ID: 959904313

View in Genome Browser
Species Human (GRCh38)
Location 3:111693801-111693823
Sequence CACAAAGGGGTGAAGGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 385
Summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 348}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959904313_959904328 19 Left 959904313 3:111693801-111693823 CCCACCTCCTTCACCCCTTTGTG 0: 1
1: 0
2: 2
3: 34
4: 348
Right 959904328 3:111693843-111693865 AGCTAGGTCTACACCTGCTTGGG 0: 1
1: 0
2: 2
3: 5
4: 90
959904313_959904329 20 Left 959904313 3:111693801-111693823 CCCACCTCCTTCACCCCTTTGTG 0: 1
1: 0
2: 2
3: 34
4: 348
Right 959904329 3:111693844-111693866 GCTAGGTCTACACCTGCTTGGGG 0: 1
1: 0
2: 1
3: 7
4: 85
959904313_959904327 18 Left 959904313 3:111693801-111693823 CCCACCTCCTTCACCCCTTTGTG 0: 1
1: 0
2: 2
3: 34
4: 348
Right 959904327 3:111693842-111693864 CAGCTAGGTCTACACCTGCTTGG 0: 1
1: 0
2: 1
3: 10
4: 118
959904313_959904321 3 Left 959904313 3:111693801-111693823 CCCACCTCCTTCACCCCTTTGTG 0: 1
1: 0
2: 2
3: 34
4: 348
Right 959904321 3:111693827-111693849 TATTATCCCACTCCCCAGCTAGG 0: 1
1: 0
2: 1
3: 12
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959904313 Original CRISPR CACAAAGGGGTGAAGGAGGT GGG (reversed) Intronic
900007064 1:65905-65927 TAAAAAGGAGGGAAGGAGGTGGG - Intergenic
900195050 1:1371790-1371812 CACGCAGGGGTGGAGGAGGCCGG + Intergenic
900576885 1:3387468-3387490 CACAAGGGGGTTGAGGGGGTCGG - Intronic
900658611 1:3772308-3772330 CCAGCAGGGGTGAAGGAGGTCGG + Intergenic
901720775 1:11195465-11195487 GAGAAAGGAGTGAAGGAGGCAGG + Exonic
901790196 1:11649917-11649939 GAGAAGGGGGTGGAGGAGGTGGG - Intronic
902028733 1:13405075-13405097 CACAGAGAGGTTAAGGAAGTTGG - Intergenic
902730243 1:18364395-18364417 TGCAGGGGGGTGAAGGAGGTGGG - Intronic
903498768 1:23790590-23790612 AACAAAGCTGTGAAGGAGGCAGG + Intergenic
903588208 1:24433364-24433386 CACAAATGGGTTGAGGGGGTTGG + Intronic
904269555 1:29340796-29340818 CAGCAAGGGGTGAATGATGTTGG + Intergenic
904412219 1:30331344-30331366 CAGAAAGGGGTGAGGGAGTCAGG - Intergenic
904438693 1:30515867-30515889 CACAAAGCACTGAGGGAGGTGGG - Intergenic
904783919 1:32971378-32971400 CACAAAGGATGGAGGGAGGTGGG - Intergenic
904937028 1:34138411-34138433 CTCAGGGAGGTGAAGGAGGTTGG - Intronic
906265027 1:44422095-44422117 CACAAAGGTGTGTACTAGGTAGG + Intronic
906311611 1:44758403-44758425 GAAGAAGGGATGAAGGAGGTCGG - Intronic
907490415 1:54805713-54805735 CCCAAAGTGGAGAAGGAGCTGGG + Intergenic
910353273 1:86324331-86324353 CACAAGGCGGAGAAGGAGGTGGG + Intergenic
910726658 1:90347065-90347087 CCAAAAGAGGTCAAGGAGGTTGG + Intergenic
911204687 1:95080396-95080418 TACAAAGGTGTGAATGTGGTAGG - Intergenic
913049766 1:115106974-115106996 CACAGAGGGGTGGAGGAAGTGGG + Intergenic
913221397 1:116663566-116663588 CACACAGAGGTCAAGGGGGTAGG + Intronic
914827604 1:151146689-151146711 CCCAAAGGCGGGCAGGAGGTGGG - Intergenic
915165532 1:153946096-153946118 CAGAAGGGGGTGCAGGAGGCCGG + Intronic
915253212 1:154605341-154605363 CCCCAAGGGCTGAAGAAGGTGGG - Intronic
916075631 1:161198541-161198563 CACAATGGGGAGCAGGAGGCAGG + Exonic
916538208 1:165724881-165724903 CAGAAAGGGCAGAAGCAGGTGGG + Exonic
917448247 1:175124807-175124829 AAGGAAGGGGAGAAGGAGGTAGG - Intronic
917665972 1:177226208-177226230 CACCAAGGGGTGAAGTAGCTGGG + Intronic
917690310 1:177461825-177461847 CACAGATGGGTGAAGCAGGATGG - Intergenic
918125856 1:181582865-181582887 CACTAAGGAGGGAAGGAGGGAGG + Intronic
918465732 1:184819616-184819638 CGCAATGGAGTGAAGGAGGCCGG + Intronic
