ID: 959903980

View in Genome Browser
Species Human (GRCh38)
Location 3:111690559-111690581
Sequence CTCAGAACACTGGTCTTCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 144}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959903977_959903980 8 Left 959903977 3:111690528-111690550 CCAGCATGAGGCTTTAGCAGGTG 0: 1
1: 0
2: 2
3: 13
4: 101
Right 959903980 3:111690559-111690581 CTCAGAACACTGGTCTTCAAGGG 0: 1
1: 0
2: 1
3: 18
4: 144
959903974_959903980 24 Left 959903974 3:111690512-111690534 CCTCTACACAGAAAGACCAGCAT 0: 1
1: 0
2: 0
3: 18
4: 207
Right 959903980 3:111690559-111690581 CTCAGAACACTGGTCTTCAAGGG 0: 1
1: 0
2: 1
3: 18
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959903980 Original CRISPR CTCAGAACACTGGTCTTCAA GGG Intronic
903193789 1:21670322-21670344 CACAGAACACTCGTGTTCCAGGG + Intergenic
908800870 1:67879295-67879317 CTGAGAGCACTGATCTTCACAGG + Intergenic
910899992 1:92110076-92110098 CTCATAACACAGGTCTTCCAAGG + Intronic
912747492 1:112257547-112257569 CTCAGAGCACTGGTCTTTGGAGG - Intergenic
912901434 1:113654047-113654069 CTCAGAAAACTGGACTTGCAGGG - Intronic
913701283 1:121376711-121376733 ATCTGAACACTGTCCTTCAATGG + Intronic
914041840 1:144057178-144057200 ATCTGAACACTGTCCTTCAATGG + Intergenic
914136250 1:144903308-144903330 ATCTGAACACTGTCCTTCAATGG - Intronic
918793768 1:188865246-188865268 CTCAAAATAATTGTCTTCAAGGG - Intergenic
920488708 1:206395433-206395455 ATCTGAACACTGTCCTTCAATGG + Intronic
921067074 1:211630790-211630812 CTGAGATCACTGGTCTAGAAGGG - Intergenic
921903176 1:220469319-220469341 ATCAAAACACTGGTTTTTAATGG - Intergenic
922219395 1:223546564-223546586 CTCAGAACAGTAGTATGCAAAGG + Intronic
923041696 1:230324135-230324157 CTGAGAACACTGGCCTTCTTGGG + Intronic
1062879559 10:966942-966964 CTCAGAACACTGGCAGCCAAAGG + Intergenic
1064974513 10:21099587-21099609 TTCAGAAAACTGCTCTACAAAGG + Intronic
1068938817 10:62661190-62661212 GTCTGAAGACTGCTCTTCAAAGG - Intronic
1070089378 10:73269827-73269849 ATCAGAACTCTTTTCTTCAAAGG + Intronic
1071090283 10:81910369-81910391 CCCAGAACTCTAGTCTTCAAGGG - Intronic
1071377233 10:85019922-85019944 CTTATAACACTTCTCTTCAATGG - Intergenic
1073954032 10:108847127-108847149 ATCAGAACAGTGGTTTTCTATGG + Intergenic
1074918441 10:117982362-117982384 GTCTGCACACTGGACTTCAATGG - Intergenic
1080016401 11:27511186-27511208 CTGAGAACACTGGAGTCCAAGGG + Intergenic
1083051511 11:59780908-59780930 CTCAGAATACTTGTTTTCATTGG + Intronic
1087603329 11:100343520-100343542 CTCAGAACGCGGGTTTTCACAGG + Intronic
1087802804 11:102522156-102522178 CTCAGAACACTAGTCCTACAGGG - Intronic
1089642890 11:119859326-119859348 CCCAAAACCCTGGTCTTCTAAGG - Intergenic
1089743005 11:120597877-120597899 CTCGGAACAGGAGTCTTCAACGG - Intronic
1091660865 12:2382441-2382463 CTCAGAATAATGTTCTTAAATGG - Intronic
1092675794 12:10917583-10917605 CTGAGAACACTAGACTTCACTGG - Intronic
1093589569 12:20885194-20885216 TTCAGAAAACTTTTCTTCAAAGG - Intronic
1095293536 12:40503372-40503394 CTAAGAACTCTGGTTTCCAAAGG - Intronic
1095503540 12:42867437-42867459 GTCATTACACTGGTCTGCAAAGG - Intergenic
