ID: 959902959

View in Genome Browser
Species Human (GRCh38)
Location 3:111680385-111680407
Sequence CCTCAAATCCTGTAGGAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 211}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959902959_959902966 14 Left 959902959 3:111680385-111680407 CCATTTTCCTACAGGATTTGAGG 0: 1
1: 0
2: 1
3: 20
4: 211
Right 959902966 3:111680422-111680444 GGACCAAGCTGAATCTACCAAGG 0: 1
1: 0
2: 0
3: 4
4: 84
959902959_959902964 -7 Left 959902959 3:111680385-111680407 CCATTTTCCTACAGGATTTGAGG 0: 1
1: 0
2: 1
3: 20
4: 211
Right 959902964 3:111680401-111680423 TTTGAGGTTGTGGGAAACCAAGG 0: 1
1: 0
2: 2
3: 24
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959902959 Original CRISPR CCTCAAATCCTGTAGGAAAA TGG (reversed) Intronic
901159060 1:7161233-7161255 CCTGAAAGCCCATAGGAAAAGGG - Intronic
902688120 1:18092161-18092183 ACTGAAATCCTGCAGGAAAGGGG - Intergenic
903782956 1:25834053-25834075 CCTCCTATCTTGTGGGAAAAGGG + Exonic
905064676 1:35170301-35170323 TCTCAATTCCTAAAGGAAAAGGG - Intergenic
905557512 1:38899108-38899130 CCTCAAATCCTGTTCAAACAAGG - Intronic
906318769 1:44804149-44804171 CTTCAAATCCTGAAGGAGACAGG - Exonic
906741383 1:48188834-48188856 CCACAAATCCTGTTGGGTAATGG - Intergenic
906941664 1:50261014-50261036 TCTCAACTCCTTTAGCAAAATGG - Intergenic
907214887 1:52854229-52854251 CCTCAAAATCTGTAGGAGATTGG - Intronic
907228992 1:52977497-52977519 CCTGAAATCCTTTTGGAAACTGG - Intronic
907256471 1:53182870-53182892 CCTCCACTCCTGCAGGAGAAAGG - Intergenic
912432654 1:109637385-109637407 CCTCAAATCCTTTTGGAACCAGG + Intergenic
916549985 1:165840770-165840792 CCTTAACTCCTTTAGGAAAAAGG - Intronic
916949829 1:169768265-169768287 CCTCCTTGCCTGTAGGAAAAAGG + Intronic
916949877 1:169768849-169768871 CTTCCATGCCTGTAGGAAAAAGG - Intronic
917122606 1:171657308-171657330 CCGCAAATGCAGGAGGAAAATGG - Intergenic
921289659 1:213645678-213645700 CATCAAAGCCTTTAAGAAAACGG - Intergenic
1063274655 10:4552360-4552382 CCACAAATCCTTTGGGAACAAGG + Intergenic
1063536868 10:6891949-6891971 CCGGAACTACTGTAGGAAAAAGG + Intergenic
1064643812 10:17440127-17440149 CCACAACTCCTGGAGGCAAAGGG + Intronic
1068062591 10:52087344-52087366 CCAAAAGTCCTGTAGGGAAATGG - Intronic
1068486357 10:57664045-57664067 CTTCAAATTATATAGGAAAAGGG + Intergenic
1071923482 10:90377641-90377663 CTTCAAATCATGAAGGAAACTGG + Intergenic
1072030295 10:91513869-91513891 CCACAAATCTTTGAGGAAAAGGG + Exonic
1078131910 11:8620377-8620399 CCTCAGACCCTGTAGGCAGAAGG + Intronic
1078617496 11:12879450-12879472 CTTCACATTCTGTTGGAAAATGG + Intronic
1078893357 11:15577194-15577216 CCCCAAATCCTCAAGGAAGAGGG + Intergenic
1082950571 11:58810786-58810808 CCTCAAATCATTAAGCAAAAGGG + Intergenic
1083421118 11:62553821-62553843 CCTCAAATGCTGAGGGATAAGGG - Intronic
1085754744 11:79193110-79193132 CCTCAAATACTGAAAGAAAATGG - Intronic
