ID: 959905178

View in Genome Browser
Species Human (GRCh38)
Location 3:111703327-111703349
Sequence CTCTCCCTCTTCTGTGGGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 308
Summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 274}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959905174_959905178 -6 Left 959905174 3:111703310-111703332 CCTAGGAAATATACATGCTCTCC 0: 1
1: 0
2: 0
3: 21
4: 173
Right 959905178 3:111703327-111703349 CTCTCCCTCTTCTGTGGGATGGG 0: 1
1: 0
2: 3
3: 30
4: 274

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959905178 Original CRISPR CTCTCCCTCTTCTGTGGGAT GGG Intronic
900679520 1:3908972-3908994 CTGTCCCTTTCCTGTGGGACTGG + Intergenic
901519053 1:9768871-9768893 CCCTCCCTCTTCTGTTGCTTTGG - Intronic
901652776 1:10752535-10752557 CTCTCCCTGTACTGTGGGAGTGG + Intronic
902758802 1:18567297-18567319 TGCTTCCTCATCTGTGGGATAGG - Intergenic
903029715 1:20454988-20455010 CTTTCCCTCCCCTGTGGAATGGG + Intergenic
903175364 1:21577265-21577287 CTTTTCCTCTTCTGTGAAATGGG + Intronic
903572689 1:24318105-24318127 CTCTCTCTCTTCTCTGGGAACGG - Intergenic
904036469 1:27561663-27561685 CTCTCTCTCTTGTGTGGTCTCGG - Intronic
906040296 1:42783964-42783986 TACTTCCTCTTCTGTAGGATGGG + Intronic
908207104 1:61861865-61861887 CTCTCTCTCTTTTTTGAGATGGG + Intronic
908329318 1:63055138-63055160 CTTTCACTTTTCTGGGGGATTGG - Intergenic
908711577 1:67021535-67021557 TTCACCCTCTCCTGTGTGATGGG - Exonic
911043885 1:93613032-93613054 AGCTCCCTCTCCTGTGGGACTGG - Intronic
912436062 1:109661751-109661773 CACTGCCTCTTCTGAGGGACTGG + Intronic
912567825 1:110601104-110601126 CTCTACTTCTTCTGGGGGGTGGG + Intronic
912962890 1:114211637-114211659 CTCCCCTTCTTCTGTAGGAATGG - Intergenic
913568230 1:120094685-120094707 TTTTCCAACTTCTGTGGGATGGG - Intergenic
914289039 1:146255714-146255736 TTTTCCAACTTCTGTGGGATGGG - Intergenic
914550074 1:148706457-148706479 TTTTCCAACTTCTGTGGGATGGG - Intergenic
915456546 1:156044311-156044333 CTCTCCCTTTTCTGGGGAAGGGG - Intronic
916511123 1:165473218-165473240 CTCTCCCACTACTGTGGGGAAGG - Intergenic
917014679 1:170516597-170516619 CTCAACCTCTACAGTGGGATAGG + Intergenic
917565463 1:176207689-176207711 GTCTCTCTCTTCTGAGGGGTAGG + Intergenic
917996612 1:180445841-180445863 TTCTGCCACTTCTGTGGCATTGG - Intronic
918912455 1:190591542-190591564 CTCTCTCTCTTTTGAGGGAGAGG + Intergenic
920045471 1:203129543-203129565 CTCTTCCTCTTCCCTGGGACTGG - Intronic
920658688 1:207896953-207896975 GACTCCCTCTTCTGTTGCATGGG - Intronic
920709466 1:208281227-208281249 CTCTCCCCCTTCTGTAGGACTGG + Intergenic
922929416 1:229377267-229377289 CGCTCCCTTTTCTCTGTGATTGG + Intergenic
1063199975 10:3778921-3778943 CTCCCCCTTTTCTGTGTGAGAGG - Exonic
1063906359 10:10784107-10784129 CTCTCCCATTTCAGTGAGATGGG - Intergenic
