ID: 959905161

View in Genome Browser
Species Human (GRCh38)
Location 3:111703212-111703234
Sequence GAGGGATGCAGGGATGGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 824
Summary {0: 1, 1: 0, 2: 5, 3: 88, 4: 730}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959905154_959905161 -2 Left 959905154 3:111703191-111703213 CCTGTCCTGTAAAGGGGGTTGGA 0: 1
1: 0
2: 0
3: 7
4: 92
Right 959905161 3:111703212-111703234 GAGGGATGCAGGGATGGTGCTGG 0: 1
1: 0
2: 5
3: 88
4: 730
959905157_959905161 -7 Left 959905157 3:111703196-111703218 CCTGTAAAGGGGGTTGGAGGGAT 0: 1
1: 0
2: 0
3: 13
4: 128
Right 959905161 3:111703212-111703234 GAGGGATGCAGGGATGGTGCTGG 0: 1
1: 0
2: 5
3: 88
4: 730
959905151_959905161 3 Left 959905151 3:111703186-111703208 CCTGTCCTGTCCTGTAAAGGGGG 0: 1
1: 0
2: 2
3: 7
4: 135
Right 959905161 3:111703212-111703234 GAGGGATGCAGGGATGGTGCTGG 0: 1
1: 0
2: 5
3: 88
4: 730

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959905161 Original CRISPR GAGGGATGCAGGGATGGTGC TGG Intronic
900086409 1:899918-899940 ATGGGATGCAGGGATGGGGTGGG + Intergenic
900141533 1:1141152-1141174 GATGGGGGCAGGGATGGGGCTGG - Intergenic
900290210 1:1920554-1920576 GAGTGATGCAGTGAAGGGGCAGG - Intergenic
900499031 1:2990647-2990669 GAGGCATGCAGGGACGGAGACGG + Intergenic
900693750 1:3997249-3997271 GTGGGATGGAGTGATGGTGCGGG + Intergenic
900792145 1:4687785-4687807 GATGGATGAATGGATGGAGCTGG - Intronic
900832666 1:4976419-4976441 AAGAGATGCAGGCATGGTTCGGG + Intergenic
900993133 1:6106987-6107009 GAAGGATGGAGGGATGATGGAGG + Intronic
900993168 1:6107117-6107139 GAGGGATGGAGGGATAATGTAGG + Intronic
900993179 1:6107158-6107180 GAGGGATGGAGGGAAGGTGGAGG + Intronic
900993192 1:6107195-6107217 GAGGGATGGAGGGATGATGGAGG + Intronic
900993198 1:6107214-6107236 GAGGGATGGAGGGATGATGGAGG + Intronic
900993203 1:6107233-6107255 GAGGGATGGAGGGATAATGAAGG + Intronic
900993210 1:6107263-6107285 GAGAGATGGAGGGATGATGGTGG + Intronic
900993227 1:6107339-6107361 GAGGGATGGAGGGATAATGAAGG + Intronic
900993233 1:6107369-6107391 GAGAGATGGAGGGATGATGGAGG + Intronic
900993246 1:6107412-6107434 GAGGGATGGAGGGATGATGGAGG + Intronic
900993259 1:6107461-6107483 GAGGGATGGAGGGATGATGAAGG + Intronic
900993277 1:6107534-6107556 GAGGGATGGAGGGATAATGAAGG + Intronic
900993284 1:6107572-6107594 AAGGGATGTAGGGATGATGAAGG + Intronic
900993312 1:6107705-6107727 GAGAGATGGAGGGATGATGGAGG + Intronic
900993322 1:6107749-6107771 GAGAGATGGAGGGATGATGGAGG + Intronic
900993338 1:6107817-6107839 GAGGGATGGAGGGATGATGAAGG + Intronic
900993347 1:6107854-6107876 GAGGGATGGAGGGATGATGGAGG + Intronic
900993390 1:6108000-6108022 GAGGGATGAAGGGACGGTGGAGG + Intronic
900993414 1:6108077-6108099 GAGAGATGGAGGGATGATGGAGG + Intronic
900993428 1:6108134-6108156 GAGGGATGGAGGAATGATGGAGG + Intronic
900993562 1:6108699-6108721 GAGGAATGGAGGGATGATGAAGG + Intronic
900993609 1:6108874-6108896 GAGGCATGGAGGGATGATGGAGG + Intronic
901700005 1:11040172-11040194 GAAGGATGGATGGATGGGGCTGG + Intronic
901728581 1:11261969-11261991 GGGGGAAACAGGGATGGGGCTGG + Intronic
902433977 1:16385193-16385215 GAGGGATGCTGTGATGGAGTAGG + Intronic
902612989 1:17608033-17608055 GAGGGAGGGAGGGAGGGAGCTGG + Intronic
902716747 1:18278154-18278176 GAGGGATGAATGGAGGGTGGGGG + Intronic
903026552 1:20433666-20433688 GAGGGAGGGAGGGAGGGTGGGGG + Intergenic
903034696 1:20486167-20486189 GAGGGAGGCAGGGATAGAGGAGG + Exonic
903370337 1:22831196-22831218 GGCGGCTGCAGGGATGGTGATGG + Intronic
903707178 1:25294897-25294919 GAGGGCTGCAGGGGTGCAGCGGG + Intronic
903720061 1:25398445-25398467 GAGGGCTGCAGGGGTGCAGCGGG - Intronic
903858953 1:26353883-26353905 GAGGAAGGCAGGGTTGGAGCAGG + Intronic
904037678 1:27567583-27567605 AAGGGAGGCAGGGATTATGCTGG - Intronic
904593172 1:31626656-31626678 GAGGGAGGGAGGGATAGAGCTGG - Intronic
904599518 1:31665834-31665856 CAGGGAGGCAGGGAAGGAGCTGG - Intronic
904653638 1:32025699-32025721 GAGGGAAGAAGGGAGGGGGCAGG - Intronic
905024309 1:34839395-34839417 GGGGTTTGCAGGGATGGTCCCGG - Intronic
905244898 1:36605937-36605959 GAGGGAGGCAGAGATGGGGCAGG + Intergenic
905530586 1:38675559-38675581 GAGGGACACCAGGATGGTGCAGG - Intergenic
905868753 1:41391165-41391187 CAGGGTGGCAGGGATGGAGCAGG + Intergenic
906535062 1:46546918-46546940 GACAGAAGCAGGGAGGGTGCTGG + Intronic
906637819 1:47421384-47421406 TAGGGAAGCAGGGAAGGTGGTGG + Intergenic
907385131 1:54121211-54121233 CAGGGAGGCAGGGATTGTGCGGG + Intergenic
907403439 1:54239642-54239664 GGGAGAGGCAGGGATGGGGCTGG + Intronic
907720067 1:56963627-56963649 GAAGGATGCAGAGAGAGTGCAGG + Intronic
908712708 1:67034985-67035007 TAGGGATGCAAGGATGGTTCAGG - Intronic
910288488 1:85578823-85578845 GAGGGGTGCAGGGACAGTACTGG - Intergenic
910291665 1:85605815-85605837 CAGGGCTGCAGGGATTGGGCTGG + Intergenic
911122420 1:94309663-94309685 GAGGGAGGGATGGATGATGCAGG + Intergenic
912497255 1:110099671-110099693 GAGGGAGGGAGGGAGGGGGCCGG + Intergenic
912529124 1:110307395-110307417 GAGGTATGCAGGGATGGCCAAGG - Intergenic
913185024 1:116363055-116363077 TAGGGATGCAGGGAAGCTGGAGG - Intergenic
914024887 1:143903915-143903937 GAGGGATGGAGGGAAGGAGGCGG - Intergenic
914663316 1:149811635-149811657 GAGGGATGGAGGGAAGGAGGCGG - Intronic
914752951 1:150548473-150548495 GAGGGATGCAGGGTTGGGGGAGG - Intergenic
914913678 1:151805316-151805338 GAGGCACACAGGGAAGGTGCAGG - Exonic
915133689 1:153714436-153714458 GAGGGAGGGAGGGAGGGAGCCGG - Intergenic
915283940 1:154841085-154841107 TAGGGCTGCAGAGATGGTGAGGG + Intronic
915515072 1:156407971-156407993 GAAGGCTGCAGGGAGGGAGCAGG + Exonic
915702271 1:157807224-157807246 GAGAGATGCAGGGAGGGTCCAGG - Intronic
916070245 1:161165840-161165862 GAAGGTTTCGGGGATGGTGCTGG + Intergenic
916504993 1:165420671-165420693 GGGAGATACAGGGATGGTGATGG - Intronic
917149893 1:171932048-171932070 GAGGAATGGAGGGAGGGTGGGGG - Intronic
917189587 1:172400417-172400439 GAGGGAAGGAGGGAAGGGGCAGG + Intronic
917189597 1:172400444-172400466 GAGGGAAGGAGGGAAGGGGCAGG + Intronic
917234626 1:172877776-172877798 GAGGGATGGGGGGAGGGTGGAGG - Intergenic
917470632 1:175323221-175323243 GAAGGAAGCAGGGATGTCGCAGG - Exonic
917536923 1:175881078-175881100 GAGGGAGGCATGGCTGGTGTGGG + Intergenic
917738777 1:177943907-177943929 CATGGAGGAAGGGATGGTGCTGG + Intronic
919674519 1:200367981-200368003 GAGGGAAGTAGGCAGGGTGCAGG + Intergenic
919712061 1:200738816-200738838 GAGGGAAGCGGGGAGGGGGCGGG + Intergenic
919787665 1:201270115-201270137 CAGGGATTCAGTGATGGGGCAGG + Intergenic
919935155 1:202246159-202246181 GAGGGATGGAGGGATGGGGGAGG - Intronic
919935201 1:202246280-202246302 GAGGGATGGAGGGATGGGGGAGG - Intronic
920084965 1:203408695-203408717 GAGGGAAGAAGGGATGGGGAGGG + Intergenic
920501961 1:206491169-206491191 GGGGGAGGCAGGGAAGGTTCAGG - Exonic
920970061 1:210735462-210735484 GTGTGATGCTGGGATGGGGCGGG + Intronic
922818819 1:228470420-228470442 GAGGGGTGCAGGGGGAGTGCAGG + Intergenic
923204850 1:231749164-231749186 GAGTGTTGAAGGGAGGGTGCTGG - Intronic
923328990 1:232905292-232905314 GAGGCATGCAGGGGTTGTGTGGG - Intergenic
924179171 1:241424130-241424152 GGGGGCTGCAGTGATGGGGCCGG + Intergenic
924536074 1:244937077-244937099 GAGGGATGGAGGGATTGGGAGGG + Intergenic
924536081 1:244937095-244937117 GAGGGATGGAGGGATTGGGAGGG + Intergenic
924536088 1:244937113-244937135 GAGGGATGGAGGGATTGGGAGGG + Intergenic
924536093 1:244937131-244937153 GAGGGATGGAGGGATTGTGAGGG + Intergenic