1087461647 11:98454979-98455001 CTTTAAATCCTGTAGGGAGAAGG + Intergenic
1090025275 11:123162356-123162378 CCTCAAATCATTTTGGAAACTGG - Intronic
1090321109 11:125844574-125844596 TATCCACTCCTGTAGGAAAAGGG + Intergenic
1091092088 11:132781008-132781030 CCTCAAATCCTTTATGGAAAGGG - Intronic
1093369884 12:18354228-18354250 CCTCAAGTCCTGTAGGTAGAAGG + Intronic
1093416610 12:18927777-18927799 ACTCAAATCCTGCAGCTAAAAGG + Intergenic
1093425540 12:19024315-19024337 CATCAGAGCCTGTAGGATAAGGG - Intergenic
1095389037 12:41683566-41683588 CCCCAAATACTGTAAAAAAAGGG - Intergenic
1097130536 12:56807990-56808012 CCTTAAGTCCTGTAGAGAAAAGG + Intergenic
1097140933 12:56902069-56902091 CCTTAAGTCCTGTAGAGAAAAGG - Intergenic
1097722673 12:63040564-63040586 TCACAAATGCTATAGGAAAATGG + Intergenic
1098909810 12:76197378-76197400 CCACAAATCCACTATGAAAATGG - Intergenic
1099958086 12:89370696-89370718 CTTCATATCCTGCAGGAGAAAGG + Intergenic
1101532655 12:105588134-105588156 CCTCAAATCATGGAAGTAAAAGG - Intergenic
1101709566 12:107252560-107252582 CCTCAAAGTTTGTAGCAAAATGG + Intergenic
1105630737 13:22163317-22163339 ACCCAAAGCCGGTAGGAAAAAGG - Intergenic
1107620258 13:42220896-42220918 CTTCAGACCCTGTATGAAAACGG - Intronic
1107801349 13:44110522-44110544 CCACAAGTCCTGTTGGCAAATGG + Intergenic
1108306997 13:49147303-49147325 CCTTAATTCCTGTAGGATATGGG - Intronic
1109101584 13:58190994-58191016 AATCAAAGCCTCTAGGAAAAAGG - Intergenic
1110738311 13:78964476-78964498 GCTAAAATCCTCTAGGATAATGG - Intergenic
1112925711 13:104672755-104672777 CCACAAACTCTGTAAGAAAAGGG + Intergenic
1114660458 14:24340208-24340230 CAGGAAATCCTGTGGGAAAAGGG - Intergenic
1115231778 14:31168212-31168234 CCTCAAATACTTCTGGAAAAGGG + Intronic
1115525833 14:34279792-34279814 TCTGAAATCCAATAGGAAAATGG - Intronic
1116592916 14:46802801-46802823 CCTCAATTCTTGTTGGCAAAAGG - Intergenic
1118983089 14:70731835-70731857 CCTCTAATCCAGTAGGAAAAGGG - Intronic
1119882910 14:78115558-78115580 TATCAAAATCTGTAGGAAAAAGG - Intergenic
1120744967 14:88144574-88144596 CCTCAGAATCTGGAGGAAAATGG + Intergenic
1120771914 14:88388341-88388363 AATCAAATTGTGTAGGAAAATGG + Intronic
1121920718 14:97878578-97878600 TCTAAAATCCTCTAGGACAAGGG + Intergenic
1122307894 14:100777064-100777086 ACTGAAATCCTGCAGGAAAGAGG - Intergenic
1124003671 15:25779784-25779806 CCTCAAATCTTTTTGGAATAAGG - Intronic
1124205174 15:27712372-27712394 CCCCAAATACAGTAGGATAAGGG - Intergenic
1127729200 15:61783054-61783076 CATCAAATCATGCAGGAAAAAGG - Intergenic
1127740034 15:61894336-61894358 CCAGAAATCCTGTAACAAAATGG + Intronic
1130227195 15:82068175-82068197 TCTCAAACCCTGTAGAAAAGGGG - Intergenic
1132008981 15:98257505-98257527 CCTCAAATTCAGAAGGGAAATGG - Intergenic
1132159061 15:99519908-99519930 CCACAAAACCTGTAGGGACAGGG + Intergenic
1138146732 16:54619333-54619355 CCTCATATCCTGTAGGTCAGGGG - Intergenic