1065450797 10:25854727-25854749 CTATATCTCTTTTGTGGGATTGG - Intergenic
1066102303 10:32128404-32128426 CTCTAGCTTTTCTGTGTGATTGG + Intergenic
1069510136 10:69036068-69036090 CTCTTCCACTTCTGTGAGAAAGG + Intergenic
1069784755 10:70980885-70980907 CTTTCCCTCATCTGTGAAATGGG + Intergenic
1070182355 10:74026428-74026450 CTGTTCCTCATCTGTGGCATGGG + Intronic
1070388519 10:75948717-75948739 TTCTCCCCCTTCTGAGTGATAGG + Intronic
1072100167 10:92221809-92221831 CTCTCCCTCTTTTAAGAGATGGG - Intronic
1072276550 10:93828924-93828946 CTCTGCCTCTTCTGTGTAACAGG - Intergenic
1072301111 10:94063260-94063282 CCCACCTTCTTCTGTGGGAAAGG + Intronic
1074143765 10:110698876-110698898 CTCTCCCACCTCTGTGGCAGTGG - Intronic
1074305967 10:112278781-112278803 GTCCCCCTCTTCTGAGGGAAAGG + Intergenic
1075596297 10:123732065-123732087 CTGTCCCTCTCCTGGAGGATGGG + Intronic
1076554926 10:131315082-131315104 CTCCCCCTGTTCTGTGAGACTGG + Intergenic
1076944852 10:133639082-133639104 CTTTCTCCATTCTGTGGGATTGG - Intergenic
1078568320 11:12436152-12436174 ATCTCCCTCTTCTGAGGATTAGG + Intronic
1078621460 11:12912541-12912563 CTCTCCCTATTCTCTGAGTTCGG - Intronic
1079390962 11:20021875-20021897 CCCTCCCTTTTCAGTGGGAGAGG + Intronic
1080884789 11:36356795-36356817 CTCTCCCTCTCCTGGGGCCTTGG + Intronic
1081438599 11:43055713-43055735 CTCTCCCTCTGCTGCTGGACTGG + Intergenic
1083806799 11:65079270-65079292 CTCTGGCTCTTTTGGGGGATAGG - Intronic
1084425053 11:69080023-69080045 CACAGCCTCTGCTGTGGGATCGG - Intronic
1087192511 11:95269876-95269898 ATCTCTCTCTTGTGTGGGAAAGG - Intergenic
1089044765 11:115490855-115490877 CTCTTCCTCTTCTGTAAAATGGG + Intronic
1089116232 11:116097233-116097255 CTCCCCTTCTTCTGTGGCACTGG - Intergenic
1089834653 11:121359369-121359391 TTCTTCCTCTTCTGAGGGGTCGG - Intergenic
1090350467 11:126104673-126104695 CTCCCACTCTTCTCGGGGATGGG + Intergenic
1090393955 11:126406953-126406975 GGCTCCTTCTTCTCTGGGATGGG - Exonic
1090828304 11:130403375-130403397 CTCTCCCGGTTGTGTGGGCTCGG - Intergenic
1091187756 11:133661887-133661909 CGCTCCCTCTGCTGTGGCAGGGG - Intergenic
1092055911 12:5507804-5507826 CTCTCCCTCTACTGAGGGAAAGG - Intronic
1092245507 12:6861829-6861851 CACTCCCTCTTCTGTGGCACAGG + Intronic
1093120470 12:15265598-15265620 CTATCCCTCTTCTGTGGAGTTGG + Intronic
1094426357 12:30320906-30320928 CTGTCCCTTTTCTCTGGGACTGG - Intergenic
1095943164 12:47739312-47739334 CTCTGCACCTGCTGTGGGATGGG - Intronic
1096351576 12:50905233-50905255 CTTTCCCTCTTCTCGGGGACAGG + Intergenic
1097170411 12:57109843-57109865 CTCTCCCTCATCTCTGGGAGAGG - Intronic
1099158945 12:79215687-79215709 CTCTCTCTCTTTTATGAGATAGG - Intronic
1099467212 12:83002266-83002288 CTTTCCTATTTCTGTGGGATTGG + Intronic
1101201441 12:102440327-102440349 TTCTCCATCTTGTGTGGGATTGG + Intronic