924536100 1:244937149-244937171 GAGGGATGGAGGGATTGGGAGGG + Intergenic
924536107 1:244937167-244937189 GAGGGATGGAGGGATTGGGAGGG + Intergenic
924536114 1:244937185-244937207 GAGGGATGGAGGGATTGTGGGGG + Intergenic
924536121 1:244937203-244937225 GGGGGATGGAGGGATTGTGGGGG + Intergenic
924626144 1:245698129-245698151 GAGGTGTCCAGGGATAGTGCTGG - Exonic
1062791216 10:307792-307814 GAGGGCAGCAGGGAGGGTTCAGG + Intronic
1062791236 10:307850-307872 GAGGGCAGCAGGGAGGGTTCAGG + Intronic
1062791299 10:308024-308046 GAGGGCAGCAGGGAGGGTTCAGG + Intronic
1063127182 10:3145576-3145598 GAGGTATGCACTGGTGGTGCTGG - Exonic
1063161334 10:3420970-3420992 GAGGGATGCAGGTAGGATGCAGG + Intergenic
1063161340 10:3420992-3421014 GTGGGACGCAGGTATGGTGCGGG + Intergenic
1063287847 10:4709652-4709674 GAGGGTCCCAGGGATGGTGGGGG - Intergenic
1063490673 10:6460820-6460842 GATGGATGGATGGATGGTGATGG - Intronic
1063838637 10:10045474-10045496 GATGGATGCCGGCATGGTGGGGG - Intergenic
1063961005 10:11305365-11305387 GAGGGATGCAGGATGGGCGCCGG - Intronic
1064526435 10:16260824-16260846 GAGGGAGGCAGGGAGGGAGATGG + Intergenic
1065478810 10:26171497-26171519 GAGGGATTCAGGGAATGTGTGGG - Intronic
1065853878 10:29814183-29814205 CTGGGAGGCAGAGATGGTGCCGG - Intergenic
1065867753 10:29928392-29928414 GAGGGAGGCAGGGAGGGAGGGGG + Intergenic
1067147015 10:43701416-43701438 AAGGGGTTCAGGGATAGTGCAGG - Intergenic
1067463262 10:46474105-46474127 GTGGGAGGCAGGGAAGGTGTTGG - Intergenic
1067623932 10:47910533-47910555 GTGGGAGGCAGGGAAGGTGTTGG + Intergenic
1067661027 10:48236327-48236349 GTGGGAGGCAGTGATGGTTCTGG + Intronic
1067776936 10:49170827-49170849 GCAGGATGCAGGGGTGGGGCCGG - Intronic
1069622344 10:69845658-69845680 GAGGGATGCAGGGACCTTGTGGG - Intronic
1069838129 10:71322138-71322160 GAGGGAAACTGGGATGGTGGGGG - Intronic
1069903703 10:71720151-71720173 GAGGGGAGCAGGGAGAGTGCTGG + Intronic
1070867259 10:79713873-79713895 GAGGGAACCAGGGTGGGTGCCGG - Intronic
1070881051 10:79851997-79852019 GAGGGAACCAGGGTGGGTGCCGG - Intergenic
1070963320 10:80514464-80514486 GAGGGAGGCAGGCCTGGGGCAGG + Intronic
1071204615 10:83259777-83259799 GAGGGAGGCAGGGGTGCTACTGG - Intergenic
1071334189 10:84588353-84588375 GGGGGCTGCAGGGAAGGTGTGGG - Intergenic
1071529387 10:86377316-86377338 GAGGGACGCAGCGAGGGCGCAGG + Intergenic
1071634172 10:87236096-87236118 GAGGGAACCAGGGTGGGTGCCGG - Intronic
1071647622 10:87368313-87368335 GAGGGAACCAGGGTGGGTGCCGG - Intronic
1072631793 10:97151453-97151475 GGGGGATGGAGGGATGGGTCAGG + Intronic
1072895768 10:99365235-99365257 GGGGGATGCAGGGGTTGTGAGGG + Intronic
1073111340 10:101064670-101064692 GGGGGTTGGGGGGATGGTGCTGG + Intronic
1073231481 10:101974768-101974790 GAGAGATGGAGGGATGGGGACGG - Intronic
1073304530 10:102492586-102492608 GAGGGAAGCAGGCATGTTGCTGG - Intronic
1073459462 10:103658307-103658329 CAGGGAGGTGGGGATGGTGCTGG + Intronic
1073571406 10:104583686-104583708 TGGGGATGCAGGCATGGAGCTGG + Intergenic
1073730369 10:106280577-106280599 AGGGGAGGCAGGTATGGTGCTGG + Intergenic
1074921677 10:118020592-118020614 GAGCGGTGCTGGGATGGGGCTGG - Intronic
1075574686 10:123570042-123570064 GGAGGATGCAGGGAGGGAGCTGG - Intergenic
1075936110 10:126342899-126342921 GAGGGCTGGAGGGAGGGTGGAGG + Intronic
1076102905 10:127797421-127797443 GAGGGATGGAGGGAGAGTGTGGG - Intergenic
1076102928 10:127797492-127797514 GAGGGATGAATGGAGGGTGGGGG - Intergenic
1076102961 10:127797600-127797622 GAGGGATGGATGGAGGGTGTGGG - Intergenic
1076102978 10:127797654-127797676 GAGGGATGGAGGGAGGGTGCAGG - Intergenic
1076103012 10:127797780-127797802 GCGGGATGGAGGGAGGGTGGGGG - Intergenic
1076103021 10:127797798-127797820 GAGGGATGAGGGGAGGCTGCGGG - Intergenic
1076358305 10:129868751-129868773 GAGGGCTGCAGGCCTGGTGGAGG + Intronic
1076825141 10:132963444-132963466 GATGGATGGAGGGATGTTGATGG - Intergenic
1077140118 11:1020581-1020603 GTGGGAAGCAGGGAGGGGGCAGG - Intronic
1077225354 11:1437024-1437046 GAGGGCTGCCTGGATGGGGCTGG + Intronic
1077272214 11:1686717-1686739 GAGGGAGGCAGGGAAGGAGGGGG - Intergenic
1077327726 11:1970945-1970967 GAGGGTGGCAGGGGTGGGGCAGG + Intronic
1077347758 11:2072000-2072022 GAGCGAGGCAGGGCTGATGCAGG - Intergenic
1077394674 11:2315173-2315195 GAGGGGAGCAGGGAGGGGGCAGG - Intronic
1077560500 11:3257450-3257472 GCGGGATGCAGGTAGGATGCAGG - Intergenic
1077560507 11:3257483-3257505 GTGGGATGCAGGTAGGATGCAGG - Intergenic
1077566393 11:3303256-3303278 GCGGGATGCAGGTAGGATGCAGG - Intergenic
1077566400 11:3303289-3303311 GTGGGATGCAGGTAGGATGCAGG - Intergenic
1077566422 11:3303388-3303410 GTGGGATGCAGGTAGGATGCAGG - Intergenic
1078901461 11:15646589-15646611 GAGGGAGGGAGGGATGGAGAGGG + Intergenic
1079351729 11:19697604-19697626 GAGGGAGGCAAGGATGGGGCAGG + Intronic
1081600384 11:44488602-44488624 GAGGGAGGGAGGGAGGGAGCGGG - Intergenic
1082171658 11:49012375-49012397 GCGGAATGCAGAGATGGAGCAGG + Intergenic
1083148533 11:60775801-60775823 GAGGGCAGCTGGGATGGGGCTGG - Exonic
1083616094 11:64027372-64027394 AGGGGCTGCAGGGATGGTGGTGG + Intronic
1083899846 11:65638298-65638320 GAGGGAAGTTGGGAGGGTGCTGG - Intronic
1083962254 11:66021014-66021036 GCGGGGAGCAGGGATGGGGCAGG - Intronic
1083994227 11:66264256-66264278 GAGGGAGGCAGGGATGAGGTTGG + Intronic
1084263212 11:67991749-67991771 GCGGGATGCGGGGCTGGCGCGGG + Exonic
1084313952 11:68332797-68332819 GACGGATGGAGGGATGTTGGGGG + Intronic
1084334053 11:68446650-68446672 GAGGGAGGCAGGGCTGGGCCCGG - Intronic
1084378990 11:68798654-68798676 GGTGGATGCAGGGATGGTGTGGG - Intronic
1084396817 11:68916531-68916553 GATGGCAGCAGGGAGGGTGCTGG + Intronic
1084453743 11:69255240-69255262 GAGGGATGAAGGGAGGGTGGAGG + Intergenic
1084484336 11:69439116-69439138 CAGGGATGCAGAGGTGGTCCTGG - Intergenic
1084892909 11:72245170-72245192 GAGGGGCCCAGGGATGATGCTGG + Intronic
1084939915 11:72607022-72607044 GAGGGAAGCAGAGATGGGGAGGG - Intronic
1084941344 11:72615001-72615023 GAGGGATGGGGGCATGGAGCGGG - Intronic
1085188151 11:74593538-74593560 GAGGGATGAAGGCTTGATGCTGG + Intronic
1085406835 11:76268537-76268559 GATGGATGGATGGATGGTGGAGG - Intergenic
1085446355 11:76603642-76603664 GAGGGATGGAGGGAGGGAGGTGG + Intergenic
1085843753 11:80042616-80042638 GAGGGATCCAGGGACAGTGTGGG - Intergenic
1086319382 11:85628643-85628665 AAGGGATTCAGGTGTGGTGCCGG + Exonic
1086330892 11:85753064-85753086 GGGGGATGCAGTGCTGGTGGTGG + Intronic
1086369080 11:86138749-86138771 GAGGAATTCAGGAATGGGGCTGG + Intergenic
1086581344 11:88403070-88403092 TAAGGATGCAGGGATGGAGATGG + Intergenic
1086993557 11:93331134-93331156 GAGAGGAGCAGGGATGGTGAAGG - Intronic
1087660618 11:100983523-100983545 CAGGGATGCGGGGATGGTAGGGG + Intronic
1089078566 11:115758699-115758721 GAGGCAAGGAGGGATGGTGGGGG + Intergenic
1089183443 11:116598687-116598709 GAGGAAGGCTGGGCTGGTGCTGG - Intergenic
1089432907 11:118437314-118437336 GAGGGAGGCGGGGATGTGGCGGG - Intronic
1089453608 11:118612983-118613005 GAGGGATGCATGGTGGGTGAGGG + Intronic
1089660825 11:119983959-119983981 GCGGGAGGCAGGGATGGAGGAGG - Intergenic
1090258776 11:125304013-125304035 TAGGAATGCAGGGATGTTGTTGG + Intronic
1090331801 11:125938662-125938684 TAGGGATGCAGGGCTGGGGTGGG - Intergenic
1090727997 11:129544870-129544892 GTGGAATGAAGGGATGGTGATGG + Intergenic
1090912621 11:131134769-131134791 GTGGGGTACAGGGATGGAGCTGG - Intergenic