918724549 1:187902738-187902760 CAGAAAGGAGGGAAAGAGGTAGG + Intergenic
919187385 1:194170081-194170103 CCAAAAGGGGGGAAGGTGGTAGG - Intergenic
920442939 1:205993513-205993535 CACATATTGGTGAAGGAGGGAGG + Exonic
921383125 1:214544961-214544983 CACAAAGAGGTTAAGCAGGCAGG + Intronic
923549734 1:234954036-234954058 CAGAAAGGAGGGAAGGAGGACGG + Intergenic
924081881 1:240406710-240406732 CTCAAAAGGGTGAATGTGGTTGG + Intronic
924685125 1:246281181-246281203 CACACAGGTGAGAAGGAAGTGGG + Intronic
924848147 1:247793979-247794001 CTCTAAGGGATGAATGAGGTGGG + Intergenic
1063882962 10:10549936-10549958 AATAAAGGGGTGAGGGAGGCAGG + Intergenic
1065574688 10:27105466-27105488 CAAACATTGGTGAAGGAGGTGGG - Intergenic
1066390653 10:34975250-34975272 CTCAAAGGGGAGAATGAGGAGGG + Intergenic
1067035505 10:42913154-42913176 CACACACCAGTGAAGGAGGTAGG - Intergenic
1068457620 10:57278706-57278728 TAAAAAGTGGTTAAGGAGGTGGG + Intergenic
1069097051 10:64271681-64271703 CACATAGGGGTCAAGGAGCTGGG - Intergenic
1070055477 10:72930428-72930450 GCCAAAGGGGTGGAGGAGGCTGG - Intronic
1070269141 10:74934978-74935000 CACACAGGGGTGAAGAAAGCAGG + Intronic
1070641408 10:78173048-78173070 CACTGAGGGATGAAGGAGCTGGG - Intergenic
1072064356 10:91851246-91851268 CACAAGGAGCTGAAGGAGATTGG + Exonic
1073155111 10:101340275-101340297 CAGAAAAGGGTGAAAGAAGTGGG + Intergenic
1073243899 10:102075907-102075929 CTCCAAGGGGTCAAGGAGGCAGG + Intergenic
1074064040 10:109996492-109996514 CAAAAATGGGGGAAGGAGGAAGG + Intronic
1074496168 10:113981866-113981888 CACAAAGAGGAGACTGAGGTAGG - Intergenic
1077257449 11:1593554-1593576 CAAAAAAGGGTGATGGATGTGGG + Intergenic
1078854694 11:15197540-15197562 CACAAAGAGGTGGATGAGGAAGG - Intronic
1078855171 11:15201115-15201137 AGCAAAGAGGTGAAGGAGATGGG + Intronic
1079133158 11:17761321-17761343 TACCAAGAGGTGAGGGAGGTGGG - Intronic
1079166320 11:18046602-18046624 CACAGAGAGGTGTGGGAGGTGGG - Intergenic
1079303080 11:19296749-19296771 GACAAAGAGGAGAAGGAGGATGG + Intergenic
1081710414 11:45212413-45212435 TACAAAAGGGAGAAGGAGGGAGG - Intronic
1082957622 11:58886905-58886927 AACAAAGGGGTAAAGGGGATGGG + Intronic
1082964272 11:58949336-58949358 AACAAAGGGGTAAAGGGGATGGG + Intronic
1083689731 11:64400084-64400106 CATAAGGGAGTGAAGGAGATGGG + Intergenic
1083730937 11:64652161-64652183 CACCAAGGGGGGAATGAGGAGGG + Intronic
1083872131 11:65495298-65495320 CATAAAGGGGCCAAGGCGGTTGG - Intergenic
1083899669 11:65637512-65637534 CGCAGAGGGGTGAAGGATGTGGG + Intronic
1084190421 11:67496139-67496161 GATAAAGGGGAGAAGGAGGAGGG - Intronic
1085411951 11:76296706-76296728 CACAGAGGGGTGCAGGAAGCAGG + Intergenic
1085524320 11:77155411-77155433 CATAAAGAGCTGAAGGAGCTGGG - Intronic
1086061710 11:82706784-82706806 CTCACAGGGGTCAAGGAGGCAGG - Intergenic
1087797428 11:102469418-102469440 CACAAAAAGGTCAAAGAGGTTGG + Intronic
1087860209 11:103144148-103144170 CACACAGGGGTTAAGTAAGTGGG + Intronic
1088514708 11:110618090-110618112 CATAAAGGGGGGCAGGGGGTGGG - Intronic
1088829010 11:113519506-113519528 AACCAAGGAGTGATGGAGGTTGG - Intergenic
1089055783 11:115583636-115583658 AACAAAGTGATGAAGGAGCTAGG + Intergenic
1089936187 11:122366297-122366319 CAGAAAGGGATGATAGAGGTGGG - Intergenic
1091023108 11:132118920-132118942 CTCAAGGGGGTGAAGGGGCTGGG + Intronic
1093281400 12:17201228-17201250 CTTTAAGGGGTTAAGGAGGTAGG - Intergenic
1094465418 12:30749072-30749094 AATAAAAGGCTGAAGGAGGTTGG + Intronic
1095478181 12:42607540-42607562 CCCAAAAGGGTGAAGGTGGCAGG + Intergenic
1096050200 12:48600797-48600819 GAGAAGGGGGTGCAGGAGGTGGG - Intergenic