1103428369 12:120859156-120859178 ATCTCCCTCTTTTTTGGGGTGGG + Intronic
1104180389 12:126374115-126374137 CTCTCCTTGTTCTGTGGGGAGGG - Intergenic
1105700622 13:22933275-22933297 CTCTCCGTGTACTGTGGGATCGG - Intergenic
1105879681 13:24593123-24593145 CTCTCCCTCTCCCTTGGGAGGGG + Intergenic
1106784660 13:33094634-33094656 TTCTCCATCTTCTGTACGATGGG + Intergenic
1107137218 13:36957815-36957837 CTTTCCCTCTTCTCGGGGACAGG - Intronic
1107417361 13:40212974-40212996 CTCTCCTTCTTCTGAAGGATGGG - Intergenic
1109231374 13:59761996-59762018 CTCTCCCTCTTCTTTGGCTATGG - Intronic
1112525977 13:100147451-100147473 CTCTCCATATTTTGTGGAATTGG + Intronic
1116446960 14:45021791-45021813 CTTTCCCTCTTCTCAGGGACAGG + Intronic
1116871098 14:50069787-50069809 CCCTCCAGCTTCTCTGGGATTGG + Intergenic
1117950852 14:61081431-61081453 CTCAGCCCCTGCTGTGGGATGGG - Intronic
1118228441 14:63925857-63925879 CTTTCCTTCTTTTTTGGGATAGG + Intronic
1118889781 14:69899218-69899240 TTCTCCCTCTTCTGCCGGAAGGG + Intronic
1119688361 14:76651336-76651358 CTTTCCATGTTCTGTGGAATGGG - Intergenic
1120922787 14:89770381-89770403 CTTTCCCTCTTCCATGGGAATGG - Intergenic
1120964650 14:90156705-90156727 CTATGCCTCATCTGTGGAATGGG - Intronic
1122040372 14:98983576-98983598 TCTTCCCTCTTCTGTGGGAGGGG - Intergenic
1122314680 14:100818681-100818703 CTGTCCCACATCTGTGGGAAGGG + Intergenic
1122838957 14:104445317-104445339 TGCTCCCTCTTCTGCTGGATTGG + Intergenic
1123838778 15:24224923-24224945 TTCTCCCTCTTCTGGTGGAGGGG - Intergenic
1124574723 15:30897103-30897125 CTCTCTCTCTTTTGTGTGTTCGG - Intergenic
1126173680 15:45715833-45715855 ATCCTCCTCTCCTGTGGGATTGG - Intergenic
1127618536 15:60710805-60710827 CCCTCCCTCTTCTGTGCCCTGGG - Intronic
1127627333 15:60793014-60793036 CTCTCTCTCTTTTGAGGGAGTGG - Intronic
1128345992 15:66852691-66852713 CTGGCCCCCTTCTGTGGGCTGGG + Intergenic
1130595501 15:85245943-85245965 CTCTTCCTCTGCTCTGTGATTGG - Intergenic
1131252302 15:90838623-90838645 CGCTCCCTCATCTGTAAGATGGG - Intergenic
1132729588 16:1354921-1354943 GTCTCCCACGTCTGTGGGGTGGG + Intronic
1132729658 16:1355150-1355172 GTCTCCCGCGTCTGTGGGGTCGG + Intronic
1132729666 16:1355182-1355204 GTCTCCCGCGTCTGTGGGGTCGG + Intronic
1132729675 16:1355214-1355236 CTCTCCTGCGTCTGTGGGGTCGG + Intronic
1134072375 16:11268811-11268833 CTCTCCATCATCTGTGGGCTCGG + Intronic
1135234646 16:20743804-20743826 CTCTCTCTCTTCTGCTGGCTGGG + Intronic
1135591996 16:23711680-23711702 GTCTCCCTCCTCTGTAGAATGGG - Intronic
1137025284 16:35467918-35467940 TTCTCCTTCTTCTGTGAGCTGGG + Intergenic
1137629188 16:49930358-49930380 CTCTCCCTGTTCTGTAGGGGAGG - Intergenic
1139285176 16:65806340-65806362 CTCTTCCTCTTCTTTGGAAAAGG + Intergenic
1139630574 16:68229749-68229771 CTGTCCCTCTTGTAGGGGATAGG - Exonic
1140450729 16:75068883-75068905 TTCTCCCTCTTCTGTGAAATGGG + Intronic