1202810708 11_KI270721v1_random:26125-26147 GAGGGTGGCAGGGGTGGGGCAGG + Intergenic
1091823821 12:3494582-3494604 GAGAGATGCAGTGATGGAGGTGG + Intronic
1091859350 12:3765448-3765470 GAGGAAAGCAAGGATGCTGCAGG + Intergenic
1091874949 12:3925917-3925939 GAGGGAGGCAGCCATGGGGCGGG - Intergenic
1091949587 12:4581734-4581756 GAGAGAGGCAGGGAGGGAGCAGG - Intronic
1092145792 12:6213826-6213848 GAGGGAGGGAGGGAAGATGCTGG - Intronic
1092238237 12:6822709-6822731 GAGGGAGGGAGGGAGGGAGCAGG - Intronic
1093183996 12:15999088-15999110 GAGGGATGGAGGGTTGGTGAGGG + Intronic
1093365826 12:18297139-18297161 GAGAGATGCAGGGACGGTCTAGG - Intronic
1093430577 12:19080684-19080706 TGGGCATGCAGTGATGGTGCTGG - Intergenic
1093946227 12:25113061-25113083 CAGGGCTGCTGGAATGGTGCAGG + Intronic
1095954683 12:47799339-47799361 GAGGGATGAAGGGAGGGAGAAGG - Intronic
1096840862 12:54378726-54378748 GAGGGATGCTGGGAAGGGGCTGG + Intronic
1096871323 12:54594158-54594180 GAGGGATGCAAGGTTTGGGCTGG - Intergenic
1097173096 12:57128416-57128438 GAGGGAGGGAGGGAAGGGGCGGG - Intronic
1097261949 12:57725401-57725423 GAGGGAGGCAGGGCTGGGCCAGG + Intronic
1098263877 12:68699009-68699031 GAGGGAGGCTGGGATTGTGTGGG + Intronic
1098721421 12:73903714-73903736 GTGGGGTGCAGGGATGGGGGAGG - Intergenic
1098919171 12:76287134-76287156 GAGGGAGGGAGGGATGGAGGAGG + Intergenic
1099229018 12:80001700-80001722 GAGGTATGCAGGGATTCTACAGG + Intergenic
1099385272 12:82006163-82006185 GAGGGAGGGAGGGAGGGAGCAGG + Intergenic
1100786267 12:98081761-98081783 ATGGGAAGCAGGGATGGAGCAGG + Intergenic
1100811134 12:98339489-98339511 GAGGTGTGCAGGGTTGGTGGAGG - Intergenic
1101817742 12:108158694-108158716 GAGGGATGTAGGGCTGGGACAGG - Intronic
1101848962 12:108387220-108387242 GTGGGAGGCAGGGGTGGGGCAGG - Intergenic
1101877086 12:108603224-108603246 TAGGGAGGCAGGGAGGGTGAGGG + Intergenic
1102262337 12:111451039-111451061 GATGAAGGAAGGGATGGTGCCGG - Exonic
1102528421 12:113528635-113528657 GAGGGAAACAGGGAGGGGGCAGG - Intergenic
1102701566 12:114843811-114843833 AGGGGATGTAGGGATGGGGCAGG + Intergenic
1103164329 12:118757176-118757198 GAGGGAAGGAGGGATGGGGTAGG + Intergenic
1103165491 12:118766894-118766916 GAGGGGTGGAGGTAGGGTGCTGG + Intergenic
1103602207 12:122061555-122061577 GAGGGGTGCAGGGTGGGTGGGGG - Exonic
1104006776 12:124898551-124898573 GAGGGGTGCAGGGACGGTGTGGG + Intergenic
1104047671 12:125174525-125174547 CAGGGATGCAGGAATAGGGCAGG - Intergenic
1104203513 12:126614881-126614903 AAGGGGTGCAGGGGTGGTGGAGG + Intergenic
1104579562 12:130000734-130000756 GAGTGATGCATGGGTGGTGGGGG + Intergenic
1104667689 12:130658989-130659011 GAGGGAGGCTGGCATGGTGGAGG - Intronic
1104766056 12:131331052-131331074 GATGGATGGATGGATGCTGCTGG - Intergenic
1104807136 12:131596827-131596849 GAGGGGTGAAGGGCTGGGGCAGG - Intergenic
1104932571 12:132347580-132347602 GAGTCATGCAGGGAGCGTGCAGG + Intergenic
1104970627 12:132529140-132529162 GGGGGCTGCAGGGATGGGGTGGG - Intronic
1105068684 12:133220703-133220725 GAGGGATGGAGGACTGGGGCAGG - Intronic
1106557113 13:30819141-30819163 GAGTGAGGCAGGGATGGCACAGG - Intergenic
1107072430 13:36285834-36285856 GAGGCATGCAGGAGTTGTGCTGG - Intronic
1107817307 13:44255682-44255704 GGGGGATGGTGGGATGGTGCAGG - Intergenic
1108387690 13:49916204-49916226 GAGGAATGCAGCTGTGGTGCGGG + Intronic
1108680586 13:52776944-52776966 GAGGAATGCAGGGATGTCTCAGG + Intergenic
1109273844 13:60282992-60283014 GAGGGATGGAGGGACGGAGAAGG - Intergenic
1112494924 13:99896604-99896626 GAGGGACGCAGGGACGATCCCGG + Exonic
1113105977 13:106771951-106771973 GCTGGGTGCAGGGATGGTGAAGG - Intergenic
1113263833 13:108594431-108594453 GAGGGAAGCAGGCATTGTGAAGG - Intergenic
1113676351 13:112210038-112210060 GTGGGGTGCAGGCATGGGGCAGG + Intergenic
1113965873 13:114153551-114153573 GAGTGATGCAGTGATGGAGATGG - Intergenic
1113966088 13:114154912-114154934 GGGGGATGCAGGGGTGGGGATGG + Intergenic
1114045452 14:18871650-18871672 GAGGGAAGGAGGGAGGGTGGAGG + Intergenic
1114118760 14:19647818-19647840 GAGGGAAGGAGGGAGGGTGGAGG - Intergenic
1114270819 14:21098674-21098696 GAGGGAGGAAGGGAGGGAGCGGG + Intronic
1117290944 14:54332116-54332138 GGGGAATGAAGGGATGGTGTGGG - Intergenic
1117342848 14:54806632-54806654 AAGGGGCGCAGGGAAGGTGCGGG - Intergenic
1117799141 14:59425718-59425740 GAGGGAAGCAGTGAGGTTGCAGG + Intergenic
1118130857 14:62961735-62961757 GATGGATACAGGGATGGGGATGG + Intronic
1118796957 14:69152710-69152732 GGGGGAGGCTGGGAGGGTGCGGG + Intronic
1118869321 14:69727950-69727972 AAGGGCTGCAGGAATGATGCAGG + Intronic
1119377464 14:74206377-74206399 GAGGGAGGCAGGGAGGGGGGAGG - Intergenic
1120077322 14:80173307-80173329 GAAGGAAGCAGGCATGGTGTGGG + Intergenic
1120613105 14:86666945-86666967 CAGGTGTGCAGGGATGGTGGGGG - Intergenic
1120642635 14:87033496-87033518 GAGGCATGCAGGAGTGGTGCTGG + Intergenic
1121340216 14:93100501-93100523 CAGGGAAGCAGGGAGGGGGCCGG + Intronic
1121739970 14:96244807-96244829 GATGGATGCATGGATGGAGGAGG - Intronic
1121844371 14:97159987-97160009 GAGGAACACAGGGATGGGGCTGG + Intergenic
1121925888 14:97926971-97926993 GGGGGAGGCAGGGATGGGTCAGG + Intronic
1122292642 14:100687866-100687888 GAGGGATGGAGAGATGATGACGG - Intergenic
1122292647 14:100687894-100687916 GAGGGATGGAGAGATGATGACGG - Intergenic
1122292658 14:100687950-100687972 GAGGGATGGAGAGATGATGACGG - Intergenic
1122292663 14:100687978-100688000 GAGGGATGGAGAGATGATGACGG - Intergenic
1122394515 14:101413988-101414010 GAGGAATGCAGGGATGCCACTGG - Intergenic
1122421621 14:101581510-101581532 GGGGGCTGCAGGGATGTAGCAGG - Intergenic
1122987271 14:105218296-105218318 GGGGGCAGCAGGGGTGGTGCAGG - Intronic
1124653445 15:31489046-31489068 GAGGGCTGCAGGGCTGGCTCAGG + Intronic
1124721653 15:32115788-32115810 GAGAGAGGAAGGGAGGGTGCAGG + Intronic
1124916299 15:33978022-33978044 GAGGGATGGAAGGATGGAGGAGG + Intronic
1125684237 15:41554103-41554125 AAGGGATGGGGGGATGGGGCAGG - Intergenic
1126675670 15:51157756-51157778 GTGGGAGGCAGGGCTGGGGCTGG + Intergenic
1127097828 15:55531060-55531082 AAGGCATGCAGGAATGGTGCTGG + Intergenic
1127508638 15:59618940-59618962 GAGCAATGCAGAGATGGTCCAGG + Exonic
1128548236 15:68581386-68581408 GAGGGATGCAGGAAAGGCACTGG + Intronic
1128627257 15:69222321-69222343 GTGGGAGGCAGGGGTGGTGGAGG + Intronic
1128707960 15:69851257-69851279 AGGGGATGCAGCGATGGTGAAGG - Intergenic
1128716767 15:69914297-69914319 GAGGGCTGCAGGGCAGGAGCAGG - Intergenic
1129606097 15:77025701-77025723 GAGGGCGGCAGGGGTGGTGGTGG + Intronic
1129642245 15:77392897-77392919 GAGGGAGGAGGGGATGGTGTCGG - Intronic
1129923356 15:79339611-79339633 GAGGGTGGCAGTGATGGTGGCGG + Intronic
1130541947 15:84826789-84826811 GTGGTATCCAGGGATGGAGCAGG + Intronic
1130744610 15:86637679-86637701 GAGGGTGGCAGGGGTGGTGGTGG + Intronic
1131493458 15:92882659-92882681 GCGGGAGGCGGGGATGGTGGGGG + Intergenic
1131866939 15:96721384-96721406 GTGGGAGGCAGGGATGGAGAGGG + Intergenic
1131899376 15:97071177-97071199 GAAGGATGCAGGTACTGTGCAGG - Intergenic
1132501504 16:286483-286505 GAGGGAGGCAGGGGTGGTGTGGG + Intronic
1132746799 16:1439571-1439593 ATGAGATGCAGGGATGGGGCCGG - Intronic
1132802478 16:1761189-1761211 GAAGGAGGCAGGGAGGGTGAGGG - Intronic
1132858384 16:2057767-2057789 GAGAGATGCAGGGCTGAGGCAGG - Intronic
1132858484 16:2058088-2058110 GAGAGATGCAGGGCTGAGGCAGG - Intronic
1133028452 16:2998614-2998636 GAGGGATGTAGGGATCTGGCAGG - Intergenic
1133038172 16:3046231-3046253 GCGGGATACAGGGATGGGGAGGG + Intergenic