1096055788 12:48650811-48650833 CATAAAGGAGTGAAGCAGGCAGG + Intergenic
1096490645 12:52010949-52010971 CACACAGGGGTCAGGGGGGTTGG + Intronic
1096919815 12:55072052-55072074 CACAAAGGGTTGAGTGTGGTGGG - Intergenic
1098834386 12:75403738-75403760 AACAGAAGGATGAAGGAGGTAGG - Intronic
1099597722 12:84689340-84689362 TAAAAAGGAGTAAAGGAGGTTGG + Intergenic
1099813982 12:87621657-87621679 CCCAAAGAGGTGTTGGAGGTAGG + Intergenic
1100316765 12:93451954-93451976 CACAATGTGGTGAAGGAGACAGG - Intergenic
1101730081 12:107419608-107419630 CACAGAGGGGTTAAGCAGCTGGG - Intronic
1101810172 12:108101139-108101161 CAGAGAGGGGTGATGGAGCTAGG - Intergenic
1102625735 12:114234193-114234215 CACGAAGGGGTGAAGAACCTTGG - Intergenic
1102761195 12:115386905-115386927 CACACAGCGGTGAGGGAGGCAGG - Intergenic
1105863165 13:24434949-24434971 CACAATAGGGTGAAGAAGGTGGG + Exonic
1106124430 13:26888864-26888886 GACAAAGGCTGGAAGGAGGTGGG - Intergenic
1106816084 13:33408760-33408782 CAGAGAGAGGTGAGGGAGGTGGG - Intergenic
1106858604 13:33880384-33880406 CACTATGGTGTGAGGGAGGTAGG + Intronic
1108498672 13:51048905-51048927 AACAAATGGGGGAAGGAGGTTGG + Intergenic
1110452926 13:75657076-75657098 CACAGAGGGATGAAGGCCGTGGG + Intronic
1110513034 13:76375458-76375480 CTAAAAGAGGTGAAGTAGGTGGG - Intergenic
1111359354 13:87154587-87154609 GACAAAGGGGAGAGTGAGGTAGG + Intergenic
1111432495 13:88162035-88162057 CAAAAAGGGGTGGTGGAGATGGG + Intergenic
1112950494 13:104989857-104989879 CACAAAAGGATGATGGTGGTGGG + Intergenic
1113016540 13:105834455-105834477 GACAAAGGGGTGAAGGACGATGG - Intergenic
1113386607 13:109854561-109854583 CACAAAGAGGAGAAGCTGGTGGG - Intergenic
1113405586 13:110036554-110036576 AACAATGGGGTGGGGGAGGTTGG + Intergenic
1113990834 14:16025774-16025796 CATGAAGGGGTGAAGCTGGTGGG - Intergenic
1114542116 14:23468759-23468781 CACAAGCTGGTGAAGTAGGTTGG - Intergenic
1116085010 14:40224409-40224431 CAAAAAGGGGTGAAGGAGGAAGG + Intergenic
1117963639 14:61186158-61186180 GACAAAGAGGAGAAGGAAGTGGG - Intergenic
1119625738 14:76173595-76173617 CAGAAAGGGGCGAAGAAGGCTGG + Exonic
1119688769 14:76654326-76654348 CCCAAAGGGGAGGAGGTGGTGGG - Intergenic
1119918602 14:78425750-78425772 CGAAGAGGGGTGAAGGAGGTAGG - Intronic
1119996884 14:79262851-79262873 TACAAAGCGAAGAAGGAGGTGGG + Intronic
1121175115 14:91885110-91885132 CAGAAAGGGGTTAAGTAGGAAGG + Intronic
1124274478 15:28314355-28314377 AACAATGGGGTGAGGGAAGTGGG + Intronic
1125245281 15:37629576-37629598 TAGAAAGGGGTGAAGAGGGTGGG + Intergenic
1125679072 15:41519620-41519642 GACAAAGGGCAGAAGGAGGGAGG - Intronic
1126218633 15:46186224-46186246 GAAACAGGGGTGAAGGAGGTGGG - Intergenic
1126588946 15:50320046-50320068 CACAAAGGGGTCAGGCGGGTGGG + Intronic
1127913225 15:63435428-63435450 CCCAAAGGAGTGAAGGAGCCAGG - Intergenic
1129246197 15:74280363-74280385 CAGAGAGGGGTGAGGGAGATGGG + Intronic
1130986723 15:88849303-88849325 AAAAAAGGGGTGATGGAGCTGGG + Intronic
1132091769 15:98953167-98953189 CACTAGGGGCTGAAGGAGCTCGG + Intronic
1133606262 16:7391190-7391212 CACCAAGGTGGGACGGAGGTGGG - Intronic
1134368652 16:13603232-13603254 CATAAGGGGCTGAGGGAGGTAGG + Intergenic
1136069012 16:27777006-27777028 CATCGAGGGGTGAAGGAGTTTGG + Exonic
1136724737 16:32348740-32348762 CGCAAGGAGCTGAAGGAGGTGGG - Intergenic
1136843063 16:33554780-33554802 CGCAAGGAGCTGAAGGAGGTGGG - Intergenic
1136910013 16:34136908-34136930 CATGAAGGGGTGAAGCTGGTGGG - Intergenic
1137724363 16:50646912-50646934 CACAGAGGGCTGAATGTGGTGGG - Intergenic
1137753501 16:50884005-50884027 CACAAAGGAGTGAAAAAGGAAGG - Intergenic