1140586161 16:76294632-76294654 CACTCACTCTTCTCTGGGTTGGG + Intronic
1141028171 16:80567265-80567287 CTCTCCCCATTCTGTGAGGTGGG + Intergenic
1142252107 16:88996717-88996739 CTCTCCAGGTTCTGGGGGATGGG + Intergenic
1142323897 16:89401900-89401922 CTCTCCAGGTTCTGGGGGATGGG - Intronic
1143345043 17:6243133-6243155 CTCTCCTTTTCCTGTGGGGTGGG - Intergenic
1143377458 17:6475214-6475236 CTCTGCTTCATCTGTGGGCTGGG - Intronic
1143663879 17:8345100-8345122 TTCTCCCTCTTCTTTGGGGGTGG + Intronic
1144061855 17:11590108-11590130 CCCTCCCCATTCTGTGTGATTGG - Intergenic
1145306266 17:21676954-21676976 CACGCCATCTGCTGTGGGATGGG - Intergenic
1146456902 17:33015661-33015683 TTCTCCCCCTGCTGTGAGATGGG + Intronic
1146660049 17:34659609-34659631 CTCTCCTTTTTCTCTGAGATGGG - Intergenic
1146675287 17:34769153-34769175 CTCTAGAGCTTCTGTGGGATTGG - Intergenic
1146997557 17:37334353-37334375 CTTTCCCTCTTCTTGGGGACAGG - Intronic
1147855913 17:43479772-43479794 CTCTCCACCTTCTGTGGAAATGG - Intergenic
1148177480 17:45579828-45579850 TTCCCCCTCTTCTGTAGAATAGG - Intergenic
1148990200 17:51659328-51659350 CTCTCCCTGTGGTTTGGGATTGG + Intronic
1151305644 17:73261293-73261315 GTCTCTCTCTTCTGTGGCTTCGG - Intronic
1151417144 17:73973902-73973924 CTCTCCCTCTCCTGTCGGCTTGG + Intergenic
1151990465 17:77570957-77570979 TTCTCCCTCTTCTTCTGGATGGG + Intergenic
1153993608 18:10421266-10421288 CTTTCCCAATCCTGTGGGATTGG - Intergenic
1155139517 18:23031562-23031584 CTTTTCCTCTTCTGTGAGACAGG - Intergenic
1155935233 18:31746441-31746463 CTCTCCCTTTCCTGGAGGATGGG + Intergenic
1156599619 18:38589729-38589751 CTCTCTCCCTTCTGTGTGATAGG + Intergenic
1156705185 18:39872925-39872947 CTTTCCTCCTTCTTTGGGATAGG - Intergenic
1159440845 18:68478084-68478106 CTCTCTCTCCTGTGTGAGATAGG - Intergenic
1160007284 18:75076691-75076713 CTCTGACTCTTCAGTGGGCTTGG - Intergenic
1160159966 18:76463584-76463606 CTCTCGCTCTTCTTGGGGATGGG + Intronic
1162743399 19:12786133-12786155 CTCTCCCACCTCTGTGGTTTGGG - Intronic
1162777894 19:12990538-12990560 CCCTCCCTCTTCTGGGGCAGCGG + Intergenic
1162864829 19:13537860-13537882 CTCTCTCTCTTGTGTGAGAGGGG - Intronic
1163328684 19:16621989-16622011 TTCCCTCTCTGCTGTGGGATGGG - Intronic
1164567643 19:29339353-29339375 AACTCCCTCTTCTTTGGCATGGG - Intergenic
1165538632 19:36471697-36471719 CTCTCCCTACACTGTGGGGTAGG + Intronic
1168689070 19:58366200-58366222 CTCTCCCTCTCCTGGAGGCTGGG + Intergenic
926509658 2:13759055-13759077 CTTACCCTCTTCATTGGGATTGG + Intergenic
927194865 2:20540159-20540181 CTCACCCTCTTCTCTGGCCTGGG - Intergenic
927990002 2:27441341-27441363 CTCTCCATCCTCTGAGGGAAAGG - Intronic
928324042 2:30305964-30305986 ATCCTCCTCTGCTGTGGGATGGG + Intronic
930563085 2:52984993-52985015 CTATCCCTGTTCTGTGGACTTGG - Intergenic