1133749502 16:8713570-8713592 GAGGGACGGAGGGAAGGTGAAGG - Exonic
1133982590 16:10644543-10644565 GAGGGGTGCAGTGATGGAGGTGG - Intronic
1134040879 16:11067406-11067428 GAGGGCTGCAGGGGGGGTGTGGG + Intronic
1135046902 16:19163361-19163383 GAGAGATGCAGGTGTGCTGCAGG - Intronic
1135433601 16:22408813-22408835 GAGGGAGGCAGGAATGGGGAAGG + Intronic
1135979673 16:27138207-27138229 GGAGGATCCAGGGATGATGCTGG + Intergenic
1136089298 16:27906922-27906944 GAGGGATGCTGGGCTGGCCCAGG - Intronic
1136173490 16:28502431-28502453 GAGGTATGATGGGATGGTGGAGG - Intronic
1136243953 16:28962581-28962603 GAGAGCTTCAGGAATGGTGCTGG - Intronic
1136279118 16:29197723-29197745 GCTGGATGCAGGGATGGTAGAGG + Intergenic
1137013735 16:35351194-35351216 AAGGGATGAAGGAATGGTGAGGG + Intergenic
1139341282 16:66269797-66269819 GAGGGAGGGAGGGAGGGGGCTGG + Intergenic
1139396977 16:66648060-66648082 AAAGGATGCGGGGAAGGTGCTGG - Intronic
1139530056 16:67538341-67538363 GCGGGATCCAGGGCTGGCGCAGG - Intronic
1140191263 16:72819206-72819228 GAGGGAGGGAGGGAGGGAGCCGG - Intronic
1140910666 16:79448880-79448902 GGGGGAGGCAGGGATGGTTTGGG + Intergenic
1141011441 16:80404084-80404106 GAGGAATTCAGGCATGGTGTGGG - Intergenic
1141028557 16:80569477-80569499 CAGGGATGGAGGGATGATGCTGG + Intergenic
1141056721 16:80823256-80823278 GTGGGAGGAAGGGATGGTGTTGG - Intergenic
1141115134 16:81302032-81302054 GATGGATGGATGGATGGAGCTGG - Intergenic
1141205716 16:81931821-81931843 GAGAGAGGCAGGGATAGTGGAGG + Intronic
1141421926 16:83923090-83923112 GAGGGAAGGAGGGATGGAGAGGG - Exonic
1141433065 16:83980894-83980916 TGGGGATGCTGGGATGGGGCTGG + Intronic
1141592449 16:85077700-85077722 GGGGGCAGCAGGGAGGGTGCGGG + Intronic
1141763737 16:86045384-86045406 GAGGGCTGCATGGCTTGTGCTGG + Intergenic
1142359336 16:89619221-89619243 GGGGGCTGCAGGGAGGGAGCAGG - Intronic
1142628580 17:1208420-1208442 GTGGCATGCAGTGATGGTGTGGG - Intronic
1142742941 17:1941431-1941453 GAGGGCTCCAGGCTTGGTGCAGG + Intronic
1143152277 17:4815076-4815098 GAAGGATGCATGGATGATGCAGG + Intronic
1143312434 17:6003077-6003099 GAGGGGTGCAGGGAGAGTCCAGG + Intronic
1143836965 17:9700436-9700458 GAGGAATGGAGTGATGGTGGTGG + Intronic
1144282962 17:13745102-13745124 GAGGGAAGAAGGGATGGGGCTGG - Intergenic
1144771704 17:17763130-17763152 GGGGGATGCAGGGAAGGATCTGG - Intronic
1144871022 17:18371009-18371031 GAGGGAGGGAGGGAGGGAGCCGG + Intergenic
1144891100 17:18494797-18494819 GAGGGGTGAAGGGTTGGTGCAGG - Exonic
1145049494 17:19648549-19648571 TAGGGATGGAGGGAAGGTGTTGG - Intronic
1145141123 17:20449521-20449543 GAGGGGTGAAGGGTTGGTGCAGG + Intronic
1146126791 17:30237134-30237156 GAGGGGTGCAGGGGGGATGCCGG + Intergenic
1146173626 17:30650944-30650966 GAGGGATGCTGGGCTGGACCAGG - Intergenic
1146280290 17:31540248-31540270 GCGGGGTGCAGGGGAGGTGCTGG + Intergenic
1146347079 17:32066965-32066987 GAGGGATGCTGGGCTGGACCAGG - Intergenic
1146381833 17:32336085-32336107 GAGAGAGGAAGGGATAGTGCAGG - Intronic
1147215827 17:38898537-38898559 GAGGGCAGCAGGGATGCCGCAGG - Intronic
1147418348 17:40309477-40309499 GAGAAATGCAGGAAGGGTGCTGG - Intronic
1147518137 17:41141684-41141706 GAGACATGCAGGGGTGGTGCAGG - Intergenic
1148755673 17:49971849-49971871 GAGGGATGCGGGGGAGGTGACGG + Intronic
1149352653 17:55807055-55807077 GAGGGAGACAGTGATGGTGATGG + Intronic
1149607502 17:57935570-57935592 GAGGGCAGCGGGGATGGGGCGGG - Intronic
1150502771 17:65667051-65667073 GAAGTATGCAGGGAGGGTGGAGG + Intronic
1151523739 17:74649272-74649294 AAGTGATGCAGGGGTGGTCCTGG - Intergenic
1151524267 17:74653234-74653256 GTGGGATGTAGGGGTGGTGGTGG - Intergenic
1151582038 17:74985505-74985527 GAGGGAAGCAGGGTTGGTGGGGG - Intergenic
1152374887 17:79913869-79913891 GAAGGAGGCAGGGAGGGGGCTGG + Intergenic
1152553270 17:81040353-81040375 CAGGCAGGCGGGGATGGTGCTGG + Intronic
1152693273 17:81731344-81731366 GAGGGATGCGGGAAGGGGGCGGG + Intergenic
1152773971 17:82188367-82188389 GAAGGATGCAGTGCTGGTGGCGG - Exonic
1152821802 17:82441298-82441320 GAGGGGGGCAGGCATGGGGCGGG + Intronic
1153666319 18:7370224-7370246 CAGGGAGGAAGGGATGGTGGGGG - Intergenic
1154139122 18:11807769-11807791 GAGGGATCCAGGGTTGGTGCTGG - Intronic
1154298239 18:13169657-13169679 CAGGGATGCAGGGATGGTTTAGG + Intergenic
1155026022 18:21941668-21941690 GCTGGAAGCAGGGATGTTGCTGG + Intergenic
1155206146 18:23559806-23559828 CAGGCATGCAGGCATGGTGGCGG + Intronic
1155630543 18:27887541-27887563 GAGGGAGGCAGGGAAGGAGGAGG - Intergenic
1156173746 18:34517602-34517624 TAGGGATGGAGGGATGGAGAGGG - Intronic
1156623599 18:38882137-38882159 GAGGGATGGAGGGAGGGAGAAGG + Intergenic
1157183963 18:45522442-45522464 CAGGGACTGAGGGATGGTGCCGG - Intronic
1157193304 18:45599256-45599278 GAGGGAGGCAGTAATTGTGCTGG - Intronic
1157517438 18:48320908-48320930 CAGGGAGGCAGGCATGGGGCTGG - Intronic
1157749103 18:50162273-50162295 GAGGGAGGGAGGGATGGTTCAGG - Intronic
1158457540 18:57621554-57621576 GAGGGAGGGAGGGAGGGTGCTGG - Intronic
1159553098 18:69917388-69917410 GAGGGAAGGAAAGATGGTGCTGG - Intronic
1159636706 18:70813383-70813405 GATGGATGGATGGATGGTGGTGG - Intergenic
1160051844 18:75440977-75440999 GAGGGATGGAGGGTTGCAGCGGG + Intergenic
1160815252 19:1032473-1032495 GAGCGGAGCAGGGATGGTGCTGG + Intronic
1161255988 19:3310036-3310058 GAGGGATGGAGGGAGGGAGGGGG - Intergenic
1161322346 19:3647064-3647086 GAGGGATGGGAGGAGGGTGCAGG + Intronic
1161322359 19:3647102-3647124 GAGGGATGGGGGGAGGGTGCAGG + Intronic
1161322368 19:3647136-3647158 GAGGGATGGGAGGAGGGTGCAGG + Intronic
1161322377 19:3647170-3647192 GAGGGATGGGAGGAGGGTGCAGG + Intronic
1161322393 19:3647220-3647242 GAGGGATGGGAGGAGGGTGCAGG + Intronic
1161322404 19:3647258-3647280 GAGGGATGGGAGGAGGGTGCAGG + Intronic
1161329066 19:3677882-3677904 GAGGGAGGGAGGGATGGAGGAGG + Intronic
1161596312 19:5152722-5152744 GAGGGGTGCAGAGCTGGTGAGGG - Exonic
1162007301 19:7788748-7788770 GAGGGAGGCGAGGATGGGGCGGG - Intergenic
1162143195 19:8596840-8596862 GAGGGAGCCAGGGATGGGGAGGG - Intronic
1162988795 19:14289096-14289118 GAGGGATGCTGGGCTGGACCAGG + Intergenic
1163011229 19:14427662-14427684 GGGAGAAGCAGGGATGGTGATGG + Intergenic
1163019008 19:14472871-14472893 GGGGGGCGCAGGGATGGTGGGGG + Intronic
1163203766 19:15787496-15787518 GAGGGAGGCAGGAATGGAGAGGG + Intergenic
1163302329 19:16455844-16455866 GAGAGATGGAGGGATGTTTCTGG - Intronic
1163511759 19:17739624-17739646 GAGAGAGGCAGTGATGGGGCAGG + Intergenic
1164600500 19:29560233-29560255 TAGGGATGCTGGGATGGGGAAGG + Intronic
1165114971 19:33523177-33523199 GAGGACAGCAGGGATGGTACTGG - Intergenic
1165383017 19:35494416-35494438 GAGGGAGGAAGGGATGGGACAGG - Intronic
1165593174 19:36988500-36988522 GAAGGAAGCAGGGAAGGTGCGGG + Intronic
1166350491 19:42195714-42195736 GAGGGAGGGAGGGAAGGTGGTGG - Intronic
1166631150 19:44409182-44409204 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632027 19:44415309-44415331 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632455 19:44418994-44419016 GAGGGTTGCAAGGATGCTGCTGG + Intronic
1166637024 19:44459399-44459421 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
1167250122 19:48394950-48394972 AGGGGATGCAGGGATGGTGGTGG + Intronic
1167396833 19:49235028-49235050 GGGGGCAGCAGGGATGGGGCTGG + Intergenic
1167511244 19:49896343-49896365 GAGGGAGGCAGGGACGGTCCAGG - Intronic
1167571359 19:50290889-50290911 GAGAGATGCAGAGGTGGAGCGGG + Exonic