1097320159 12:58216673-58216695 CCCAGAACACTGCTGTCCAAGGG - Intergenic
1099595384 12:84656259-84656281 GTCAGACTTCTGGTCTTCAAAGG + Intergenic
1102174207 12:110864295-110864317 CTCAGAAAACTTTTCTTAAAGGG - Intronic
1102370574 12:112379965-112379987 CACAGAAGAATGGTTTTCAAAGG - Intronic
1102577924 12:113868650-113868672 CTCAGGACACTGGTATTCCATGG + Intronic
1102748132 12:115267969-115267991 CTCAGACCTTTGGTCTTCTAAGG - Intergenic
1103327542 12:120131412-120131434 GTCAGCACACTGGTCTCCAGCGG - Intronic
1106619819 13:31362440-31362462 CTCAGTACACTGTTCTTTTAGGG - Intergenic
1114277369 14:21158940-21158962 GTCAGAACACAAGTCTTCCATGG + Intergenic
1121865974 14:97363171-97363193 GTCTGAAAACTGGCCTTCAATGG + Intergenic
1122199451 14:100113663-100113685 AGCACAACACTGGACTTCAAAGG - Intronic
1124857426 15:33403750-33403772 CTAAAAACACTGATCTTAAATGG + Intronic
1125258989 15:37800632-37800654 CTCAGGACCCAGGTCTCCAAAGG + Intergenic
1126352766 15:47762323-47762345 CCCACGACACTGCTCTTCAAAGG - Intronic
1127903829 15:63361298-63361320 CAAAGAACACTGTTTTTCAAAGG + Intronic
1130104439 15:80918863-80918885 CTCAGAACTCAGGTCTTCAGAGG - Intronic
1130861534 15:87895065-87895087 CTCAGAACCCAGGGCTTGAAAGG + Intronic
1132724323 16:1332332-1332354 TCCAGAACACAGCTCTTCAAAGG - Intergenic
1134906412 16:17983339-17983361 ATGCTAACACTGGTCTTCAAGGG + Intergenic
1137717041 16:50604334-50604356 CCCAGAACACTTGTTTTCAGAGG - Intronic
1139678558 16:68542015-68542037 AACAGAACACTGGTCCTAAACGG + Intronic
1144424010 17:15124041-15124063 CTCAAAAGACTAGTCCTCAAGGG - Intergenic
1150657585 17:67050312-67050334 TTCAGAGCACTGCTCTTCCATGG - Intronic
1155063782 18:22251412-22251434 CCCAAAACCCTGGGCTTCAAGGG + Intergenic
1155580686 18:27302264-27302286 CTCAGAAAACTTATCATCAACGG + Intergenic
1156115216 18:33779393-33779415 CTGAGAACACTGGACTTTGAAGG + Intergenic
1157405229 18:47417283-47417305 TTCAGAGCACTGGTCTCCCATGG + Intergenic
1162689881 19:12420703-12420725 GTCAAAACACTGGACTTCAATGG + Intronic
1166865455 19:45833663-45833685 ATCAGAACACTGGTTTTCTCTGG + Intronic
1168355040 19:55695405-55695427 CTCACAACACTGATCTCCCAGGG - Exonic
926991190 2:18682239-18682261 CATAGAACACTAGTCTCCAACGG - Intergenic
927870643 2:26620740-26620762 CTCAGATATCTGGTCATCAAGGG - Intronic
930846578 2:55912215-55912237 CTGAGATCACAGGTCTTCACTGG + Intronic
932573510 2:72950621-72950643 CTCAGAGAGGTGGTCTTCAAGGG - Intronic
934060497 2:88288063-88288085 ATCAGAACACTTTTCTTAAAGGG + Intergenic
940373521 2:152927772-152927794 CTCAGAACACTGGAATTCACTGG - Intergenic
940720142 2:157273165-157273187 CTCATCACTCTGGTCTTTAATGG + Intronic
942432021 2:175921876-175921898 CTCACAACACAGGTGTTCAGGGG - Intergenic
944822174 2:203441776-203441798 CTCTGAGCACTGGACTTCCAAGG + Exonic
944825680 2:203480936-203480958 CTCACAGCATTGATCTTCAAAGG + Intronic
945907411 2:215610537-215610559 CTCATAACACTTGCCCTCAAAGG + Intergenic
946412234 2:219521185-219521207 CTCAGAGGGCTGGTCTTCAAGGG + Intronic
1169777097 20:9267388-9267410 CTTAGAACACTGGCCTTACATGG + Intronic