930826388 2:55700441-55700463 CTCTCTCTCTTTTGGGGGAGGGG + Intergenic
930868250 2:56143366-56143388 CTCTCCCTCATCTGTGCCTTTGG + Intergenic
932521186 2:72414524-72414546 CTGTCCCTGTTATGTGGAATTGG - Intronic
933632452 2:84673223-84673245 CTCTGCCTCTCCTGTTGGTTTGG - Intronic
933782292 2:85811127-85811149 CTCTCCCACTTCATTGGGGTGGG - Intergenic
933997456 2:87680258-87680280 CTCTCCCTCTGCTGAGGGACAGG - Intergenic
934163004 2:89270204-89270226 CTCTCACACTTCTGGAGGATGGG - Intergenic
934204268 2:89912320-89912342 CTCTCACACTTCTGGAGGATGGG + Intergenic
935802963 2:106716891-106716913 CTCTCCCTATTTTGTGCAATTGG - Intergenic
936296396 2:111270654-111270676 CTCTCCCTCTGCTGAGGGACAGG + Intergenic
936481109 2:112885562-112885584 CTCCCCCTCTGCTGTGGCTTTGG - Intergenic
936824561 2:116565535-116565557 CTCTCCCTCTTCTGGGATACAGG - Intergenic
937274237 2:120673803-120673825 CTCTCCTTCTGCTGAGGCATAGG - Intergenic
937971990 2:127557610-127557632 CTCTCCCCCTTTTGTGGTATTGG + Intronic
938170207 2:129069354-129069376 CTCTGCCTATCCTGTGGGTTGGG + Intergenic
940052121 2:149476198-149476220 CTCTCCCTTTACTGTGGGATTGG + Intergenic
946085894 2:217171122-217171144 CTTCCTCTTTTCTGTGGGATTGG + Intergenic
947307623 2:228764859-228764881 CTCTCCCTTTCCTGGGGGATGGG - Intergenic
947501388 2:230673867-230673889 CTCTCCCTCTCCTGTGGGTAAGG + Intergenic
947914283 2:233821686-233821708 ACTTCCCTCTTCTGTGGAATAGG + Intronic
947991237 2:234489225-234489247 CTGTCCATCCTCTGTGGGGTAGG + Intergenic
949059552 2:241949159-241949181 CTCTCCCTCTCGGGTGGGGTGGG - Intergenic
1169683576 20:8244785-8244807 CTCTCTCTTCTCTGTGGAATTGG - Intronic
1169785007 20:9350356-9350378 CTCTCACAAGTCTGTGGGATAGG + Intronic
1169898240 20:10526940-10526962 GTCTCTCTCTTTTTTGGGATGGG - Intronic
1169910685 20:10645292-10645314 CCCTCTGTCTTCTGTGGGAGGGG - Intronic
1170365993 20:15598936-15598958 CTCTCCCTCTTCTGCATAATAGG + Intronic
1170528996 20:17270627-17270649 CTCTCCCTTTTCAGGGGGAATGG - Intronic
1171446271 20:25206883-25206905 CAGTTCCTCTTCTGTAGGATGGG + Intronic
1171531504 20:25856415-25856437 CACGCCATCTGCTGTGGGATGGG - Intronic
1172188746 20:33048970-33048992 CCCTCCTTCCTCTGTGGCATGGG - Intergenic
1172970010 20:38866374-38866396 CTTTCCCTCATCTGTAGAATGGG + Intronic
1172995666 20:39068924-39068946 AGCTCTCTCTGCTGTGGGATGGG + Intergenic
1173072164 20:39778883-39778905 GCCTCCCTCTTCTGTGAGGTGGG - Intergenic
1173869120 20:46330683-46330705 CTCTCCCTGTCATGGGGGATGGG + Intergenic
1174556975 20:51402819-51402841 CTCCCCCTCTTCTGGGAGAAGGG + Intronic
1175749180 20:61483492-61483514 CTCCTCCTCTTCTCAGGGATGGG + Intronic
1179024087 21:37666120-37666142 CACTCCCGCTTCTGTGGTTTGGG - Intronic
1181179211 22:21055384-21055406 CCCTTCCTCCTCTGTGGGCTGGG + Intronic
1182344080 22:29647813-29647835 CTGTTCCTCTTCTGAGGGAGAGG + Intronic
