTGAAGGTGAAGAAGAGCTGG + Intronic
1189192944 X:39126632-39126654 TGCTCAATGTGAAGATGATGAGG + Intergenic
1189708861 X:43788118-43788140 GGCTGAAGGTGAAGAGGAGCTGG + Intronic
1190225495 X:48541441-48541463 GGGTGAGTGGGAAGATGCTGGGG + Exonic
1192151937 X:68718030-68718052 GGCTGAAGATGAAGATGATGAGG + Exonic
1192477941 X:71459644-71459666 GTCTGAAGGAGAAGATGATGAGG + Exonic
1197717282 X:129718709-129718731 GGCTGGCTGGGAGGTTGATCTGG + Intergenic
1198249212 X:134863361-134863383 GGCTGGATGAGAAATTGATCTGG - Intergenic
1201292499 Y:12434703-12434725 TACTCAATGGGAAGATGATAAGG - Intergenic