1167576371 19:50319937-50319959 GAGGGAGGCAGAGATGTTGATGG + Intronic
1167685515 19:50953240-50953262 GGGGGAGGCAGGGAAGGGGCTGG - Intergenic
1167686321 19:50958982-50959004 CAGTGATGCAAGGATGGAGCTGG + Exonic
1167717747 19:51154826-51154848 GAAAGATGCAGGGATGGGACGGG - Intergenic
1168096340 19:54117370-54117392 GAGGCATACAGGAGTGGTGCTGG + Intronic
1168159344 19:54498644-54498666 CAGCAATGCAGTGATGGTGCTGG + Intronic
1168639454 19:58021022-58021044 GAGGGAGGGAGGGATGGAGGAGG + Intergenic
1168706360 19:58472497-58472519 GAGGGATGCAGGCATGGGTTGGG + Exonic
925422062 2:3720366-3720388 TAGGGAGGCAGGGAGAGTGCAGG - Intronic
925466231 2:4109084-4109106 GGGGGAGGCAGGGGTCGTGCCGG - Intergenic
926188040 2:10707017-10707039 CACGGATGCAGGGAGGGTGGGGG + Intergenic
926687335 2:15708469-15708491 GAGGGAAGCATGGAGTGTGCTGG - Intronic
926692361 2:15746245-15746267 GAGGAATGCAGGAAGGGTGGAGG - Intergenic
926751267 2:16200402-16200424 GAAGGCTGCGGGGATGGTGGCGG - Intergenic
927414612 2:22865832-22865854 TGGGGGTGCAGGGATGGTGCAGG + Intergenic
928142711 2:28744468-28744490 CATGGATGCATGGATGGAGCTGG + Intergenic
928453023 2:31395598-31395620 GGGGGATGCAGTCATGGAGCGGG - Intronic
929055138 2:37870034-37870056 GATGGCAGCAGGGATGATGCAGG + Intergenic
929586886 2:43121947-43121969 GAGGGAGGCAGGAAGGGTGGGGG - Intergenic
929864664 2:45708028-45708050 GAGGAATGCTGGGATGCTGCAGG + Intronic
930087301 2:47506843-47506865 GAGAGAGGTAGGGGTGGTGCAGG + Intronic
931419582 2:62114029-62114051 GAGGGATTCAGGGATTTTTCTGG + Intronic
931573631 2:63696914-63696936 GAGGAATGCAGTGATGGGGATGG - Intronic
931781132 2:65580147-65580169 CAGGGAGGCAGGGATGGAGGGGG - Intergenic
931867063 2:66425021-66425043 GATGGAGTCAGGGATGGAGCAGG + Intergenic
932001848 2:67892588-67892610 GAGGGATGCAGCTATACTGCTGG + Intergenic
932306782 2:70709451-70709473 GAGTGAGTCAGGGATGTTGCTGG + Intronic
932430280 2:71670115-71670137 GGTGGATGCAGAGATGGTGGAGG - Intronic
932601901 2:73133411-73133433 GAGGGAAGGAGAGATGGTGGAGG + Intronic
932805953 2:74783633-74783655 GATGGAAACAGGGATGGTACAGG + Intergenic
933632428 2:84673071-84673093 GAGGGATTCAGGGGTGGGGCTGG + Intronic
935828733 2:106977151-106977173 AAGGGCTGTAGGGTTGGTGCGGG + Intergenic
936288337 2:111198952-111198974 GAGGGAAGTGGAGATGGTGCTGG - Intergenic
936531642 2:113280106-113280128 GAGGGGGGCAAGGAAGGTGCAGG + Intergenic
937264694 2:120608254-120608276 GAGGGAAGCAGGGTGGGTGTGGG + Intergenic
938003921 2:127771793-127771815 GAGGGAGGGAGGGAGGGGGCAGG + Intronic
938011355 2:127831504-127831526 GAGGGATGCAGTGCAGGTGAGGG + Intergenic
938391889 2:130913208-130913230 GAGGGAAGCAGGGATTGACCGGG + Intronic
938406161 2:131034520-131034542 CAGGAATGCAGGGATGGCGGAGG - Intronic
938540996 2:132283388-132283410 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
938730543 2:134143625-134143647 GAGGGGTGGAAGGGTGGTGCTGG + Intronic
938903382 2:135817364-135817386 CAGAGATGCCGGGAGGGTGCTGG + Exonic
939535375 2:143421395-143421417 CAGAGAGGCAGGGAGGGTGCAGG + Intronic
940344906 2:152619116-152619138 GAGGGAGGCAGTGGTGGTGGAGG - Exonic
941099481 2:161280937-161280959 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
942066474 2:172276583-172276605 GAGGGAGCCAGGGTTGGAGCAGG + Intergenic
942206110 2:173621148-173621170 GATGGATGGATGGATGATGCAGG + Intergenic
942479509 2:176368885-176368907 GGGGGATGCAGGGGTGGTTAGGG - Intergenic
944553887 2:200869265-200869287 GAGGCATGCGGGAGTGGTGCAGG - Intergenic
945724266 2:213455902-213455924 AAGGCATGCAGGAGTGGTGCTGG - Intronic
947824119 2:233092751-233092773 GAGGGATAAAGGGATGCTGTTGG - Intronic
947827064 2:233113731-233113753 GAGAGAGGCAAGGATGGAGCTGG - Intronic
948106659 2:235419926-235419948 GCGGGATGCAGGGAGAGTGATGG + Intergenic
948507150 2:238435939-238435961 CAGGGGTGCTGCGATGGTGCCGG - Exonic
948563177 2:238867249-238867271 GAGGGAGGCAGGGAGGGAGGGGG + Intronic
948638070 2:239353085-239353107 CAGGGTTGCAGGGGTGGTGGAGG - Intronic
948893074 2:240916426-240916448 GGGGGACGCAGGGGTCGTGCAGG - Intergenic
949069863 2:242018034-242018056 GGGGCATGCAGGGGAGGTGCTGG + Intergenic
1168744055 20:221292-221314 GAGGGAGGGAGGGAGGGAGCAGG + Intergenic
1168984816 20:2039046-2039068 GAGGGATGGAGGGATGCCTCTGG - Intergenic
1169216235 20:3796351-3796373 GAGGGATGCGGGGAGGGCGGGGG - Exonic
1170515413 20:17124452-17124474 GAGGGTGGCAGGGATAGTGAGGG + Intergenic
1170605040 20:17869602-17869624 GAGGAAAGGAGGGATGGTGCAGG - Intergenic
1170879053 20:20278431-20278453 GAGGGAAGGAGGGAAGGGGCCGG + Intronic
1170894884 20:20403945-20403967 GACAGATGCTGGGATGGTGGAGG + Intronic
1171108706 20:22460555-22460577 GAAGGATGCAGGGAGGGTAGAGG - Intergenic
1171134388 20:22683932-22683954 CAGGGAAGAAGCGATGGTGCTGG + Intergenic
1171869905 20:30516393-30516415 GAGGGTTGCAAGGGTGCTGCTGG - Intergenic
1171870694 20:30522174-30522196 GTGGGTTGCAAGGATGCTGCTGG - Intergenic
1172098623 20:32472918-32472940 GAGAGATGCAGGGAGGCTGGGGG - Intronic
1172191308 20:33063446-33063468 GTGGGAGGCAGGGAAGGGGCTGG - Intronic
1172271446 20:33657781-33657803 GAGGGAGGCAGGCAGGGTCCCGG + Exonic
1172448331 20:35004576-35004598 GAGGGAGGCAGGGGTGCAGCAGG + Intronic
1172602022 20:36190591-36190613 GAGGGATGCAGGGGAGGAGGAGG - Intronic
1172619023 20:36307397-36307419 GAGGGATGAAGGGATGGAGGGGG - Intronic
1172628585 20:36363247-36363269 GAGGGAACCAGAGGTGGTGCAGG + Intronic
1172737799 20:37141221-37141243 GCTGGATGCAGGGATGTTTCAGG + Exonic
1172786602 20:37472916-37472938 GAAGGTGGCAGGGATGGTGCTGG + Intergenic
1173846556 20:46192293-46192315 GAGGGATGCTGGGGAGGTGCAGG + Intronic
1173856465 20:46253412-46253434 GAGGGATGGAGGGAGGGGTCTGG + Intronic
1173966886 20:47119288-47119310 GTGGGAAGCAGGCATGGTGAGGG - Intronic
1174180075 20:48669036-48669058 GAGGGCTGCAGGGAGGTGGCAGG - Intronic
1174302999 20:49595675-49595697 GAGGGAAGCAGAGGTGTTGCAGG - Intergenic
1174564220 20:51453047-51453069 GGGAGATGCAGGGATGGGTCGGG - Intronic
1174758394 20:53182276-53182298 GAGGGAGGCAGGGACGGAGGAGG - Intronic
1175123653 20:56735879-56735901 CAGGGATGAAGGGATGGTGGGGG - Intergenic
1175236841 20:57519785-57519807 GAAGGATGCAGAGATGGGGCGGG - Intronic
1175504618 20:59472759-59472781 GGGGGATGCAGGGGTGGTTTTGG + Intergenic
1175949851 20:62577614-62577636 GAGGGCAGCAGGGCTGGGGCTGG + Intergenic
1175956271 20:62611019-62611041 GAAGGAAGCAGGGATGCTCCAGG + Intergenic
1175984112 20:62755589-62755611 GAGGGAGGGAGGGATGATGGAGG - Intronic
1176103598 20:63375640-63375662 CTGGGATGCAGGGATGGTAGGGG - Intronic
1176428406 21:6562411-6562433 CAGGGTTGAAGGCATGGTGCAGG - Intergenic
1177319239 21:19498905-19498927 TAGGGATGGAGGGATGGTTTGGG - Intergenic
1178285862 21:31324898-31324920 GAGGGATGCTGGTATGGAGTAGG - Intronic
1178883649 21:36467672-36467694 GAGGGGTGCAGGGATGGGATGGG + Intronic
1179025428 21:37675424-37675446 CAGGGCTGCAGGTACGGTGCGGG + Intronic
1179703896 21:43170727-43170749 CAGGGTTGAAGGCATGGTGCAGG - Intronic
1180186902 21:46144658-46144680 GAGGGAGGGAGGGATGGGGAGGG - Intronic
1180463983 22:15594267-15594289 GAGGGAAGGAGGGAGGGTGGAGG + Intergenic
1180835281 22:18926571-18926593 CAGGGGTGCAGGGCTGGTGGGGG - Intronic
1180949266 22:19714065-19714087 GAGGTCAGCAGGGATGGTCCTGG - Intergenic
1181050142 22:20234501-20234523 GAGGCATGCAGGGATGGATATGG + Intergenic
1181528361 22:23502513-23502535 GGGGGATGGAGGGATGGGGATGG - Intergenic
1181528509 22:23502934-23502956 GAGGGATGGAGGGATGGGAATGG - Intergenic