1182881550 22:33738268-33738290 CTCCCTCTACTCTGTGGGATTGG - Intronic
1183085257 22:35483181-35483203 CTCCCACTCTCCTGTGGGGTAGG + Intergenic
1183187199 22:36298980-36299002 CTCCTCCTCTTCTGTGAGGTTGG + Exonic
1183914085 22:41102698-41102720 CTTTCCATCTTCTGTGGTAAGGG - Intronic
1184757037 22:46522728-46522750 CTCTCACCCTTCTGTAGGTTGGG - Intronic
1185028021 22:48426606-48426628 ATCTCCCTCTGCCGTGGGATGGG - Intergenic
1185174909 22:49321032-49321054 CTCTGACCCTCCTGTGGGATGGG + Intergenic
1185174924 22:49321088-49321110 CTCTGTCCCTCCTGTGGGATGGG + Intergenic
1185174939 22:49321144-49321166 CTCTGTCCCTCCTGTGGGATGGG + Intergenic
1185174954 22:49321200-49321222 CTCTGTCCCTCCTGTGGGATGGG + Intergenic
950183002 3:10928217-10928239 CTCTCCCTCCTCTGTGCCAGGGG + Intronic
950316125 3:12003873-12003895 TTCCCCCTCTTCTGGGGGCTGGG + Intergenic
950500159 3:13358632-13358654 GTCTACCTCTTCCCTGGGATAGG - Intronic
950741221 3:15053128-15053150 CTCTCCCTCTTGCGGGGGACGGG - Intronic
954149362 3:48649705-48649727 CTCTCCCTTGTCTCTGGGGTTGG + Intronic
954275109 3:49536801-49536823 CCCTGCCTCTTTTGGGGGATGGG + Intergenic
955028197 3:55190534-55190556 CTCTCCCTGATCTTTGGGAAAGG - Intergenic
955217797 3:56998744-56998766 CTTTCCCCCTACTGTGGAATTGG + Intronic
955336788 3:58093401-58093423 CTCTCCCTTCCCTGTAGGATGGG + Intronic
956732635 3:72210879-72210901 CTCTCCCTGTTCAGTGAGCTAGG - Intergenic
957083306 3:75657326-75657348 CTTTCTCCATTCTGTGGGATTGG + Intergenic
958864598 3:99486159-99486181 CTCTCTCTGATCTGTGGGAGGGG - Intergenic
959354098 3:105303648-105303670 CTGTCCCTCTTCTGTTGAAAGGG - Intergenic
959905178 3:111703327-111703349 CTCTCCCTCTTCTGTGGGATGGG + Intronic
960108353 3:113821521-113821543 CTCTCTCTCTTTTGTGATATGGG + Intergenic
960665831 3:120107970-120107992 CCTTCCCTCTTCTGGGTGATAGG - Intergenic
962708960 3:138069785-138069807 CCCTGCCTCTTCTGTGGCCTGGG - Intronic
965604328 3:170484231-170484253 ATCTCCCTCTTCTCTGGGGGTGG - Intronic
965965672 3:174486079-174486101 CACTTCCTCTTAAGTGGGATAGG + Intronic
966125828 3:176575371-176575393 CTATCCCTCTTTTGTGGGCCAGG + Intergenic
966668425 3:182499053-182499075 CTCTTCCTCCTCTGTGGTCTAGG + Intergenic
966692608 3:182757008-182757030 CTGTCCCTGTTCTGCAGGATGGG + Intergenic
967507728 3:190271880-190271902 ATTTCCAACTTCTGTGGGATTGG - Intergenic
968193848 3:196690791-196690813 CTCTCTCTCTTCCCTGGGGTGGG - Intronic
969271816 4:6108217-6108239 CTCTGCTGCTTCTGTGGCATAGG - Intronic
970815634 4:20152681-20152703 CTTTCCCTCTTCCATGGAATCGG - Intergenic
973610031 4:52627403-52627425 ATCTTCTTCTTCTGGGGGATTGG - Intronic
978692371 4:111529526-111529548 ACCTCCCTTTTCTGTGGGAGAGG + Intergenic
980625306 4:135367387-135367409 TTCTCACTCTTATGTGGGTTTGG - Intergenic
981342625 4:143639439-143639461 CACTCCCTCATCTGAGGGATGGG - Intronic