1171251511 20:23652713-23652735 CCCAAAACACTGGGCTTCAAGGG + Intergenic
1172391382 20:34567681-34567703 GTCAGACCACAGGCCTTCAAGGG - Intronic
1173304472 20:41835286-41835308 CCCAGATCACTGCTCTTCATTGG - Intergenic
1173346241 20:42202846-42202868 CACAGATCATTGGTTTTCAAAGG + Intronic
1175416750 20:58806247-58806269 CTCAGACCACAGCTCTTCAGAGG + Intergenic
1175447598 20:59034486-59034508 ATCAAAACACTGGTTTTTAATGG + Exonic
1175636705 20:60590421-60590443 CTCACAACTCTAGTCTTGAATGG - Intergenic
1177634881 21:23774425-23774447 CTCAAAACTCTGGTTATCAAAGG + Intergenic
1178040926 21:28640258-28640280 CCCAGAGCACTGGTCATCATGGG - Intergenic
1179842722 21:44087690-44087712 CTCAGAAGACTGTTCTACGAAGG - Exonic
1181183380 22:21082971-21082993 CTAAAAACCCTGGCCTTCAAAGG - Intergenic
1181898112 22:26129082-26129104 ATCAGAAGCCAGGTCTTCAATGG - Intergenic
1182004912 22:26951867-26951889 CTCAGAAAACCGGTCTTGATGGG + Intergenic
1184720220 22:46308266-46308288 CTCATAACACTGGCATTTAAAGG - Intronic
950010004 3:9716269-9716291 CCCAGACCAGTGGTCTTCACTGG + Intronic
950564990 3:13763990-13764012 CTCTGGACACTGGTCATCATAGG + Intergenic
951701207 3:25498293-25498315 CTCAAAGCAGTGGTCTACAAGGG + Intronic
953192125 3:40697900-40697922 CTCAGATCACTTGGCTTCTAAGG - Intergenic
954429543 3:50463005-50463027 CTCAGGACAGTGGCCGTCAAAGG + Intronic
955730094 3:61976003-61976025 ATTAGAACACGGTTCTTCAAGGG - Intronic
959181462 3:102985751-102985773 CTCAGAAGAATGGTCTGCAATGG - Intergenic
959903980 3:111690559-111690581 CTCAGAACACTGGTCTTCAAGGG + Intronic
960881918 3:122354062-122354084 CTCAGAACATTGAGCTTCCATGG + Intergenic
961646070 3:128393467-128393489 CTCAGAAGCCTGGGCTCCAAGGG - Intronic
964050806 3:152390903-152390925 CTCACATCACTGCACTTCAAAGG - Intronic
964479645 3:157128591-157128613 CTCAGAACACTGGAGATGAAAGG + Intergenic
965794364 3:172424012-172424034 CTCAGATTACTGGAGTTCAAAGG + Intergenic
968422827 4:499534-499556 CTCAGAAAAAAGGTCTTCTAGGG - Intronic
968639308 4:1703502-1703524 CTTAGAACAGTGGTTTTCAAAGG - Intronic
969371090 4:6732062-6732084 CACGGTGCACTGGTCTTCAATGG + Intergenic
973734386 4:53856200-53856222 CTCAGAACACTTTTCTGCAATGG - Intronic
973735067 4:53863741-53863763 CTCTGAACACTGGGCTTCAGGGG - Intronic
974192618 4:58526786-58526808 CTCAGAACAATGGTATAAAATGG - Intergenic
978278770 4:106984699-106984721 CTAAGAATATTGGTGTTCAAGGG + Intronic
979029058 4:115616842-115616864 CTCAGCCAACTGTTCTTCAAAGG + Intergenic
985724113 5:1506691-1506713 CCCAGAACAATGGCCTTCTAAGG + Intronic
988696872 5:33630864-33630886 CTCAGAAAACTGGCCATCTATGG + Exonic
994488661 5:100412287-100412309 CTGAGAACACTTGTTTTCATGGG + Intergenic
997021813 5:130011442-130011464 CTCAGCAAACTAGTCATCAATGG + Intronic
999778588 5:154830586-154830608 ACCAGAACACTGGTCTTGACTGG + Intronic
1000078450 5:157819260-157819282 TTCAGAACACTGTTCTACTATGG + Intronic
1000661970 5:163948938-163948960 CTCAGAAAATTTGTCTTCCAAGG + Intergenic
1002984695 6:2177662-2177684 CTCAAAACACTAGGCATCAAAGG + Intronic
1003123084 6:3333985-3334007 TTCAGAACACTGCTTTTCAAAGG - Intronic