1137780391 16:51093414-51093436 CACAGAGGGGTGTAGGATGAGGG + Intergenic
1138645988 16:58425346-58425368 CACAAAGACTTGAAGGAGGGAGG + Intergenic
1139484926 16:67249996-67250018 CACAACAGGGAGAAGGAGGAGGG - Intronic
1140253122 16:73312188-73312210 GACAAAAGGATGAAGGAGGTTGG + Intergenic
1141523883 16:84598945-84598967 CACAAAGGGGCTAGGGAGGGGGG + Intronic
1203001693 16_KI270728v1_random:169015-169037 CGCAAGGAGCTGAAGGAGGTGGG + Intergenic
1203133297 16_KI270728v1_random:1705421-1705443 CGCAAGGAGCTGAAGGAGGTGGG + Intergenic
1203153228 16_KI270728v1_random:1855078-1855100 CGCAAGGAGCTGAAGGAGGTGGG - Intergenic
1143905805 17:10208174-10208196 TAAAAAGGGGGGAAGGAGGCTGG + Intergenic
1144373664 17:14617690-14617712 CACCTATGGGTGAAGGAGCTGGG + Intergenic
1144384930 17:14740666-14740688 CACAGAGGTGTGATGGAGGCTGG - Intergenic
1144758023 17:17691944-17691966 CAGATAGGGGTGAGGGAGGCGGG + Intronic
1145249518 17:21289610-21289632 CACACAGGCCTGATGGAGGTGGG - Intronic
1146942857 17:36855720-36855742 CACACAGGGGTGAGGAAGGCTGG + Intergenic
1147250126 17:39148199-39148221 AAAAAAGGAGGGAAGGAGGTTGG - Intronic
1147338716 17:39741446-39741468 TGCAGAGGGGAGAAGGAGGTGGG - Intronic
1147723079 17:42550515-42550537 CACAGAGGGGCAAAGGGGGTTGG - Exonic
1147724291 17:42556741-42556763 CACAGAGGGGCAAAGGGGGTTGG - Intergenic
1148480473 17:47956813-47956835 CACAGAGGGCTGAAAGGGGTTGG + Intronic
1148492672 17:48033388-48033410 CAGAAAGGGGAGAAGGAAATAGG - Intronic
1148687940 17:49510958-49510980 GACTGTGGGGTGAAGGAGGTTGG - Intronic
1148742175 17:49899049-49899071 GAGGAAGGGGTGAAGGAAGTGGG - Intergenic
1148757136 17:49979198-49979220 CACAATGGGGTGCAGGGAGTGGG + Intergenic
1148943473 17:51236679-51236701 CAGAGAGAGGTGATGGAGGTAGG - Intronic
1149396958 17:56254913-56254935 CAGAAAGGGGTGAAAGAGCAGGG - Intronic
1149444314 17:56701785-56701807 GAGAAAGGGAGGAAGGAGGTAGG + Intergenic
1151926581 17:77202088-77202110 CACAAAGGGGAAAAAGAGCTTGG - Intronic
1152456124 17:80417212-80417234 CACAGTGGGCTGTAGGAGGTGGG - Intronic
1153272263 18:3334249-3334271 GACAGAGGGATGGAGGAGGTAGG - Intergenic
1155592311 18:27441139-27441161 CCCAAAGGGTTTATGGAGGTGGG + Intergenic
1156553602 18:38043445-38043467 CTCAAAGGGGAGAGGGAGGGAGG + Intergenic
1157486317 18:48089974-48089996 CAGAACTGGGTGAAGGAGGTGGG + Intronic
1158337970 18:56434262-56434284 AACAGAGGGGTGAAGAAGGTGGG - Intergenic
1160638819 19:107489-107511 TAAAAAGGAGGGAAGGAGGTGGG - Exonic
1161566845 19:5007134-5007156 CTCAAATGGGAGATGGAGGTTGG - Intronic
1161806032 19:6443522-6443544 TATAAAGGGGAGAAGGAGGCCGG - Intronic
1162283594 19:9720371-9720393 GAGAAGGGGGTGCAGGAGGTGGG - Intergenic
1163839255 19:19595793-19595815 TACTTGGGGGTGAAGGAGGTGGG + Intronic
1164862185 19:31570483-31570505 TCCCAAGGAGTGAAGGAGGTGGG + Intergenic
1164864436 19:31592231-31592253 TAGACAGGGGTGAAGGAGGATGG - Intergenic
1164985672 19:32646705-32646727 CACAATGGGGTGAAGGCCGTAGG - Intronic
1165929172 19:39344924-39344946 CTCAAAGGGGAGAAGGAAGAAGG - Intronic
1166316147 19:41991343-41991365 CAAGAAGGGGTGCAGGGGGTGGG + Intronic
1167499102 19:49835692-49835714 GACACAGGGGTGAGGGAGATGGG - Intronic
1167597569 19:50435564-50435586 CCCAAAGGGGTGAGGGAGCCTGG + Intronic
1168721637 19:58557822-58557844 GTCAAACGGGTGAAGTAGGTTGG - Intronic
925005173 2:437736-437758 CACAAGGAAGTGAAGGACGTTGG + Intergenic
925324674 2:3008693-3008715 CACTCAGAGCTGAAGGAGGTAGG + Intergenic
925601775 2:5615757-5615779 CATCAAGGAGTGAAGGAGATAGG - Intergenic
926721759 2:15966240-15966262 CAGAAAGAGGTGGAGGCGGTGGG + Intergenic