1143225072 17:5294604-5294626 CCTCAGATACTGAGGGAAAACGG + Intronic
1143666531 17:8365282-8365304 CATCAACTCCTGTGGGTAAAAGG - Intergenic
1144400100 17:14887522-14887544 CTTCAATTCCAGAAGGAAAATGG - Intergenic
1146113865 17:30116632-30116654 CCTCAAAATCTGTAGGAGAAAGG - Intronic
1146362786 17:32191962-32191984 CCACAAATCCTCTAAGAACAGGG - Intronic
1146824357 17:36010099-36010121 CCTCAGACTCTGGAGGAAAATGG + Intergenic
1148655388 17:49279358-49279380 ACTCAACTCCTGTAGCCAAAAGG - Intergenic
1149039036 17:52165537-52165559 CCTCAAATCATGGAGTAGAATGG + Intergenic
1149521773 17:57323263-57323285 TCTCATATCCTGCAGGAAAGTGG + Intronic
1151207284 17:72517161-72517183 CCCCTAATCCTGTAAGAAACTGG + Intergenic
1153095808 18:1401539-1401561 TCTCATATCCTGTAGTCAAAGGG - Intergenic
1156592637 18:38508999-38509021 CATCAAGTCCTGTAGGATTAGGG + Intergenic
1156909089 18:42389467-42389489 CTCAAAATCCTGTAGGTAAAAGG + Intergenic
1157050234 18:44155223-44155245 CATCAAAGACTGTAGGATAAGGG - Intergenic
1157960017 18:52143034-52143056 TCTAAAATCCAGTAGGACAATGG + Intergenic
1160629326 18:80234393-80234415 CCTTAAATTCTGTAAGATAAAGG + Intronic
1161912300 19:7203693-7203715 CCTCAACTCCTGAAGGACACAGG + Intronic
1162660908 19:12168505-12168527 ACTCAAGTCCTGTAGGGAAGGGG + Intronic
1162911472 19:13850217-13850239 CCCCAAATCCCTTAGGAAAATGG + Intergenic
1164762089 19:30735860-30735882 CCTCAAATCCCTTTGGAAATAGG + Intergenic
1165122737 19:33571848-33571870 TCTTAAATCAGGTAGGAAAAAGG - Intergenic
1167132830 19:47598747-47598769 TCACAAACCCTGTAGTAAAAAGG + Intergenic
924997314 2:374101-374123 CCGCAGAACCTGTAGGAATATGG - Intergenic
925025247 2:602101-602123 CCTCAAGCCCTGGAGGAAGAAGG - Intergenic
925417473 2:3680690-3680712 GCTCACATGCTGTAGGGAAAGGG + Intronic
925659080 2:6183579-6183601 CCTGAAGTCCTGAAGGATAAAGG - Intergenic
928613897 2:33017554-33017576 GCCCAAATATTGTAGGAAAAGGG + Intronic
931350898 2:61487723-61487745 CTGCAAATCATTTAGGAAAAAGG + Intronic
931533817 2:63249326-63249348 CCTTAATTTCTGTAAGAAAATGG + Intronic
931768891 2:65480600-65480622 CCTCGAATGCGGTAGGAGAATGG - Intergenic
931803508 2:65781318-65781340 CATCAAAGCCTGTTGGAAGAGGG + Intergenic
933270626 2:80229278-80229300 CATCAGATCCTGTAGGTTAAGGG + Intronic
933920477 2:87040482-87040504 CCTCAAATCTTGTAAAGAAAAGG - Intergenic
933931147 2:87153304-87153326 CCTCAAATCTTGTAAAGAAAAGG + Intergenic
934002520 2:87729416-87729438 CCTCAAATCTTGTAAAGAAAAGG + Intergenic
935976368 2:108582977-108582999 ACTCAAATCCTTTAAGACAATGG + Intronic
936361976 2:111812128-111812150 CCTCAAATCTTGTAAAGAAAAGG - Intronic
936784846 2:116082292-116082314 CCTCATATCCTGTAAGTTAAAGG + Intergenic
941441136 2:165538312-165538334 CCCCAAAACCAGTAGGAAAGTGG + Intronic
941679887 2:168386210-168386232 ACTCAAATCCAGTAGAAGAAAGG + Intergenic
943703360 2:191010900-191010922 CCTAAAATTCATTAGGAAAACGG + Intronic