1181528518 22:23502959-23502981 GAGGGATGGAGGGATGGGGATGG - Intergenic
1182431640 22:30302363-30302385 CAGGGAGGCAGGGCTGGGGCTGG - Intronic
1182549009 22:31091132-31091154 GGAGGAGGCAGGGGTGGTGCTGG - Exonic
1183212213 22:36458087-36458109 GAGGCAGGCAGGGAAGGAGCCGG - Intergenic
1183296848 22:37034873-37034895 GAGGCAGGCAGGGCAGGTGCAGG - Intergenic
1183301084 22:37059517-37059539 GAGAGGTGGAGGGATGGTGCAGG - Intronic
1183622994 22:38985743-38985765 GAGGAGTGCAGGGGTGGGGCAGG - Intronic
1183630920 22:39032068-39032090 GAAGCCTGCAGGGATGGGGCCGG + Intronic
1183632999 22:39044872-39044894 GAGGAGTGCAGGGGTGGGGCAGG - Intronic
1183731149 22:39619273-39619295 GAGAGAGTGAGGGATGGTGCTGG - Intronic
1183943192 22:41308217-41308239 GAGGGCTGCAGGGAAGGTGGGGG + Intronic
1184089354 22:42284118-42284140 GAGGGATGGATGGATGGAGGAGG + Intronic
1184293394 22:43509686-43509708 GAGGGATGGAGGGATGAAGGGGG - Intergenic
1184493195 22:44822294-44822316 GAGGGTTGCAGGGAGGGAGGGGG - Intronic
1184516592 22:44966126-44966148 GAGGGATGCAGGGAGTGCCCAGG - Intronic
1184726163 22:46347870-46347892 GAAGGCTGCAGTGATGGGGCAGG + Intronic
1184770453 22:46594130-46594152 GCGGGATGCTGGGGTGGGGCTGG - Intronic
1184826280 22:46953876-46953898 GAGGGAGGCAGGGAGGGAGGTGG + Intronic
1185322746 22:50209429-50209451 GTGGACTGCAGGGATGGAGCTGG - Intronic
1185400602 22:50613656-50613678 GTGGGATGCAGGGGTGGGGGCGG - Intronic
1203285369 22_KI270734v1_random:151870-151892 CAGGGGTGCAGGGCTGGTGGGGG - Intergenic
949674703 3:6440253-6440275 GAGGGATGCCTAGATGGTTCAGG + Intergenic
949793649 3:7822630-7822652 GAGTGCTGAAGGGAGGGTGCTGG + Intergenic
950340928 3:12243685-12243707 GAGGGCTGTAGGGATGGTTGGGG + Intergenic
950451724 3:13069235-13069257 GAGAGATGCAGGGAGGGAACCGG - Intronic
950588942 3:13921415-13921437 GGGGGATGCAGGGATGGTTTGGG + Intergenic
950852996 3:16080731-16080753 GTGGGATGGAGTGATGGTGAAGG + Intergenic
951307919 3:21088122-21088144 CAGGGATGCAAGAATGGTTCAGG + Intergenic
952090901 3:29884475-29884497 GAGGGAGGGAGGGAGGGAGCGGG - Intronic
952092919 3:29912057-29912079 GATGGATGCAGGGATGCGGATGG + Intronic
952254055 3:31680438-31680460 GGGGGATGCAGGGCAGGTGCTGG - Intronic
952425904 3:33174267-33174289 GAGGAAAGCAGGGGTGGTGAGGG - Intronic
952437654 3:33288106-33288128 GAGAGAGACAGGGATGGAGCAGG + Intronic
952926849 3:38326596-38326618 GAGGGAGGCAGGGATGGCAGGGG - Intergenic
953609091 3:44432763-44432785 GAGGGAAGCTGGGATGTTGGAGG - Intergenic
953695253 3:45153193-45153215 TAGGTATCCAGGGCTGGTGCAGG - Intergenic
954021919 3:47749777-47749799 GAGGGATAGAGGGAGGGGGCAGG + Intronic
954791545 3:53136940-53136962 GAGTGATGCATGGAAGGTGGAGG - Intergenic
955034625 3:55254575-55254597 GGGGGATGCAGGGGTGAGGCGGG + Intergenic
955216648 3:56989706-56989728 GAGTGGGGCAGGGGTGGTGCTGG - Intronic
955700812 3:61680298-61680320 GAGGGAAGCAGGGTAGGTGGAGG + Intronic
955751155 3:62186478-62186500 GAGGGAAGCAGTGAGAGTGCAGG + Intronic
957311837 3:78530219-78530241 GAGGGAGGCAGGGATGAGGAGGG + Intergenic
959028204 3:101266768-101266790 GAGGCATGCAGGAGGGGTGCTGG - Intronic
959180693 3:102976013-102976035 CAGGAGTGCTGGGATGGTGCAGG - Intergenic
959905161 3:111703212-111703234 GAGGGATGCAGGGATGGTGCTGG + Intronic
960826176 3:121787053-121787075 GTGTGATACAGTGATGGTGCAGG + Intronic
961007112 3:123412467-123412489 CAGGGCTGCAGGGATGGTTTGGG + Intronic
961208314 3:125105217-125105239 GGGGGATGGAGGGATGGGGGTGG + Intronic
963010940 3:140769772-140769794 GAGGAGTGCAGGGATGGTGCAGG - Intergenic
963767865 3:149356463-149356485 GATGGAGGCAGGAATGGAGCTGG + Intergenic
964359422 3:155878897-155878919 GAGGGATGGGGGGAGGGTGATGG + Intronic
964476029 3:157098419-157098441 CAGGGAGGCAGGGATGGAGGAGG + Intergenic
964858839 3:161177933-161177955 GATGGATGCAGTGTTAGTGCTGG - Intronic
965402008 3:168223417-168223439 AATGGATGCTGGGATGGAGCAGG + Intergenic
966744200 3:183260082-183260104 GAGGAACACAGGGATGGGGCTGG + Intronic
966851344 3:184166883-184166905 GCCGTATGCAGGGAAGGTGCCGG - Exonic
967162060 3:186747724-186747746 GATGGATGCAGGGATGCCGAAGG + Intergenic
967221575 3:187252105-187252127 GAGGGATGCAGGTTTGGACCTGG - Intronic
967975916 3:195034777-195034799 GAGGGATGCAGGCGTGGCTCCGG + Intergenic
968229406 3:196996504-196996526 GAGGGTTTCAGGGATGGGGCAGG - Intronic
968479687 4:827580-827602 GAGAGAGGAAGGGACGGTGCTGG - Intergenic
968492146 4:895736-895758 GAGAGATGCAGGGATGAGGGAGG + Intronic
968606234 4:1537005-1537027 GAAGGCTGCAGGGATGGGTCTGG - Intergenic
968947104 4:3670868-3670890 CATGGAAGCAGGGATGGTCCAGG - Intergenic
968959740 4:3737408-3737430 GAGGGATGCTGGGCAGGGGCAGG + Intergenic
968977922 4:3831408-3831430 CAGGGAGGCAGGGGTGGTGCTGG - Intergenic
968994361 4:3936345-3936367 GAGGGATGCTGGGAGCGGGCTGG + Intergenic
969119786 4:4899682-4899704 GAGGCATGCAAGGATGCTGCGGG + Intergenic
969133003 4:5005437-5005459 AAGGGAGGAGGGGATGGTGCTGG - Intergenic
969281564 4:6174381-6174403 GAGGGCTGCTGGGAGGGTCCAGG + Intronic
969315629 4:6380017-6380039 GAGGGAGGAGGGGATGGAGCAGG - Intronic
969510331 4:7614091-7614113 GATGGATGAATGGATGGTGATGG - Intronic
969515712 4:7647095-7647117 GAGGGAAGTAGGGATGCTCCAGG + Intronic
969606670 4:8205423-8205445 GAGGGATGGATGGACGGGGCGGG - Intronic
969732136 4:8963756-8963778 GCGGGATGCAGGGCTGGCGCGGG - Intergenic
969791729 4:9497841-9497863 GCGGGATGCAGGGCTGGCGCGGG - Intergenic
969851307 4:9959080-9959102 GGGGAAGGGAGGGATGGTGCTGG + Intronic
971551445 4:27962680-27962702 GAGGGATGCAGTGTTTGAGCAGG - Intergenic
971938975 4:33189434-33189456 GAGGGCTGCCAGGATGGGGCTGG - Intergenic
971971078 4:33621707-33621729 GAGGCATGTAGGAATGGTGCTGG + Intergenic
972782697 4:42299989-42300011 GAGGGATGGAGGGAGGGAGGGGG - Intergenic
973765402 4:54157247-54157269 GAGGGAGGGAGGGAGGGAGCCGG + Intronic
974027557 4:56746997-56747019 GAGAAATGCCGGGATGGGGCTGG - Intergenic
975576607 4:75869206-75869228 GAGTTATGCAGGGATGGAGTAGG + Intronic
977279892 4:95026735-95026757 GAGGGAGGCAGGGAGGGAGAAGG - Intronic
977331674 4:95644372-95644394 GAGAGATACAGGGTTGGTGGGGG + Intergenic
977585371 4:98770211-98770233 GAAGGCTGCAGGGGTGGTGAGGG + Intergenic
978379440 4:108111601-108111623 GAGGGAGGCAAGAAAGGTGCTGG + Intronic
981684140 4:147434500-147434522 GAGGGTGGCAGGGATGGGGGTGG - Intergenic
981898645 4:149835453-149835475 GAGGGGTGCTGGGAGGGTGACGG - Intergenic
983160689 4:164410662-164410684 GAGGGAAGGAGGGATGGAGAAGG - Intergenic
985958436 5:3281759-3281781 AAAGGAAGCAGGGTTGGTGCAGG + Intergenic
985995661 5:3595747-3595769 GCGGGAGGCAGGGAGGGGGCGGG + Intergenic
986002308 5:3639821-3639843 GAGGGAGGCAGGGATAGAACTGG - Intergenic
986651162 5:9964548-9964570 GAGGGAAGCAGGGAATGTGGGGG + Intergenic
986733460 5:10651724-10651746 GATGCAGGCAGGGCTGGTGCAGG + Intergenic
986755241 5:10829789-10829811 GAGGGATACAGGGGTGTTTCTGG - Intergenic
987049314 5:14136103-14136125 AAGGGAGGCAGGGATGGAGGAGG + Intergenic
988802618 5:34710716-34710738 GGGTGGTGGAGGGATGGTGCAGG - Intronic
988832650 5:35002912-35002934 GTGAGAGGCAGGGATGGAGCAGG + Intronic
989003610 5:36786164-36786186 CAGGGATGCAGGGATAATGTAGG + Intergenic
994514025 5:100746951-100746973 GAGGCATGTAGGGTTGCTGCAGG + Intergenic
995555952 5:113328942-113328964 AAGGGAAGGAGGGATGCTGCAGG - Intronic
996706009 5:126499460-126499482 GAGAGATCCAGAAATGGTGCTGG - Intergenic
997364638 5:133318214-133318236 GAGGGATGCAAGCAAGGTGAGGG - Intronic