926749269 2:16185738-16185760 CACAAAGTGGTGAAGAAGGAAGG + Intergenic
927471974 2:23384191-23384213 CAGACAGGGGTGGAGGAGGAGGG + Intergenic
928363071 2:30681052-30681074 CACAAAGGGGTTAGGGAAGGAGG - Intergenic
929029318 2:37636038-37636060 CACAAGTGGGTGAAGGAGTGGGG - Intergenic
929810799 2:45187993-45188015 CAGGAAGGGGTGGAGCAGGTGGG - Intergenic
929858852 2:45658103-45658125 TACTAAGGGGGTAAGGAGGTAGG + Intronic
931114047 2:59145267-59145289 AACAAAGGGGTGAAGGACAGTGG - Intergenic
932411385 2:71549911-71549933 CAGAAGGTGTTGAAGGAGGTGGG + Intronic
935631954 2:105219317-105219339 CACAAAGGGCTGGAGGTAGTGGG + Intergenic
935958763 2:108403382-108403404 GAGAAGGGGGTGCAGGAGGTGGG - Intergenic
936388008 2:112047663-112047685 CACACAAGGGTGAGGGAGCTGGG - Intergenic
936521259 2:113213290-113213312 GACAAAGGGGAGAGGGAGATGGG + Intergenic
936968089 2:118146836-118146858 CAGAAAGGGGTGAAGCCAGTCGG + Intergenic
938036800 2:128041431-128041453 GAGAAGGGGGTGCAGGAGGTGGG - Intergenic
938941123 2:136170479-136170501 CAGAAAGGGGAGAAGGAGATTGG + Intergenic
938972968 2:136449048-136449070 CCCAAAGTGGTGAAGCAGGATGG + Intergenic
939028130 2:137038697-137038719 CAGAAAAGGGTCAAGGAGGCAGG + Intronic
940072818 2:149708656-149708678 CACATAGCAGAGAAGGAGGTGGG + Intergenic
940259546 2:151765802-151765824 CACAGAGTGGGGAAGGAGATGGG + Intergenic
942526467 2:176858171-176858193 CACAAATGGCTGCAGCAGGTAGG - Intergenic
944223101 2:197322259-197322281 TACAAAGGGATAAAGGAGGGAGG + Intergenic
944384993 2:199154204-199154226 CAGAAAGGAGTGAAGCAGATTGG - Intergenic
944861561 2:203819979-203820001 CACAATGGGGTGGAGAAGGCGGG + Intergenic
945039194 2:205730110-205730132 CGCAGTGGGGTGAAGGAGCTTGG - Intronic
946068465 2:217010493-217010515 CACCAAGGTTTGAAGGAGCTCGG + Intergenic
946420651 2:219562721-219562743 CACAACGGGGTCAGGGAGGACGG - Intronic
1168789805 20:568446-568468 GACAATGGGGGGAAGGGGGTGGG - Intergenic
1169261582 20:4142823-4142845 GACAACGAGGGGAAGGAGGTCGG - Intronic
1169337012 20:4764984-4765006 CACCTAGGGGTGAGGGAGTTGGG - Intergenic
1169552506 20:6715468-6715490 CACATAGTGGTGCAGAAGGTTGG - Intergenic
1169624428 20:7548103-7548125 CACCAAGATGTGAAGGAGATGGG + Intergenic
1170841127 20:19925033-19925055 CACAAAGAGGTGGGGGAGGCCGG - Intronic
1171771047 20:29323932-29323954 CATGAAGGGGTGAAGCTGGTGGG + Intergenic
1171780422 20:29411725-29411747 CATAACGGGGTGGAGGTGGTAGG - Intergenic
1171905487 20:30895632-30895654 CATGAAGGGGTGAAGCTGGTGGG - Intergenic
1172331611 20:34079633-34079655 CACAAAGGGGTGTAGCAGGATGG - Intronic
1172644867 20:36462721-36462743 CACAAAGGGGGAAAGGAGGGAGG + Intronic
1173457051 20:43211343-43211365 AATCCAGGGGTGAAGGAGGTGGG - Intergenic
1173469476 20:43311669-43311691 CACAAAAGAGAGAAGGAGGGGGG + Intergenic
1174086421 20:48011364-48011386 CACCCAGAGTTGAAGGAGGTAGG + Intergenic
1174485194 20:50856575-50856597 CACAAAAGGGACAAGGAGGCTGG - Intronic
1174533777 20:51235636-51235658 TACAAAGGGGACAAGGAGGCTGG + Intergenic
1174964685 20:55199164-55199186 AGCAAAGGGCTGAAGAAGGTAGG + Intergenic
1175169953 20:57073226-57073248 CACCCAGGGCAGAAGGAGGTGGG + Intergenic
1175227618 20:57453962-57453984 AACAAAGGGCTGGAGGTGGTGGG - Intergenic
1177159296 21:17530259-17530281 GAAAAAAGGGTGAAGGAGGCCGG - Intronic
1177207718 21:18029684-18029706 CACAAAGAGACAAAGGAGGTAGG + Intronic
1177868135 21:26537357-26537379 CATAAAGGGATGATGGAGGGAGG + Intronic
1178025696 21:28463851-28463873 CAACAATGAGTGAAGGAGGTGGG + Intergenic
1179949609 21:44702385-44702407 CACAAGGGCGTGCAGGAGCTGGG - Intronic