984597932 4:181692895-181692917 CTCTCCAGCTTCTGTGGCAAAGG - Intergenic
984932093 4:184857153-184857175 CTGTCTGTCTTCTGTGGGGTGGG - Intergenic
985341660 4:188961041-188961063 CTCTCCCCTTTCTGGAGGATGGG - Intergenic
985448236 4:190039593-190039615 CTTTCTCCATTCTGTGGGATTGG - Intergenic
992112419 5:73508666-73508688 CGCGCCCTCTTCCGTGGGAATGG + Intergenic
995125914 5:108576860-108576882 CTTTCCCTCTTCTCGGGGACAGG + Intergenic
995548220 5:113253708-113253730 ATCTCTGTCTTCTCTGGGATCGG - Intronic
995672731 5:114625294-114625316 CTCTCTCTCTCATGTGAGATAGG + Intergenic
997212702 5:132086794-132086816 CTCTCTCTCTTCTCAGGGCTAGG + Intergenic
999408469 5:151327915-151327937 CTCTCCCTCTTCTGTAAAATTGG + Intronic
1004685050 6:17935142-17935164 CTCTCTCTCATGAGTGGGATTGG + Intronic
1006118926 6:31792273-31792295 TTCTCCCTCTTCTCTGGTTTTGG + Exonic
1007259561 6:40554137-40554159 CTCTCCCACTTCGGGGGGACAGG - Intronic
1008698713 6:54073055-54073077 CTCACCCTTTTCTGTCTGATGGG + Intronic
1008885933 6:56431650-56431672 TTCTACCTCTTCTGTAGGAATGG + Intergenic
1008908873 6:56711736-56711758 CTCTCTCTCATATGTGGAATGGG - Intronic
1010506452 6:76665859-76665881 TTCTCCCTCTGCTGTGAGACTGG + Intergenic
1011751641 6:90460485-90460507 AACTCCCTCTTCTCTGGGAATGG + Intergenic
1012063929 6:94522800-94522822 CTCTCACTCTTCTGGAGGCTGGG - Intergenic
1012599385 6:101075862-101075884 CTCTCCAGCATCTGTGGGTTTGG - Intergenic
1013932808 6:115555017-115555039 CTCTCCCACTTCCCTGGCATTGG - Intergenic
1015275303 6:131377837-131377859 CTCTCCTTCTGCTGAGTGATTGG + Intergenic
1015305320 6:131700659-131700681 TTCTCCCACCTCTGTGTGATTGG - Exonic
1015597503 6:134879853-134879875 CTCTCCCTCTCCATTGGCATTGG + Intergenic
1017828684 6:158103657-158103679 CTCTCCGTGTTCTGTAGCATTGG + Intergenic
1018070213 6:160157954-160157976 ATCTCCTTCATCTGTGGAATGGG - Intronic
1018832746 6:167457465-167457487 CTGTCCCTTTTCAATGGGATGGG - Intergenic
1019018487 6:168897832-168897854 CTCTCTCTCTTTTGTGGGGAGGG + Intergenic
1022840523 7:34159690-34159712 TTCTCCCTCTTCTTTGGGAAAGG + Intergenic
1023460208 7:40387889-40387911 CTCTTCCTCATCTGTGAAATGGG - Intronic
1023820422 7:43977523-43977545 CTCTGCATCTGCTGAGGGATGGG + Intergenic
1025284204 7:57649358-57649380 CACGCCATCTGCTGTGGGATGGG - Intergenic
1027444320 7:78255185-78255207 CTCTACCTTTTCTGTGGGGAAGG - Intronic
1028588068 7:92470673-92470695 TTTTCCCTCTTCTCAGGGATAGG + Exonic
1029693452 7:102197774-102197796 CACGCCCTCTTCTGCGGGGTGGG - Intronic
1030186645 7:106768967-106768989 CTCTCCGTCTGCTGTGCGCTGGG - Intergenic
1030901828 7:115133689-115133711 CACTCACTCTTCTGAGTGATGGG + Intergenic
1033042161 7:137928563-137928585 TTCTCCCTCCTCCGTGGGTTGGG + Intronic
1033739431 7:144258886-144258908 TTCTCCCACCTCTGTGTGATTGG - Exonic