997512639 5:134464139-134464161 GAGGGATGGAGGGAGGGAGGAGG - Intergenic
997696181 5:135862816-135862838 AAGCAATGCAGGGATGGTGGGGG + Intronic
997852626 5:137346313-137346335 GAGGGGTGCAGGGAAGGAGGGGG - Intronic
998080533 5:139271595-139271617 GAGGAGTGCAGGGATGGAGGAGG + Intronic
1000244528 5:159438365-159438387 CAGGCATCCAGGGATGGGGCGGG + Intergenic
1001089389 5:168726342-168726364 GAGGGAGGCAGGGAGGGAGAGGG + Intronic
1001089396 5:168726360-168726382 GAGGGAGGCAGGGAGGGAGAGGG + Intronic
1001089447 5:168726494-168726516 GAGGGAGGCAGGGAGGGAGAGGG + Intronic
1001907555 5:175485538-175485560 GAGAGATGCAGGCATGATCCTGG - Intronic
1001940661 5:175737308-175737330 GACGGATGCAGGCATAGTGTGGG - Intergenic
1001956463 5:175851247-175851269 GAGGAATGAATGAATGGTGCTGG - Intronic
1002654848 5:180737768-180737790 GTGGGATGCAGTGACAGTGCTGG + Intergenic
1002690316 5:181045809-181045831 GAGGGCTGGAGAGATGGTGGAGG - Intronic
1002761510 6:206007-206029 GAGGAAGGCAGAGACGGTGCAGG - Intergenic
1003381517 6:5628698-5628720 GAGAGATGGAGGGAAAGTGCTGG + Intronic
1004402926 6:15305338-15305360 AAAGGGTGCAGGGAGGGTGCTGG + Intronic
1005831755 6:29676706-29676728 GAAGGATGCCAGGATGGTGCGGG + Intronic
1006184906 6:32176023-32176045 AAGGGAGGGAGGGAGGGTGCTGG - Intronic
1006638757 6:35478142-35478164 GAGGGATGCAGGCTGGGTGGTGG - Intronic
1006922263 6:37634744-37634766 GGGGGATGGGGGGATGCTGCTGG - Exonic
1007231631 6:40352179-40352201 GAGGGAGGGAGGCATGGGGCTGG - Intergenic
1007993090 6:46277702-46277724 GAGGGAGGCATAGATGGGGCAGG + Intronic
1008427755 6:51379388-51379410 GAGGGAGGGAGGGAGGGGGCGGG + Intergenic
1008912462 6:56750007-56750029 GAGGGGTGCAGCGATGGTGGTGG - Intronic
1009304740 6:62074327-62074349 GAGACATGCAGGAATGGTGCTGG - Intronic
1010159166 6:72831578-72831600 GTGGGATGCAGGGAGGGGGGAGG + Intronic
1010393477 6:75363209-75363231 GAGGCAAGCAGGGCTGGTCCTGG + Intronic
1010787542 6:80021629-80021651 AAGAGATGCAGGAGTGGTGCAGG + Intronic
1012172930 6:96042086-96042108 TAGGGATGTCGGGATGGTGGGGG - Intronic
1012372983 6:98529724-98529746 GAGGGATGCAGCGCAGGTGGGGG + Intergenic
1013073469 6:106750310-106750332 GAGTGGTGCAGGGAGGCTGCTGG - Intergenic
1013306107 6:108848453-108848475 CAGGGATGCAGCGCTGGCGCGGG - Exonic
1013511691 6:110850495-110850517 GAGGCAGGCAGGGATGGTTGGGG - Intronic
1016244378 6:141965383-141965405 GAGGTATGCAGGTGTGGAGCAGG - Intergenic
1016323915 6:142878505-142878527 GAAGCAGGAAGGGATGGTGCCGG + Intronic
1016870081 6:148808030-148808052 GTGGGAGGCAGGGCTGGGGCTGG + Intronic
1017720203 6:157238480-157238502 GAGGGTGGCAGTGATGGTGGTGG + Intergenic
1017811317 6:157985815-157985837 CAGGGAGGGAGGGATGGGGCAGG + Intronic
1017964531 6:159252542-159252564 GTGGGATGCAGGGAGGGTTTGGG + Intronic
1018208728 6:161460069-161460091 GGGTGAAGCAGGCATGGTGCAGG + Intronic
1018733211 6:166668835-166668857 GAGGGAGGGAGGGATGGAGGAGG - Intronic
1018787185 6:167117192-167117214 GAGGGATGCGGGGACGGTGGTGG - Intergenic
1018787196 6:167117222-167117244 GAGGGATGCGGGGACGGGGACGG - Intergenic
1018886358 6:167941010-167941032 GAGGGATGTAGGGATGAGGGTGG + Intronic
1018886370 6:167941068-167941090 GAGGGATGTAGGGATGAGGGTGG + Intronic
1018886393 6:167941182-167941204 GAGGGATGTAGGGATGAGGGTGG + Intronic
1018886405 6:167941240-167941262 GAGGGATGTAGGGATGAGGGTGG + Intronic
1018886441 6:167941412-167941434 GAGGGATGTAGGGATGAGGGTGG + Intronic
1018886453 6:167941470-167941492 GAGGGATGTAGGGATGAGGGTGG + Intronic
1018946316 6:168348770-168348792 GAGGGATGCAGGCTTGGGCCAGG + Intergenic
1019056333 6:169226115-169226137 GAGGGACGCGGGGACGGTGGCGG - Intronic
1019103425 6:169650146-169650168 GATGGATGGAGGGATGGAGAGGG - Intronic
1019160811 6:170066150-170066172 GACGGATGGAGGGATGGGGATGG - Intergenic
1019160822 6:170066185-170066207 GACGGATGGAGGGATGGGGATGG - Intergenic
1019160900 6:170066410-170066432 GACGGATGGAGGGATGGGGATGG - Intergenic
1019716339 7:2541158-2541180 GAGGGGTGCAGGGGCCGTGCAGG - Intronic
1019785877 7:2977120-2977142 GGGGGAGGCAGGGATGGAGGAGG + Intronic
1020309150 7:6855689-6855711 GCGGGATGCGGGGCTGGCGCGGG + Intergenic
1021011147 7:15467922-15467944 GAGGGTGGCAGGGAGGGTACGGG - Intronic
1021099851 7:16575136-16575158 GAGGGAGGGAGGGAGGGAGCAGG + Intronic
1021860258 7:24899041-24899063 GTGGGATGTGGGGATGGTGGTGG - Intronic
1022162633 7:27726947-27726969 GAGGGAGGCAGGGAGGGAGGAGG + Intergenic
1022465495 7:30650380-30650402 GAGGGATTCAGGGCTGGGGTTGG + Intergenic
1022481874 7:30749592-30749614 GAGGCATGTAGGGATGGAGAAGG + Intronic
1022518137 7:30988602-30988624 GAGGGAGGGAGGGATGGTGTGGG - Intronic
1022532591 7:31076336-31076358 CAGAGAAGCAGGGATGGAGCAGG + Intronic
1022602321 7:31773047-31773069 GAGGGGTGCACGGAAGGAGCTGG - Intronic
1022954198 7:35366538-35366560 GCTGGAGGCAGGGATGGAGCAGG - Intergenic
1023090481 7:36613550-36613572 GAGGCATGCAGGAAAGGTCCTGG - Intronic
1023609307 7:41957489-41957511 GTGGCATGCAAGGAGGGTGCTGG - Intergenic
1023858506 7:44201326-44201348 GAGGGATGAGGGGAGGGTGGAGG + Intronic
1024272833 7:47655394-47655416 GAGGGATGTGGGGGTGGTCCTGG + Intronic
1024402714 7:48943870-48943892 GAGGGATGGAGGGAGGGAGGGGG - Intergenic
1025282700 7:57639674-57639696 GAGGGGTGCAGGCATGGAACTGG - Intergenic
1025302017 7:57825743-57825765 GAGGGGTGCAGGCATGGAACTGG + Intergenic
1026535895 7:71238279-71238301 GTGGGAGGCAGGGAAGGTGAGGG + Intronic
1026621395 7:71952790-71952812 GAAGGATGCAGGGATCCTACAGG - Intronic
1026692482 7:72561351-72561373 GAGGCATGCACTGATTGTGCTGG - Intronic
1029466346 7:100727625-100727647 GAGGAAGGCAGGGATGATGGAGG + Intergenic
1029524749 7:101087903-101087925 GAGGCAGGCAGGGGTGGTCCAGG - Exonic
1029745323 7:102512995-102513017 GGGGGAGGCAGGGATGGGGTAGG - Intronic
1029763263 7:102611974-102611996 GGGGGAGGCAGGGATGGGGTAGG - Intronic
1030174358 7:106636045-106636067 GAGGGAGGCGGGGAGGGGGCAGG + Intergenic
1030357023 7:108554673-108554695 GATGGATGGATGGATGATGCAGG - Intronic
1032072598 7:128817891-128817913 GAGGGATAGAGGGAGGGTGCAGG + Intronic
1033599176 7:142876699-142876721 GAGGGGAGCTGGGATGCTGCAGG - Intronic
1033656366 7:143377521-143377543 GATGGAAGCAAGGATGGGGCAGG + Intergenic
1033741264 7:144277384-144277406 GGGGGATGCAGTGAAGGTGCGGG + Intergenic
1033752639 7:144372230-144372252 GGGGGATGCAGTGAAGGTGCGGG - Intronic
1033842057 7:145386743-145386765 GAGGGAGGCAGGGTTGCTGTTGG + Intergenic
1034093432 7:148384754-148384776 GTGAGAGGCAGTGATGGTGCTGG - Intronic
1034422122 7:150995783-150995805 GAGGGGTGCAGGGGTGGGTCGGG - Intronic
1034422137 7:150995816-150995838 GAGGGATGCAGGGGTGGGACGGG - Intronic
1034422180 7:150995915-150995937 GAAGGGTGCAGGGATGGGACAGG - Intronic
1034422191 7:150995947-150995969 GAAGGGTGCAGGGATGGGACGGG - Intronic
1034422203 7:150995979-150996001 GAGGGGTGCAGGGATGGGACGGG - Intronic
1034422256 7:150996113-150996135 GAGGGGTGCAGGGGTGGGGTAGG - Intronic
1034422330 7:150996310-150996332 GAGGGGTGCAGGGGTGGAACAGG - Intronic
1034553089 7:151833464-151833486 GAAGTCTGCAGGGATGGTGCGGG + Intronic
1034628688 7:152514045-152514067 GAGGGAAGGAGGGATTGGGCAGG - Intergenic
1034982630 7:155488628-155488650 GAAGGATGCAGCCAGGGTGCTGG - Intronic
1034984105 7:155496863-155496885 GAAGGATACAGGAGTGGTGCAGG - Intronic
1035000719 7:155610352-155610374 GAGGCATCCAGATATGGTGCAGG + Intergenic
1035058502 7:156052228-156052250 GAGGGATGGAGGGATGGATGGGG - Intergenic
1035239964 7:157523172-157523194 GTGGGCAGCAGGGATGGTGGGGG + Intergenic