1180316436 22:11281752-11281774 CATGAAGGGGTGAAGCTGGTGGG + Intergenic
1181102550 22:20551105-20551127 CACAAAGGGGACAGGCAGGTTGG - Intronic
1181828386 22:25538441-25538463 CAAAAAGTGGGGAGGGAGGTAGG + Intergenic
1182747516 22:32616939-32616961 CCCAAAGGTGTGAAAGTGGTTGG + Intronic
1182933137 22:34194110-34194132 AACAGATGGGTGATGGAGGTGGG + Intergenic
1183370765 22:37430862-37430884 CACAAAGGTGTGAAGATGATGGG - Intergenic
1183467212 22:37985728-37985750 TCCAAAGGGGTGTAGGGGGTGGG + Intronic
1184733836 22:46386314-46386336 CCCCATGGGGTGAAGCAGGTGGG - Intronic
1184882119 22:47314356-47314378 CACAAAGGACAGAAGGAGGAAGG - Intergenic
1185386282 22:50532542-50532564 CACAATGGGGTCTGGGAGGTGGG - Exonic
1185401385 22:50619884-50619906 CACAAAGGAGCCAAGGAGGCTGG + Intergenic
950101117 3:10357600-10357622 CATTAAGGAGTGGAGGAGGTGGG + Intronic
950359451 3:12440239-12440261 CCCATAGAGGTGAAGGAGCTAGG + Intergenic
952069289 3:29614297-29614319 CGCAAAAGGCTGAAGGAGGGTGG + Intronic
952103600 3:30043527-30043549 TACCAAGGGGTGCAGGAGGAGGG + Intergenic
952626045 3:35404692-35404714 CACGTAGGGGTGAAGGAAGCTGG + Intergenic
952958700 3:38576521-38576543 CACAGAGGAATGGAGGAGGTGGG + Intronic
954240861 3:49292413-49292435 CACACATGGGAGAAGGGGGTTGG - Intronic
954401592 3:50322196-50322218 CTCAGAGGGGTCTAGGAGGTTGG + Exonic
954418955 3:50408461-50408483 GACAAAGGGCTGGAGGTGGTGGG + Intronic
954593064 3:51800809-51800831 CACTGAGAGGTGAAGGAGGGAGG + Intergenic
955076298 3:55616940-55616962 CACATAGGTGTGAAGGAGTTAGG + Intronic
957084657 3:75668786-75668808 CATAACGGGGTGGAGGTGGTAGG + Intergenic
959904313 3:111693801-111693823 CACAAAGGGGTGAAGGAGGTGGG - Intronic
960057206 3:113284221-113284243 CACAGAGGGTTGAAGGACGTAGG - Intronic
960833194 3:121873508-121873530 CATAAAGGGGTGAACCAGTTAGG - Intronic
962716939 3:138134529-138134551 CAGAAAGGGGTGCAGAAGGAAGG - Intergenic
964743117 3:159988168-159988190 CATGAAGGGTTGAGGGAGGTGGG - Intergenic
967136601 3:186517709-186517731 CAAAGAGGGATGGAGGAGGTTGG + Intergenic
968016754 3:195341986-195342008 CAGAAAGGGGGGAAGGTGGGAGG + Intronic
968696871 4:2034906-2034928 CACACAGGAGTGAATGAGTTGGG + Intronic
968983207 4:3861659-3861681 CAAAAAGGGGTGAAGAGGGGCGG + Intergenic
969202393 4:5616300-5616322 CAGAAAGGGCTGAAGGAAGAGGG + Intronic
969627937 4:8317148-8317170 CACCAAGGGGAGAGGGAGCTGGG + Intergenic
970195570 4:13547566-13547588 GACAAAGGTGTGGAGGAGGAGGG - Intergenic
970292843 4:14594900-14594922 CACAAAGAAGTGAAGGAGAATGG - Intergenic
972037176 4:34539618-34539640 CACAAAGAGAAGGAGGAGGTGGG - Intergenic
972423046 4:38907383-38907405 GAAAAAGGGGTCAAGAAGGTTGG - Intronic
973342268 4:49017442-49017464 CACATAAGGGTTAAGGAGATAGG - Intronic
974162936 4:58163373-58163395 CTCAGTGGGGTGAAGGAGCTGGG + Intergenic
974786149 4:66621706-66621728 CACAAAGGGGTAATAGAGGTGGG - Intergenic
975586636 4:75956494-75956516 CACAAAGGTGTGGAGGAGAAAGG + Intronic
975762845 4:77635318-77635340 CAGCAGGGGGTGAAGGAGGTGGG - Intergenic
975986266 4:80203299-80203321 CACAGCGAGGTGAAGGAGGGCGG - Exonic
976310348 4:83605608-83605630 CACAAAGGGGTGGAGGGTGAGGG - Exonic
976324782 4:83758825-83758847 CACATAGGTGTTAAGGATGTTGG - Intergenic
977407034 4:96612614-96612636 CACATAGGGATGAAAGTGGTGGG + Intergenic
977534176 4:98237795-98237817 CAGAAAAGGGTGAAGGAAGAAGG + Intergenic
978493533 4:109334260-109334282 AATAAAGGAGTGAAGGAGGAGGG + Intergenic
979084635 4:116391156-116391178 CAAAGAGAGGTGATGGAGGTGGG - Intergenic
979730733 4:124019908-124019930 CACCCAGGGGTGAGGGAGCTAGG - Intergenic