1035823542 8:2620495-2620517 CTCTCTCTCTTGTGAGAGATTGG + Intergenic
1036090924 8:5664458-5664480 CTCTGCCTCTTCTGTGCCTTGGG + Intergenic
1036120968 8:6017396-6017418 ATGTCCCTCTTGTATGGGATGGG - Intergenic
1038743031 8:30232244-30232266 CTCTCCTTCTTCCATAGGATAGG - Intergenic
1041870379 8:62627448-62627470 CTTTCCCTCTGCTGTGGTAAGGG + Intronic
1046227717 8:111306674-111306696 CTTTCCATGTTCTGTGTGATAGG + Intergenic
1046679038 8:117147052-117147074 CGCCCCCTTTTCTGTGGGCTTGG - Exonic
1047498870 8:125427503-125427525 CTCTGCCTCTTCTGAGAGACAGG - Intergenic
1047528615 8:125655586-125655608 CAGGCCATCTTCTGTGGGATGGG + Intergenic
1049141141 8:140955554-140955576 TTCTCCCTGTCCTGTGGGTTTGG - Intronic
1049708008 8:144051656-144051678 CTGTTCCCCCTCTGTGGGATGGG + Intronic
1052110114 9:24571826-24571848 TTCTCCCTTTTCTGGAGGATGGG + Intergenic
1052811870 9:33068356-33068378 CTCTCCCTCTTTCCTGGGAGAGG - Intronic
1054933961 9:70667114-70667136 CTCTCTCTCTTCTGTGTTAGAGG + Intronic
1054966431 9:71033067-71033089 CTCTCCATCTTAAGTGGGCTGGG + Intronic
1056401487 9:86231972-86231994 CTTTCCCTCCTCTGAGGGAAGGG - Intronic
1057262919 9:93596085-93596107 CTCTTCCTCTTCTGTGTGCTGGG + Intronic
1059176968 9:112176114-112176136 CTCTGTCTGTTCTGTGGAATTGG + Intergenic
1060532655 9:124357036-124357058 CTTTTCCTCATCTGTGAGATGGG - Intronic
1060718331 9:125955412-125955434 CTCTCCTTTTTCTGTAGAATAGG + Intronic
1060969053 9:127727579-127727601 CACTCCCTCAGCTGTGTGATGGG + Intronic
1062521380 9:136959371-136959393 CTGACCCTGTTCTGTGGGAGGGG - Intergenic
1062583192 9:137237214-137237236 CCCTCCCTCTGCTGTGTGGTCGG + Intergenic
1203441983 Un_GL000219v1:17313-17335 CTTTCTCTATTCTGTGGGATAGG - Intergenic
1203512791 Un_KI270741v1:136222-136244 CTTTCTCTATTCTGTGGGATAGG - Intergenic
1186273280 X:7913319-7913341 CTCTCTCCCTTCTCTGTGATGGG + Intronic
1187201938 X:17143395-17143417 CTCTCCCTCTGCTTTGGGGTAGG + Intronic
1187702224 X:21973688-21973710 CTCTCCCTATCCAGTGGGATGGG + Intronic
1188702591 X:33282846-33282868 GTCCCCATCTTCTGTTGGATAGG + Intronic
1189232186 X:39461159-39461181 CTCTCCCACCTCTGCAGGATAGG - Intergenic
1189750675 X:44218033-44218055 CCCTTCTTCTTCTGAGGGATAGG - Intronic
1190252348 X:48736804-48736826 ATCACCCTCTTCTGGGAGATGGG + Intergenic
1190784132 X:53627432-53627454 CTCTCCTTCTTGTGTAGTATTGG + Exonic
1194660149 X:96621956-96621978 GTCTCCCTTTTCTTTGGGACAGG + Intergenic
1195021876 X:100836864-100836886 CTCTGCCTCACTTGTGGGATAGG + Intronic
1197534486 X:127670942-127670964 CTCTCCATCATCAGTGGGAGTGG + Intergenic
1198682764 X:139200377-139200399 CTGTCCTTCTTCAGTAGGATAGG + Intronic
1199139010 X:144288008-144288030 CTCATCCTCTTCTGGGGGATGGG + Intergenic
1202182125 Y:22148565-22148587 TTCTCCCTCTTCTGTCGGATGGG - Intergenic
1202209235 Y:22437837-22437859 TTCTCCCTCTTCTGTCGGATGGG + Intergenic