943720483 2:191198891-191198913 ACACAAATCCTGTTGGATAAGGG + Intergenic
944442723 2:199758718-199758740 CCTGAAAGCTTGTAGGAAATGGG + Intergenic
944892677 2:204134008-204134030 CCTCAAATCATTCAGGAAAAAGG - Intergenic
945601959 2:211878998-211879020 CCTCTAACCCTCTAGGAGAAAGG + Intronic
946133990 2:217630475-217630497 TCTGAAATCCTGTAGGGTAAGGG - Intronic
947161219 2:227216930-227216952 CCTCAAATCCTGTGTCCAAATGG + Intronic
947975328 2:234361013-234361035 CCACAGAGGCTGTAGGAAAAGGG + Intergenic
947991639 2:234492754-234492776 TTTCAAATCCTTTAGGAAAATGG - Intergenic
948642845 2:239386305-239386327 CCTCAGTTTCTGTACGAAAATGG + Intronic
1169843660 20:9966267-9966289 CCTCAAAACCAGCATGAAAAAGG - Intergenic
1170539843 20:17376428-17376450 CCTCAAGTACTGTAGGAGGATGG - Intronic
1170871565 20:20211142-20211164 CATCAAATCCAGAGGGAAAATGG + Intronic
1171119283 20:22554341-22554363 CCTCAAATAGTGTGAGAAAAAGG - Intergenic
1171144341 20:22768416-22768438 GCTCAAATCCTGAAGCAAGATGG - Intergenic
1172189763 20:33054837-33054859 CCCCAAATCTTGTTGAAAAAGGG - Intergenic
1173668530 20:44780791-44780813 CTTCAAATCCTCTTGGAAAAAGG - Intronic
1174031868 20:47635345-47635367 ACCCAAATCCTGTTGGACAAGGG + Exonic
1177938132 21:27375442-27375464 CCTCAAATCCTATTTGAAACTGG + Intergenic
1182145969 22:27996822-27996844 CCCCAGATCATGTAGGGAAAGGG + Intronic
949435396 3:4023779-4023801 CCTTAAATCCTTTATGAACATGG + Intronic
951110109 3:18793207-18793229 CCTGAAAACCTGTAGTAAAAGGG + Intergenic
952684252 3:36131136-36131158 TCTTAAGTCCTGTAGCAAAAGGG - Intergenic
952833322 3:37583764-37583786 CCTTAAATCCTGTTGGAACAAGG + Intronic
955786843 3:62550107-62550129 CCTCCAAACCTGGAAGAAAAGGG + Exonic
956327235 3:68067437-68067459 CCTCCACTCCTGGAGGAAAAAGG - Intronic
957882653 3:86240459-86240481 GCTCAAAACCAGTAGTAAAAAGG + Intergenic
958431029 3:94041520-94041542 CCACAAATCATAAAGGAAAAAGG + Intronic
959110808 3:102120410-102120432 CATCAAAAGCTGAAGGAAAATGG - Intronic
959201455 3:103252852-103252874 CCTAGAACCCTATAGGAAAAAGG + Intergenic
959430013 3:106241952-106241974 CCTTAAATCCTAAAAGAAAAGGG - Intergenic
959902959 3:111680385-111680407 CCTCAAATCCTGTAGGAAAATGG - Intronic
960532696 3:118782746-118782768 CCTCAAATCATAAAGGAAAGGGG + Intergenic
963555304 3:146779727-146779749 CCTAAATTCCTTAAGGAAAAAGG - Intergenic
963643008 3:147881390-147881412 CCTTAAGTCCTGTAGAGAAAAGG + Intergenic
964829776 3:160871207-160871229 GCTCAAATCCTGTTCCAAAAAGG - Intronic
964927045 3:161972225-161972247 GCTGAAATCCAGTGGGAAAAAGG + Intergenic
965528489 3:169746900-169746922 CCTACAATCCTGTAGGGAACAGG + Intergenic
967801121 3:193661227-193661249 CCTGAAATCCTGTGGGGAGAAGG - Intronic
970882531 4:20948558-20948580 CCTCACATTCTGTGGGAAACAGG + Intronic
971345788 4:25810612-25810634 CCTCCAATTCTCTAGGAAAATGG - Intronic
972565768 4:40267832-40267854 CATGAAATCCTCTAAGAAAAAGG + Intergenic