1036767295 8:11556976-11556998 GAGGGATGGAGGGAGGGGGAGGG + Intronic
1037169427 8:15873942-15873964 GAGGGAGGCAGGGAGGGAGGGGG - Intergenic
1037486274 8:19350280-19350302 CAGTGATGCAGAGCTGGTGCAGG - Intronic
1037839580 8:22234175-22234197 GTGGGAGGCAGGGATGGTGCTGG - Intergenic
1037918216 8:22785595-22785617 GAGGGAGGCAGGGGTGATCCAGG + Intronic
1038244380 8:25841138-25841160 GAGGGAGGCAGGGCTGGACCAGG - Intergenic
1038497308 8:28012872-28012894 GAGGGAGGGAGGGATGGAGAAGG + Intergenic
1039124816 8:34189626-34189648 CAGGGATGCAGGGAGGGTAAAGG - Intergenic
1039203463 8:35123007-35123029 GAGACATGCAGGAGTGGTGCAGG + Intergenic
1039246999 8:35620103-35620125 CAGAGGTGAAGGGATGGTGCAGG - Intronic
1039920723 8:41892445-41892467 GAGGGATGGAGGAAGAGTGCAGG - Intronic
1040023586 8:42761960-42761982 GAGGGATCCAGTGTTTGTGCTGG - Intronic
1040295353 8:46146159-46146181 GGGAGATGCAGCGATGCTGCAGG - Intergenic
1040510111 8:48085699-48085721 GAGGGTTACAAGGATGCTGCTGG - Intergenic
1040550710 8:48435047-48435069 GACAGCTGCAGGGATGGTGCTGG + Intergenic
1041071343 8:54128583-54128605 GAGGGATACAGAGTTGGTGGGGG + Intergenic
1041101289 8:54398656-54398678 GAGGGATGTAAGGCTGGAGCAGG - Intergenic
1042036587 8:64540450-64540472 GAGGGAGGGAGGGAGGGAGCTGG + Intergenic
1042949794 8:74189189-74189211 GGGGGATGCAGGGAGGGAGAGGG - Intergenic
1043172719 8:76985726-76985748 GAGGGAGGCATGGATCCTGCTGG + Intronic
1043602040 8:81952539-81952561 GAGGGAGGGAGGGAGGGTGAGGG - Intergenic
1044429825 8:92095673-92095695 GAGGGAAGGAGGGATGGAGGAGG + Intronic
1044563350 8:93636253-93636275 GAGGGAGGAAGGCAGGGTGCTGG + Intergenic
1045605955 8:103776152-103776174 GTGGGATGCATGTATGGTGAAGG + Intronic
1047025371 8:120817834-120817856 GAGGTAACCAGGGATGGGGCGGG - Intergenic
1047051392 8:121117203-121117225 GAGGGATGCAAAGATAGTCCAGG - Intergenic
1047356325 8:124125567-124125589 GAGAGATGCTGGAATGTTGCTGG - Intergenic
1047878975 8:129171485-129171507 GAGGGATGCAGGAAGGTTGGAGG + Intergenic
1048170837 8:132104701-132104723 GTAGGAAGCAGGGATGGTGAGGG + Intronic
1048202455 8:132386028-132386050 CTGGGATGGGGGGATGGTGCAGG + Intronic
1048404069 8:134101243-134101265 GAGGCATGTGGGAATGGTGCAGG + Intergenic
1049582676 8:143420026-143420048 GAGGGGAGCAGGGAAGGAGCAGG - Intronic
1049652519 8:143778647-143778669 GAATGATGAAGGGATGGTGATGG - Intergenic
1049662096 8:143824117-143824139 GGAGGGTGCAGGGCTGGTGCGGG + Intronic
1050371801 9:4929668-4929690 GAGGAATGGAGGGGTGGTGGGGG - Intergenic
1052365094 9:27603337-27603359 GAGGCATGCAGGAGGGGTGCAGG - Intergenic
1052681634 9:31700595-31700617 GTGGGAGGCAGAGATTGTGCTGG - Intergenic
1052750149 9:32482039-32482061 GAAGGATGGAGAGATGGTGATGG - Intronic
1052972365 9:34384947-34384969 GAGGGATGCAGGAGAGGTGGAGG + Intronic
1053455356 9:38229317-38229339 GAGGGATGCAGGGTTGGGGCGGG + Intergenic
1055216800 9:73873285-73873307 GAGGGGTGCAGGTGTGCTGCAGG - Intergenic
1055256174 9:74373743-74373765 GAGAGATGCAGTGATGGTAAAGG - Intergenic
1057353188 9:94317063-94317085 GAGGGAACCAGGGCAGGTGCTGG + Intergenic
1057654562 9:96940528-96940550 GAGGGAACCAGGGCAGGTGCTGG - Intronic
1057831276 9:98409136-98409158 GAGGGAGGCAGGGTTGTGGCTGG + Intronic
1059343783 9:113614949-113614971 GAGGGAGGCGGGCATCGTGCCGG + Intergenic
1060414702 9:123421996-123422018 GAGGGATGCAGGGATCCATCAGG - Intronic
1060876062 9:127084433-127084455 GAGGGCTGCCTGGATGGTGGGGG - Intronic
1061049000 9:128183129-128183151 GAGGGAGGGAGGGAGGCTGCAGG - Intronic
1061187184 9:129061360-129061382 GAGGGAGGGAGGGAGGGAGCAGG + Intronic
1061368199 9:130183330-130183352 GAGGGGTGCAGGGCAGTTGCTGG + Intronic
1061481493 9:130899556-130899578 GAGGGATGCACCGATGCCGCAGG + Intergenic
1061675628 9:132214091-132214113 GAGCGAGCCAGGGATGGTGCTGG - Intronic
1061781549 9:132999268-132999290 GGGGGCTGCAGGGATGCTGCGGG + Intergenic
1061980965 9:134103440-134103462 GATGGATGGATGGATGGTGGTGG - Intergenic
1061981005 9:134103627-134103649 GATGGATGGATGGATGGTGGTGG - Intergenic
1061981024 9:134103717-134103739 GAAGGATGGATGGATGGTGGTGG - Intergenic
1061981097 9:134104055-134104077 GATGGATGAATGGATGGTGATGG - Intergenic
1061981118 9:134104149-134104171 GATGGATGGATGGATGGTGGTGG - Intergenic
1061981124 9:134104171-134104193 GATGGATGGATGGATGGTGGTGG - Intergenic
1061981160 9:134104341-134104363 GATGGATGGATGGATGGTGGTGG - Intergenic
1061981225 9:134104617-134104639 GATGGATGGATGGATGGTGGTGG - Intergenic
1062039244 9:134396538-134396560 TAGGGTTGCAGGGACGTTGCAGG + Intronic
1062092443 9:134685504-134685526 GATGGATGGATGGATGGTGATGG - Intronic
1062130264 9:134888711-134888733 GCGGGAAGCAGGGATGGCCCTGG + Intergenic
1062416205 9:136451538-136451560 GAGGGAGGCAGGAAGGGGGCTGG + Intronic
1062522469 9:136963987-136964009 GTGGGCTGCAGGGCTGGGGCTGG + Intergenic
1062613686 9:137386765-137386787 GAGGGAGGCAGGCAGGGAGCAGG - Intronic
1062613704 9:137386823-137386845 GAGGGAGGCAGGCAGGGAGCAGG - Intronic
1062613735 9:137386910-137386932 GAGGGAGGCAGGCAGGGAGCAGG - Intronic
1062613744 9:137386939-137386961 GAGGGAGGCAGGCAGGGAGCAGG - Intronic
1062613753 9:137386968-137386990 GAGGGAGGCAGGCAGGGAGCAGG - Intronic
1062613774 9:137387026-137387048 GAGGGAGGCAGGCAGGGAGCAGG - Intronic
1062637071 9:137497141-137497163 GAGGGATGCAGAGGTGGGGGAGG + Intronic
1062637265 9:137498269-137498291 TAGGGTTGGAGGGATGGGGCAGG - Intronic
1185451218 X:281346-281368 GAGGGAGGGAGGGAGGGTCCCGG - Exonic
1187295251 X:17993181-17993203 TGGGGATGCAGGGATGGGGGTGG - Intergenic
1189242024 X:39532677-39532699 GAAGGATGCAGGGAGGCTTCTGG + Intergenic
1189650092 X:43179384-43179406 CAGAGATGCAGGGATGGTGATGG - Intergenic
1189774188 X:44455497-44455519 GAGGGATGGAGGCATCGTGTGGG + Intergenic
1190429940 X:50369534-50369556 GAGGGAGGCAGGGAGGGGGAAGG - Intronic
1190708261 X:53048460-53048482 GAGGGAGGCAGGGAGGGAGAGGG - Intergenic
1190789646 X:53686683-53686705 GAGGGGAGCAGGGCTGGAGCAGG - Intronic
1191589240 X:62862608-62862630 GAGGGATGCAGGTTTGATGTAGG - Intergenic
1192639296 X:72847252-72847274 GTGGGTTGCAAGGCTGGTGCAGG - Exonic
1192642415 X:72873553-72873575 GTGGGTTGCAAGGCTGGTGCAGG + Exonic
1194000459 X:88422274-88422296 GAGGCATGCAGGAGTTGTGCTGG - Intergenic
1195491219 X:105472064-105472086 GTGGGATGGAGGGGTGGTGGTGG + Intronic
1195977719 X:110545591-110545613 TAAGGATGCAGTGATGGTCCAGG + Intergenic
1197671177 X:129279766-129279788 CAAGGATGCAGGGATGGTTTAGG - Intergenic
1198203629 X:134445800-134445822 AAGGGGTGCAGGGAGGGGGCGGG + Intergenic
1200059490 X:153477930-153477952 GAGGGGTGCAGGGCTGGTCAAGG - Intronic
1200075215 X:153547331-153547353 GGGAGAGGCAGGGAGGGTGCTGG + Intronic
1200163104 X:154019258-154019280 GGCGGGTGCAGGGATGCTGCTGG + Exonic
1200292305 X:154885647-154885669 GAGGGATGGAGAGGTGGTGGGGG + Intronic
1200339142 X:155381384-155381406 GAGGGATGGAGAGGTGGTGGGGG + Intergenic
1200347327 X:155459308-155459330 GAGGGATGGAGAGGTGGTGGGGG - Intergenic
1200703517 Y:6422185-6422207 GAGGGCTGCAGGGTTCGTGAAGG - Intergenic
1200914114 Y:8556360-8556382 GAGGAATGCAGGGATGGAGATGG - Intergenic
1200929856 Y:8687158-8687180 AAGGAATGCAAGGATGGAGCTGG + Intergenic
1201030594 Y:9742522-9742544 GAGGGCTGCAGGGTTCGTGAAGG + Intergenic
1201741272 Y:17326373-17326395 GAGGGATGGAGGGAGGGAGAAGG + Intergenic
1202180318 Y:22134230-22134252 AAGGAATGCAGGGATGGAGTTGG + Intergenic
1202211042 Y:22452169-22452191 AAGGAATGCAGGGATGGAGTTGG - Intergenic