980035367 4:127877234-127877256 CACAAAGGGATGAAAGTGGCCGG + Intergenic
982426536 4:155268746-155268768 GATAAAGGGGTGGAGGAGGGTGG - Intergenic
983760968 4:171406189-171406211 CTCAAAGGAAAGAAGGAGGTAGG - Intergenic
985034370 4:185823175-185823197 CATAAAGGGGAAAAGGAGGCCGG - Intronic
986636048 5:9823560-9823582 CAGAAAGGGGGGAAAGAGGAAGG + Intergenic
987247022 5:16059487-16059509 TACAAAGGAGTGAAGGATTTAGG + Intergenic
989231845 5:39095836-39095858 CACACTGGGGTGAGGGAGGGAGG + Intergenic
989415898 5:41175164-41175186 CATAAAGTGGTGAGGGAGGAAGG + Intronic
990364811 5:55059586-55059608 AACCAAGGGGTGAAGCAGCTGGG + Intergenic
991274125 5:64823535-64823557 AACAGAGGGATGTAGGAGGTGGG - Intronic
992092305 5:73328124-73328146 GAGAAAGGGGTAAATGAGGTAGG - Intergenic
992447887 5:76850312-76850334 CACAAAGGGGTCGGGGGGGTGGG + Intronic
992831828 5:80601123-80601145 AACCAAGGGGAGAAGGAGGTGGG - Intergenic
994714574 5:103306241-103306263 TACATAGGGGTGAAGGAGGTTGG + Intergenic
995676514 5:114668510-114668532 CAGAAAGAAGTGAAGGTGGTGGG - Intergenic
996353831 5:122575263-122575285 CACAAAGGAGAGAAGGATTTGGG - Intergenic
997219384 5:132147736-132147758 TTCTGAGGGGTGAAGGAGGTGGG - Intergenic
997308804 5:132862282-132862304 CACTAAAGGTTGAAGGAGGCTGG + Exonic
998887808 5:146712700-146712722 CACAGAGTGGTGAGGGAGGAAGG - Intronic
999044917 5:148456562-148456584 AACAAAGGTGTCAAGGAGGTGGG - Intronic
1001055001 5:168441938-168441960 AACAATGGGGTGGAGGAAGTAGG + Intronic
1002590714 5:180290289-180290311 CACAGAGGTGTGAAGGAGCAGGG - Intronic
1002591726 5:180295314-180295336 CACAGCGGGGTGGAGGAGCTAGG + Intergenic
1002999657 6:2319316-2319338 CACAAGGGGTTGAATGGGGTAGG - Intergenic
1003234614 6:4284503-4284525 CACCAAGGGGTGAGGAAGCTTGG + Intergenic
1003387165 6:5679495-5679517 GACAGAGGGGTGATGGAGGAGGG - Intronic
1003687709 6:8321420-8321442 TACAATTGGGTGAAGGCGGTGGG - Intergenic
1005407160 6:25501578-25501600 CACAAAGGGCTGAAGCAGGCAGG - Intronic
1006832677 6:36978073-36978095 AAGAAAGTTGTGAAGGAGGTGGG - Exonic
1007461422 6:42021932-42021954 CATAAAGGGCTGAAGGAGGCTGG + Intronic
1007519594 6:42441323-42441345 CTCAAAGGGGGGAAGGAGGAGGG + Intronic
1007599957 6:43075569-43075591 CAGCAAGGGGTGTAGGAGGCGGG - Intergenic
1011551666 6:88536085-88536107 GAAAAATGGGTGAAAGAGGTGGG + Intergenic
1012053624 6:94375653-94375675 CAAAAAAGGTTGAAGGAGGGTGG + Intergenic
1013154495 6:107480667-107480689 CACTAGGAGGTGTAGGAGGTGGG - Intergenic
1013216433 6:108032051-108032073 CACAAGGGGTTGAATGTGGTGGG - Intergenic
1013653958 6:112225986-112226008 TACAAAGGGAGGCAGGAGGTAGG - Intronic
1016940588 6:149480067-149480089 CACAAGGGAGTGAATGAGCTAGG - Intronic
1018149462 6:160924874-160924896 CATTAAGGGGAAAAGGAGGTTGG - Intergenic
1018405106 6:163472395-163472417 CAGAAGGAGGTGATGGAGGTGGG + Intronic
1019007189 6:168808830-168808852 CACAAATGGGCTAAGGAGGGAGG + Intergenic
1019334900 7:478445-478467 GACAAAGGGAGGAAGGAGGGAGG + Intergenic
1019370209 7:659144-659166 CACAAGGTGGTGCAGGGGGTGGG - Intronic
1019506056 7:1392053-1392075 CACAAAGGTGTGAAGATGCTTGG + Intergenic
1019568058 7:1694432-1694454 CACAAAGAGCTGGAGGAGGATGG + Intronic
1020194201 7:6024695-6024717 GACAAAGGGGTGAGGGATGACGG - Exonic
1020722256 7:11761901-11761923 CCAAAAGGGGGGAAGGAGGGAGG - Intronic
1021117040 7:16755242-16755264 CACCAACAGGAGAAGGAGGTTGG + Intronic
1022183235 7:27942254-27942276 ACCACAGGGGTGAAGGAGGAAGG - Intronic
1022702953 7:32778496-32778518 CACTAAGGGAAGAAGGAGCTGGG + Intergenic
1022907187 7:34868616-34868638 CACTAAGGGAAGAAGGAGCTGGG + Intronic