974168902 4:58240619-58240641 CTTCAAATCCTTTAAGTAAAAGG - Intergenic
974495765 4:62624588-62624610 CCACAAATCAGGTAGGAGAAAGG + Intergenic
974613160 4:64242707-64242729 GCTAAAATCCAGGAGGAAAATGG + Intergenic
974697582 4:65396277-65396299 CCTTAAGTCCTGTAGAGAAAAGG - Intronic
975147953 4:70991192-70991214 CCCCAGGTCATGTAGGAAAATGG + Intronic
977114784 4:93010037-93010059 CTTCAAATACTGTAGAATAAAGG - Intronic
977390767 4:96407299-96407321 CCCCAAATCCAGCAGGATAATGG + Intergenic
978475601 4:109125738-109125760 GCACAACTCCTGTAGGAAAGAGG + Intronic
979006849 4:115309689-115309711 CCTAAAATCATGTTGGCAAAGGG - Intergenic
982346704 4:154367944-154367966 CCTCAAAGCCTGGAGTACAAGGG - Intronic
983305888 4:165986045-165986067 CCTCAAATCATGTATTAAATGGG + Intronic
983771181 4:171551165-171551187 CTACAAATCCTGTTGAAAAAGGG + Intergenic
987147662 5:15008198-15008220 CCTCAATTCCCATTGGAAAATGG - Intergenic
987933880 5:24438344-24438366 GCTCAAATCCTGATGGAAAATGG + Intergenic
988007179 5:25431365-25431387 GCTCAAGTCCTTTAGGTAAACGG + Intergenic
988102555 5:26701103-26701125 CTTTAAATCCTGTATTAAAATGG + Intergenic
989821000 5:45795867-45795889 CCTTAAATCCTGTAGAGAAAAGG - Intergenic
990213368 5:53504385-53504407 CCTTAATTCATATAGGAAAAAGG + Intergenic
990427157 5:55697724-55697746 ACACAAATCCTGTAAGAAAGTGG + Intronic
990552280 5:56894942-56894964 CATGGAATCCTGAAGGAAAATGG + Exonic
996116778 5:119628835-119628857 TCTCAAACTCTGTAGGAAAGAGG - Intronic
996485843 5:124033321-124033343 CCTGAAATCATGGAGGAAAGGGG - Intergenic
998686745 5:144535661-144535683 CCTCACATCCTGCAGGGACATGG + Intergenic
999466792 5:151814795-151814817 CCTCCTATATTGTAGGAAAAGGG + Intergenic
1000024219 5:157344882-157344904 GCTCCACTCCTGGAGGAAAATGG - Intronic
1000531881 5:162432879-162432901 CCTAAAAATCAGTAGGAAAAAGG - Intergenic
1006194136 6:32227569-32227591 GATGAAATACTGTAGGAAAAAGG - Intergenic
1006208682 6:32374373-32374395 CTTTAAATCCTGTAGGAAGAAGG - Intergenic
1008589802 6:52982697-52982719 CCTTAAAATCTGTAGGGAAATGG + Exonic
1009462450 6:63930745-63930767 CCTCCAATACTGCAGGAAAGTGG + Intronic
1011713670 6:90081464-90081486 CTTCAATTGCTGTAGGAAAAAGG + Intronic
1011778953 6:90764875-90764897 CTTTAAACCCTGTAGGAAAAGGG + Intergenic
1013392584 6:109701648-109701670 CCTTAAATCCTTTTGGAACAAGG - Intronic
1013794467 6:113870615-113870637 CCTCAGACACTGGAGGAAAATGG - Intergenic
1014218800 6:118779541-118779563 CCTCAAAGTCTGTATCAAAATGG + Intergenic
1016706670 6:147116722-147116744 CCTCAATTTCCTTAGGAAAAGGG + Intergenic
1017103647 6:150868195-150868217 ACTCAATTCCTTCAGGAAAATGG + Intronic
1021799428 7:24289436-24289458 CATAAAAACCTTTAGGAAAAAGG - Intronic
1023636568 7:42217215-42217237 CCTCAAAACCGGTAGGACATGGG + Intronic
1027938924 7:84647574-84647596 CCTCAAGTCTTTTAGGAAAGAGG - Intergenic