1005387856 6:25303589-25303611 CACAGGACACTGGTGTTCCAGGG + Intronic
1006999444 6:38295742-38295764 CTCAGAATACAGATCTTAAATGG - Intronic
1009554360 6:65143352-65143374 TTCAAAACAGTGGTCATCAATGG + Intronic
1010402120 6:75457920-75457942 CCTAGAACATTGGTTTTCAATGG + Intronic
1013893478 6:115054863-115054885 CTCAGAAGATTGGTCTGCACAGG - Intergenic
1014672655 6:124325707-124325729 ATCAGAACAGTGGTCTTCTCAGG + Intronic
1018111915 6:160544580-160544602 CTCAGGATGCTGGTCTTCAGTGG + Intronic
1018131345 6:160734935-160734957 CTCAGGATGCTGGTCTTCAGTGG - Intronic
1022289199 7:28984987-28985009 CACAGGATATTGGTCTTCAAAGG + Intergenic
1024719128 7:52115249-52115271 TTCAGAACACACGACTTCAAGGG - Intergenic
1026385253 7:69840530-69840552 ATAAGAACACTGGGCTTCACAGG + Intronic
1028590971 7:92494182-92494204 CTAAGAAAGCTGGTCTTCTAAGG + Intronic
1030125486 7:106149094-106149116 TTCCGAACACTGGACTTCCATGG - Intergenic
1030927696 7:115477787-115477809 CTCAGAGCACTGTTAGTCAAGGG - Intergenic
1031891356 7:127296692-127296714 ATCAAAACACTGGTTTTGAATGG - Intergenic
1038443106 8:27585375-27585397 CCCAGAACACTGGTCCCCATTGG + Intergenic
1038506467 8:28089148-28089170 CTCAGAATACTAGTGTTCCATGG - Intergenic
1039540990 8:38369688-38369710 ATAAGAACACTGATCTTCAGTGG + Intronic
1040831350 8:51680937-51680959 CCCAAAACCCTGGTCTTCTAGGG - Intronic
1041178054 8:55217807-55217829 CTCAGAAGACTGCTTTGCAATGG + Intronic
1041335911 8:56783296-56783318 TTCAAAACCCTGTTCTTCAAAGG - Intergenic
1045184462 8:99823003-99823025 ATCAGAACACTGGTTTTCAAAGG - Intronic
1047419432 8:124694296-124694318 CACACAACACTGCTCTTCAAAGG - Intronic
1047907454 8:129487638-129487660 TTCATAACAATGGTCTTAAATGG - Intergenic
1050318352 9:4425949-4425971 CTCAGAACAGTGGTTTGCAAAGG + Intergenic
1051114090 9:13674263-13674285 CTCAGCACATTGCTCTTCAATGG + Intergenic
1051256771 9:15221628-15221650 GTCAGAACTCTGCTCTTCTAGGG - Intronic
1051664585 9:19456790-19456812 CCCTGAGCTCTGGTCTTCAAAGG - Intergenic
1060423208 9:123484342-123484364 CTCTGAACACTGAGATTCAAGGG - Intronic
1186025802 X:5309944-5309966 CTCAGAAAACTGAAATTCAAAGG - Intergenic
1186025932 X:5311978-5312000 CTCAGAAAACTGGAATTCAAAGG - Intergenic
1186383174 X:9082588-9082610 CAAAGAAAACTGCTCTTCAAAGG + Intronic
1186398766 X:9237184-9237206 CATAAAACACTGGGCTTCAAAGG + Intergenic
1189921147 X:45904209-45904231 CTCAGAAAACTGGCCTGCAGGGG + Intergenic
1190456391 X:50632161-50632183 TTCAGAACACTGCTCGCCAATGG - Intronic
1195249814 X:103032093-103032115 CTCAGAGAATTGGGCTTCAAGGG + Intergenic
1195876629 X:109549289-109549311 CTTAGAACACAGGTCTTCTTTGG - Intergenic
1198865900 X:141122523-141122545 AGCAGAACACTGGTCTTCTATGG + Intergenic
1200257911 X:154594720-154594742 CTCAGAAAGCTGGACTTCCAGGG + Intergenic
1201213784 Y:11704325-11704347 CTCAAAACAATGGTCTCGAATGG + Intergenic
1201473944 Y:14361060-14361082 CTCAGAACATTTTTTTTCAAGGG - Intergenic
1201644372 Y:16212488-16212510 CTTAGAAAACTGGAATTCAAAGG + Intergenic
1201658443 Y:16372833-16372855 CTTAGAAAACTGGAATTCAAAGG - Intergenic
1201748941 Y:17411770-17411792 CTCAGAAGGCTAATCTTCAAGGG - Intergenic