1026332366 7:69363902-69363924 CAAAAAGGGATGAAGGTGATGGG - Intergenic
1027229612 7:76264602-76264624 GACAAAGGGGTGGAGTAGGATGG + Intronic
1027361363 7:77414016-77414038 CAATAAGGGGTCAAGGAGGAAGG - Intronic
1031590165 7:123581121-123581143 CGCAAAGAGCTGAAGGAGGTTGG - Intronic
1032016616 7:128384115-128384137 CACAAGGGGAGGGAGGAGGTTGG + Intergenic
1032616816 7:133481830-133481852 CAGAAAGGAGTGAAGGAGGAGGG + Intronic
1033439429 7:141365460-141365482 CTCAGAGGGGTGAAGGAGATGGG - Intronic
1033795503 7:144840726-144840748 GAAAAAGGGGTGTAGTAGGTAGG - Intergenic
1035259449 7:157652383-157652405 CTCACAGGGGAGAAGAAGGTTGG + Intronic
1035817916 8:2561375-2561397 CTCAGATGGGTGAAGAAGGTCGG - Intergenic
1036035447 8:5013543-5013565 CTCAATGGGGTCATGGAGGTGGG + Intergenic
1036433698 8:8713389-8713411 TAGCCAGGGGTGAAGGAGGTTGG - Intergenic
1036975389 8:13405291-13405313 CACAGAGGGGAGAAGGAGGGAGG - Intronic
1039270800 8:35877967-35877989 CACAAAGAAATCAAGGAGGTAGG - Intergenic
1040422358 8:47252142-47252164 CACATGGGGGTGATGGAGCTTGG + Intergenic
1042059272 8:64799166-64799188 TGTAAGGGGGTGAAGGAGGTGGG - Intergenic
1044833975 8:96278007-96278029 CAGAAAGGGGTAAAGAAGCTGGG - Intronic
1046889196 8:119402494-119402516 CTCAAGAGGGTGAATGAGGTTGG - Intergenic
1047561843 8:125994361-125994383 AACTAAGAGGTGAAGGGGGTGGG - Intergenic
1047757089 8:127927023-127927045 CAGAAAGGGGAAAAGGACGTGGG + Intergenic
1048135244 8:131741583-131741605 CACTAAGGGGTGAAGGACCAAGG - Intergenic
1048690773 8:136960670-136960692 TTCAAAGGGGAGAAGGAGGTGGG + Intergenic
1049759472 8:144325568-144325590 CATAAAGGGGGGATGGAGGGTGG + Intronic
1049797700 8:144504109-144504131 CAGAAAGGGCTGAAGGAGCTGGG - Exonic
1051870820 9:21735693-21735715 CACAAAGGGGGGCTGGGGGTTGG + Intergenic
1053445795 9:38152150-38152172 CACTAAGGGATGAATGAGGCTGG + Intergenic
1054727612 9:68667827-68667849 CACCGAGGGGTGAAGAAGCTAGG - Intergenic
1055505726 9:76946777-76946799 CAGAAAGGGATGCAGAAGGTAGG - Intergenic
1055630631 9:78220041-78220063 CCTAGAGGGGTGAAGGAGTTAGG - Intergenic
1057746110 9:97752615-97752637 CTCAAAGGTGAGAAGGGGGTGGG + Intergenic
1058425063 9:104868998-104869020 AAGAGAGGGGTGAAGGAGCTTGG + Intronic
1060359939 9:122945189-122945211 AACAGAGGGGTGAGGGTGGTTGG - Intronic
1061510422 9:131057614-131057636 CACTAAGGGGTGAGGGTGGCAGG - Intronic
1062081691 9:134627505-134627527 CACAAAGAGGAGAATGACGTTGG + Intergenic
1062542910 9:137049423-137049445 CAGACTGGGGTGAGGGAGGTGGG - Intronic
1187308491 X:18118783-18118805 CACAAAGGGGTGAGGAAGCTGGG - Intergenic
1187824210 X:23318445-23318467 CAGAGAAGGGAGAAGGAGGTTGG - Intergenic
1189223770 X:39395670-39395692 ATCTAAGGGGTGAGGGAGGTGGG + Intergenic
1189808158 X:44755572-44755594 CACAAGGGGGTGAGGGTTGTTGG - Intergenic
1190162727 X:48045527-48045549 GACAGAGAGGTGGAGGAGGTAGG + Intronic
1191226387 X:58048845-58048867 CAAACAGGGGTGTTGGAGGTGGG - Intergenic
1193248451 X:79259133-79259155 CACAAAGTGGAGGAGGAGGATGG + Intergenic
1195671154 X:107471148-107471170 CACAAGGGGCTGAAGCAGGAGGG + Intergenic
1195747575 X:108134339-108134361 CACAAATGGGTGTAGGAGAAGGG + Exonic
1196528681 X:116758149-116758171 CAAAGAGGGGTGATGAAGGTGGG - Intergenic
1197968533 X:132091463-132091485 AACAAAGACTTGAAGGAGGTGGG - Intronic
1198031359 X:132756492-132756514 AAGAAAGGGGGAAAGGAGGTGGG - Intronic
1198272058 X:135064407-135064429 CACACAGGAGTGAATGAGTTGGG - Intergenic
1200126622 X:153818299-153818321 CCCCAAGTGGTGGAGGAGGTAGG + Intronic
1200243760 X:154511810-154511832 CACAAAGGGGAGGAGCAGGGAGG + Intronic