1028113435 7:86970436-86970458 CCGCAAATCCTCTGGGAGAAAGG + Intronic
1028466330 7:91156602-91156624 CCCCAAATCCAGTGGGGAAAAGG + Intronic
1028753485 7:94409176-94409198 ACTCAAATCTTGTAATAAAACGG + Intronic
1029292453 7:99512570-99512592 CCTCGTCTCCTGGAGGAAAATGG + Exonic
1032774594 7:135098275-135098297 GCTCAAGTCCTGTTGTAAAATGG + Intronic
1032872026 7:135996350-135996372 CCTCCAATGCTGGAGGATAAAGG + Intergenic
1033669842 7:143481054-143481076 CCTCAAAACCAATAAGAAAAAGG - Intergenic
1034368626 7:150574098-150574120 GCTCAAATCTTCTAGGGAAAGGG - Intergenic
1035304411 7:157922117-157922139 CCTTAAAAACTGTAGGTAAAGGG + Intronic
1037007716 8:13803254-13803276 ACACACATCCTGTAGGCAAAGGG - Intergenic
1039271430 8:35885079-35885101 CCTACAATCCTGTAGAAACATGG + Intergenic
1039327252 8:36499045-36499067 CCTCAACTCATGGTGGAAAATGG - Intergenic
1040400155 8:47042166-47042188 CATAAAAACCTGTGGGAAAAGGG + Intergenic
1040918373 8:52587393-52587415 CTTTATATCCTGTGGGAAAAAGG - Intergenic
1041808073 8:61875587-61875609 CCTCTAATCCTGTGGAATAAGGG + Intergenic
1045896291 8:107221973-107221995 CCTAAATTCCTGGAGCAAAAGGG + Intergenic
1046899905 8:119512804-119512826 CTTCAAACCCGGTAGGAATAAGG + Intergenic
1046922086 8:119741831-119741853 CCTCAAATTCTCAAGGAACAGGG - Intronic
1047609270 8:126505140-126505162 CCACATATGCTGGAGGAAAAAGG - Intergenic
1050176372 9:2873385-2873407 GCTCAAATCCTTTTGGAAAAAGG + Intergenic
1050343175 9:4661462-4661484 ACTAAAATCCTGTAACAAAAAGG - Intronic
1052550401 9:29940243-29940265 CCTCACATCATGATGGAAAAGGG - Intergenic
1054798352 9:69323915-69323937 ATTCAAATTCTGGAGGAAAAGGG - Intergenic
1060933126 9:127501192-127501214 CCTCAAATTCTGCAGGTACAGGG + Intronic
1186322156 X:8439542-8439564 CCACAAACCCAGCAGGAAAAAGG + Intergenic
1186461784 X:9753951-9753973 CCTCAACTCCTGGGGGAAACGGG - Intronic
1187189034 X:17015349-17015371 CATCAAATTCTGTAAGACAAGGG + Intronic
1187270668 X:17776592-17776614 CCTCAGAGCCTTTCGGAAAAGGG + Intergenic
1187663582 X:21577601-21577623 CCTCAAATTTTGTAGGCAATTGG + Intronic
1188464288 X:30461345-30461367 CAAACAATCCTGTAGGAAAATGG - Intergenic
1192156751 X:68752572-68752594 GCTCATATACTATAGGAAAATGG + Intergenic
1192694068 X:73395968-73395990 CCTTATATCTTGTAGCAAAAAGG + Intergenic
1193813830 X:86082646-86082668 CCCAAAATCCTGTAGCAATATGG - Intergenic
1194124076 X:89992279-89992301 CCTTAAGTCCTGTAGAGAAAAGG + Intergenic
1195507652 X:105676538-105676560 ACTAAAATAATGTAGGAAAAAGG + Intronic
1195669889 X:107460718-107460740 CCTCCAATCCTGTATCAATATGG + Intergenic
1197673373 X:129303194-129303216 CCTCACATCCTGTAAGAGAGGGG + Intergenic
1197917393 X:131551165-131551187 CCACATATCCTGTAGGCAATAGG - Intergenic
1199361427 X:146923731-146923753 CATCAAATCATGGAGAAAAAAGG - Intergenic
1199904366 X:152209442-152209464 GCTCAAAACTTGAAGGAAAAGGG - Intronic
1200476963 Y:3649901-3649923 CCTTAAGTCCTGTAGAGAAAAGG + Intergenic